Research Article

 

Spa Typing and Prevalence of Methicillin-Resistant Staphylococcus aureus Isolated in Retail Meats from Silchar, Assam, India

 

Sagolsem Yaiphathoi, Indu Sharma*

Department of Microbiology, Assam University, Silchar-788011, India.

 

Abstract | Background: The study involves the presence of Methicillin-resistant Staphylococcus aureus (MRSA) in animal food origin which is a growing concern as their presence makes them highly pathogenic and difficult to treat. Materials and methods: A total of 414 samples consisting of pork 50 (12.07%), chicken 86 (20.77%), beef 74 (17.87%), mutton 100 (24.15) and fish 104 (25.12%) were randomly purchased from different retail meat shops located at Silchar, Assam, India. All the isolates were tested against cefoxitin (30µg) and oxacillin (1µg) and classified as MRSA isolates. Spa typing of randomly selected 136 MRSA isolates was done followed by antimicrobial susceptibility testing. Results: Overall prevalence rate of MRSA was observed as 38/104 (36.53%) in fish, 33/86 (38.37%) in chicken, 26/74 (35.13%) in beef, 26/100 (26%) in mutton and 13/50 (26%) in pork. Of 136 MRSA isolates, only 12 isolates (8.82%) that harboured the spa gene amplified at 371bp. The frequently found environmental and human associated spa type t021 (clonal complex CC30, 83.33%) and a less frequently found spa type t448 (16.66%) were recovered from chicken, mutton, beef and pork. All tested MRSA isolates were found to be 100% resistant to cefoxitin followed by oxacillin and clindamycin but resistance to other antibiotics were variable. Conclusion: This is the first pilot study to be conducted in Silchar retail meat markets demonstrating the occurrence of MRSA in chicken, mutton, beef, pork and fish, thus, we strongly recommend regular monitoring and surveillance, implementation of good hygienic practices be incorporated to control the dispersion of MRSA to the community.

 

Keywords | MRSA, Retail meat, Spa-typing, Antibiotic resistance.

 

Received | February 03, 2018; Accepted | May 25, 2019; Published | June 30, 2019

*Correspondence | Indu Sharma, Department of Microbiology, Assam University, Silchar-788011, India; Email: drsharma7652@gmail.com

Citation | Yaiphathoi S, Sharma I (2019). Spa typing and prevalence of methicillin-resistant staphylococcus aureus isolated in retail meats from silchar, assam, india. Adv. Anim. Vet. Sci. 7(8): 694-700.

DOI | http://dx.doi.org/10.17582/journal.aavs/2019/7.8.694.700

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

 

Copyright © 2019 Yaiphathoi and Sharma. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Introduction

 

Methicillin-resistant Staphylococcus aureus were found responsible for causing several primary infections both in humans and animals (Reacher et al., 2000). Identification of MRSA strains in animal based food leads to strong concerns world widely regarding the food-borne contamination and their intoxicationssince MRSA has been procured in retail meats (Tauxe, 2002). S. aureus has the ability to become methicillin resistant by acquisition of mecA gene which encodes the protein 2a where penicillin gets binded with extremely low affinities for β-lactams. Thus several methods, based on phenotypes were developed to detect the methicillin resistance in S. aureus isolates, but the PCR based detection for mecA gene is applicable due to its high sensitivity and specificity (Chambers, 1997).

 

 

Both community-acquired and hospital-acquired MRSA infections are of global concern thereby making their treatment complicated due to resistance for various antimicrobials and strain variations. Emergence of Livestock-associated MRSA has become an important concern with animal contact which is considered as a leading source ofhuman MRSA infections caused by livestock-associated MRSA strains (Wulf et al., 2008). Besides animal-human transmission, livestock acts as an MRSA transporter into the communities which are situated nearby animal farms. Upon entering the food chain, they might serve as convenient vehicles for bacterial transfer, possibly threatening food handlers and consumers (Boost et al., 2013, Crombe et al., 2013; Monaco et al., 2013). ST398 is circulating

 

Table 1: Primers and PCR conditions used for Spa-typing of MRSA.

PCR Genes Primer sequence (5′–3′)

Denaturation Annealing Elongation No. of cycles
Temp

(°C)

Time

(sec)

Temp

(°C)

Time

(sec)

Temp

(°C)

Time

(min)

Simplex

spa-F

 

TAAAGACGATCCTTCGGTGAGC 94 40 61 30 72 2 30 cycles

spa-R

CAGCAGTAGTGCCGTTTGCTT

 

well in between animals and professionals (veterinarians, meat seller, employees of farm). Nevertheless, a strong suggestion for the existence of ST398 type with the exception of livestock which include retail meats has been seen because it was observed that some human infections cause by MRSA is not related with animal based food (Stinear et al., 2014) and recently reports have also supported the presence of ST398 in retail meats (Pu et al., 2009; Jackson et al., 2013). Since MRSA strains have now been well established in retail meats requires a strict epidemiological surveillance to understand the association between transmission dynamics and the risks factorsfrom animal production to slaughtering methods and its processing. Since, limited information in regard to prevalence and dissemination of MRSA spa types in retail meats in Silchar, Assam, India persists; the following study would therefore be highly helpful in assessing the involvement of risk factors to consumers and in monitoring the emergence and dissemination of MRSA virulence factors in retail meats.

 

Therefore, the aim of the study was to investigate the prevalence of MRSA spa types and antimicrobial resistance pattern in retail meats from Silchar, Assam, India.

 

Materials and Methods

 

Sample Collection and Processing

A total of 414 samples consisting of pork 50 (12.07%), chicken 86 (20.77%), beef 74 (17.87%), mutton 100 (24.15) and fish 104 (25.12%) were randomly purchased from different retail meat shops located at Silchar, Assam, India. The packed samples were kept at 4ºC in portable cooling containers during transportation, and microbiological analyses were conducted within 4 hours of purchase.For initial enrichment of the samples, 3g of the meat and fish samples was inoculated in 10 ml peptone water followed by incubation of 24 hours at 37°C. Growth was depicted in the broth by observing the turbidity. A loopful of sample was inoculated onto selective Manitol salt agar (MSA) and Baird-Parker agar (BP) (Hi-Media, India) followed by aerobic incubation of plates at 35°C for 24–48 h. MRSA colonies based on appearance (golden yellow-colour, round colonies in MSA andblack, convex, shiny colonies on Baird-Parker agar) were selected for further analysis. Confirmation of staphylococci by gram’s stain; catalase testing and coagulase tests were performed.

 

Methicillin-resistance was further screened by antimicrobial susceptibility testing, performed by following the Clinical and Laboratory Standard Institute guidelines (CLSI 2013). All the isolates were examined by using cefoxitin (30µg) and oxacillin (1µg) and classified as MRSA when the inhibition zone diameter was ≤ 17 mm for oxacillin and ≤ 22 mm for cefoxitin (Mehdi Goudarzi et al., 2016; Omer et al., 2017).

 

Spa-typing of MRSA

The spa-typing of randomly selected 136 MRSA isolates from positive samples was performed by using methods described earlier by Duarte et al. (2002). DNA templates were extracted from fresh MRSA culture by using the cell lysis by simple boiling method as described by Jose et al. (2016). The isolates were inoculated in Brain Heart Infusion Broth and incubated for 48 hours at 35°C, distributed in 1-ml aliquots into microfuge tubes, and was centrifuged at 14000 rpm for duration of five minutes. After discarding the supernatant, the pellets were subjected to DNA extraction protocols. After that in 200 µl of TE buffer (Tris-HCl [10 mM]: EDTA [1 mM]) suspension of bacterial pellets was done and subjected to 15 minutes of boiling. Immediately after boiling, the microfuge tubes were placed in an ice bath for 15 minutes and then at room temperature, the centrifugation step was done 14,000 rpm for 5 minutes. The supernatant containing 100µl DNA template was place to another sterile tube and kept at –20°C. The conditions of primer sequences and amplification are stated in Table 1. A volume of 20μl was used for the overall PCR reactions which included 2 μl of DNA template (primary PCR product). Oligonucleotide primers were used at final concentrations of 0.3 μM in reactions. The reaction mixture contained PCR Buffer, the 4deoxynucleoside triphosphate for a concentration of 0.2 mM and 0.75 U of Ampli Taq polymerase.

 

Antimicrobial Susceptibility Testing

Antibiotic susceptibility test was performed by using the disc agar diffusion method on Mueller–Hinton agar (CLSI, 2013).

 

Overnight suspensions of S. aureus cultures were balanced to turbidity of 0.5 McFarland standards. The swabs were dipped in suspensions and streaked onto Muller Hinton agar (MHA) and further it was kept to dry for some time. Then the antibiotic discs were suspended aseptically on the petri plates and after 24hrs of incubation period the results were interpreted. Further, the isolates were tested for antimicrobial agents representing the major class of antibiotics against: Ampicillin (10 µg), Cefoxitin (30µg), Gentamicin (10µg), Erythromycin (15µg), Clindamycin (2µg), Oxacillin (1µg), Levofloxacin (5µg), Nitrofurantoin (300µg), Ciprofloxacin (5µg) and Tetracycline (30µg).

 

Data Analysis

The data were entered into an excel spreadsheet for analysis. The variables used in the analysis were prevalence of spa type in each areas of sample collection that werecompared using chi‐square test (χ2) by using Microsoft excel (version 2007).

 

Results

 

Prevalence of Mrsain Animal Foods

Methicillin-resistant Staphylococcus aureus was found in 136 (32.85%) isolates of 414 samples. The overall prevalence rate of MRSA was observed as 38/104 (36.53%) in fish, 33/86 (38.37%) in chicken 26/74 (35.13%) in beef, 26/100 (26%) in mutton and 13/50 (26%) in pork. All MRSA isolates did not carry the spa genes. Amongst the 136 MRSA positive strains analysed, only 12 isolates (8.82%)harboured the spa gene which amplified at 371bp. The highest MRSA prevalence was observed in chicken samples 33/86 (38.37%) which was followed by fish 38/104 (36.53%), beef 26/74 (35.13%), mutton 26/100 (26%) and pork 13/50 (26%). MRSA prevalence rate was significantly different among all the animal based food samples collected.

 

Spa-typing of MRSA

Amongst the 136 MRSA isolates, two different spa types were detected (Table 2). The frequently found environmental and human associated spa type t021 (clonal complex CC30, 83.33%) was the very frequent spa type found in the three different animal based food that is, pork mutton, beef and a less frequently found Spa type t448 (16.66%), was recovered from chicken. In pork samples, spa type t021 was most prevalent (30.76% isolates) followed by beef s (15.38% isolates) and mutton samples (7.69% isolates). The spa type found in chicken sample was diverse from the other three samples which may be due to the presence of less common spa type t448 (6.06 % isolates).

 

Antimicrobial Susceptibility Testing

The prevalence of antimicrobial resistant in MRSA isolates within each different meat sampleswas notably different. All tested MRSA isolates were 100% resistant to cefoxitin followed by oxacillin and clindamycin but resistance to other antibiotics was variable. All MRSA isolates (100%)

 

Table 2: Identified Spa-types from various foods of animal origin

Sample Identification number Sample source Identified Spa-types

SP1 Pork t021
SP2 Mutton t021
SP3 Chicken t448
SP4 Beef t021
SP5 Pork t021
SP6 Mutton t021
SP7 Beef t021
SP8 Beef t021
SP9 Chicken t448
SP10 Pork t021
SP11 Pork t021
SP12 Beef

t021

 

Total isolates=136

Pork=4 spa types (30.76%)

Mutton=2 spa types (7.69%)

Chicken=2 spa types (6.06%)

Beef=4 spa types (15.38% )

 

isolated from five different meat samples (fish, chicken, pork, beef and mutton) were sensitive towards ciprofloxacin (100%). Isolates from fish, chicken and mutton were found to be sensitive towards gentamicin (71.32%) whereas isolates from pork and beef expressed their resistance (28.67%). Isolates from chicken, mutton and pork were resistant to erythromycin (52.94%), whereas, isolates from fish and beef were sensitive (47.05%). All isolates were found to be sensitive towards nitrofurantoin (90.44%), except isolates from pork expressed their resistance (9.55%). It was noted that ampicillin (56.61%) was resistant to MRSA isolates isolated from fish, pork and beef but sensitive to chicken and mutton (43.38%) isolates. Chicken, mutton and pork isolates showed resistance towards tetracycline (52.94%) whereas isolates from fish and beef were observed to be sensitive (47.05%) for the same. Further, levofloxacin was sensitive towardsfish, chicken and mutton isolates (71.32%) whereas isolates from pork and beef (28.67%) resulted into intermediate sensitivity. Overall results revealed that isolates from pork showed the highest resistance and isolates from fish showed the least resistance.

 

Data Analysis

Significant differences in the prevalence of spa types from different areas of sample collections were observed where the P-value ≤0.05 was considered as statistically significant at 95% confidence interval.

 

Discussion

 

Contaminated foods of animal origin have been represented as a source of MRSA infection forhumans (Lee, 2003) which are now a major global health issues. The cause of the severity of their illnesses (Livermore, 2000) relies on poising risk of incidence of Community associated MRSA (CA-MRSA) and Livestock associated MRSA (LA-MRSA) infections due to increased developing countries (Doufour et al., 2002). The first MRSA infection was described in 1961 (Jevons, 1961) and since then, human infections caused by multi-drug-resistant MRSA have being on raise (Waness, 2010) including MRSA infections from contaminated retail meats (de Boer et al., 2009; Pu et al., 2009; Buyukcangaz et al., 2013). Besides these, MRSA have also raised serious concerns anddrawn attentions though beinga critically important human pathogen, in disseminating its potential capability of infection and colonization in human by the animal based foods as a source.

 

This research was focused on the MRSA prevalence in animal food origin which included chicken, beef, mutton, pork and fish and it describes the various impacts on the MRSA prevalence in retail animal foods. The present study observed the overall prevalence rate of MRSA as 38/104 (36.53%) in fish, 33/86 (38.37%) in chicken, 26/74 (35.13%) in beef, 26/100 (26%) in mutton and 13/50 (26%) in pork. The findings of this study revealed that prevalence of MRSA in chicken (38.37%) was higher in comparison to other animal foods (Kwoji et al., 2017). In North East India, generally birds are kept on deep-litter system (Kwoji et al., 2017) where control measures for diseases and pathogen dissemination are usually not practiced by most of the private poultry raisers and further add to this there is indiscriminate misuse or overuse of antibiotics for promoting growth and prophylactics in poultry holders and other food animals without in consultation and prescription with the veterinarians (Broens et al., 2012). This has been commonly practised over time thus constituting reservoirs as a threat to other related infections and diseases (Rodrı´guez Noriega et al., 2010). Poultry farmers can be colonized by MRSA CC398 (Herve et al., 2017). Elevated rates of MRSA carriage were disclosed too in the workers of poultry slaughter house in the Netherlands, with much higher carriage rates among workers who contacted live birds that those who worked only with dead fowl (Herve et al., 2017). Besides this, other geographical differences and farm husbandry practices could have also influenced the MRSA prevalence rate observed in current study.In a previous study, it has been observed that the prevalence rate of S. aureus on traded pork products were ranging from 12% to 59.7% (Hanson et al., 2011, Waters et al., 2011, Hanning et al., 2012, Pu et al., 2009, Bhargava et al., 2011, Kelman et al., 2011,O’Brien etal., 2012) and the results from the present study show similar findings to that of the previous published reportssince S. aureus was found on 26% of pork products.The prevalence rate of S. aureus in traded beef products from other studies has shown a range from 20% to 37% while theS. aureus prevalence rate of retail beef from this study was observed at 35.13%. The reason could be the usage of different beef products in this study while comparing to other studies (Jackson et al., 2013).

 

Presently, it has been reported that contamination in aquaculture systems could be the possible reason for such high prevalence rates of MRSA in fish along with possible cross‐contamination of the meat handlers to some extend while processing. As stated in earlier findings about the antibiotic usage in animal tissue and their meat products, similar such uses of antibiotics have also been incorporated indiscriminately to promote aquaculture or the fishery industry (Lipsitch et al., 2002) here at North East India.

 

Further the prevalence rate in mutton was observed in 26% of the meat samples from the present study, but recent studies have shown that among 717 sheep meat samples, a minimum of 6 that is 0.8% were detected as positive for MRSA (Quddoumi et al., 2006) in Jordan while in Nigeria another study was conducted, in clinical and non‐clinical swab samples and reported about the isolation frequency of S. aureus from healthy sheep nasal samples was 56·2% (Bamaiyi and Aniesona, 2013) and no MRSA were isolated. Such differences in this study could be possibly due to higher contamination rates in retail than in slaughter samples and the increased number of operations the meat of sheep has been subjected to along with the hygienic‐sanitary profile of food handlers which is often unacceptable in terms of health status, personal hygiene practices, and habits, thus, raising the risk of cross contamination in the handled food (Campos et al.,2009; Hammad et al., 2012; Kamal et al., 2013; Ferreira et al., 2014).

 

We identified 12 spa types from 136 isolates isolated from chicken, pork, mutton and beef. The predominant spa types among the MRSA isolates (t012) represented more than 7.35% of all the MRSA isolates. The presence of t021 spa type in three different animal based foods that is pork, beef and mutton were environmental and human associated spa types which belong to clonal complex CC30. This spa type can cause infection bycolonizing in humans especially in areas where high livestock farming is practised, thus making the environment vulnerable towards dissemination of infection between humans and the environment (Papadopoulos et al., 2018). Another spa type t448 detected in the current study from chicken was in accordance to a study conducted at Chicago where, spa typing disclosed that S. aureus ST88 spa genotypes including t448 were colonizing the animals which was also the lead cause of infection in male mice known as PGA(preputial gland adenitis) (Sun et al., 2018).

 

All tested MRSA isolates in our study were found to be resistant for a minimum of one antibiotic (Bravo et al., 2015). The differences in antibiotic resistance patterns could be due to regular continuous check on usage of antibiotics in foods of animal origin. Various countries have adopted some norms of regular surveillance on antibiotic usage and their doses but in Silchar (Assam) no such regulations are present to keep a strict vigilance or check on retail meat markets for handling antibiotics. Differences in the origin of meat samples and different geographic settings are added factors that contribute to such differences in the results. Sometimes possibilities of MRSA strains to obtain resistance gene through genetic mobile elements rather than antibiotics from other bacteria in the environment (Jamrozy et al., 2017) is also observed. Thus such type of research needs more attention as post antibiotic era is soon to approach. Hygiene and food safety practices in regard to food production from ‘farm to fork’ should be strictly followed in order to keep away MRSA from contaminating food.

 

Conclusion

 

The existence of MRSA in retail meats is of great public health concern as high transmission from raw meat to meat handlers may strengthen the health associated risk factors involving both animals and humans concerned. Thus, MRSA control by using whole genome sequence technology will help in differentiating among human and animal isolates and decrease colonization rate and risk factors to both animal and human health. Besides this, a regular monitoring and vigilance practices will be highly appreciated to keep a check on antibiotic resistance too.

 

Acknowledgement

 

We would like to thank the authorities of Assam University, Silchar, Assam, India for providing facilities in carrying out the present work.

 

Conflict of interest

 

None to declare.

 

Authors Contribution

 

Sagolsem Yaiphathoi: Performed all the experiments.

Dr. Indu Sharma: Manuscript writing and data compilation.

 

References

 

  • Abdalrahman LS, Fakhr MK (2015). Incidence Antimicrobial Susceptibility and Toxin Genes Possession Screening of Staphylococcus aureus in Retail Chicken Livers and Gizzards. Apr 21. 4(2):115-129. http://dx.doi.org/10.3390/foods4020115.
  • Abdelkarim, Waness (2010). Revisiting Methicillin-Resistant Staphylococcus aureus Infections. http://dx.doi.org/10.4103/0974-777X.59251
  • Anand KB, Agrawal P, Kumar S, Kapila K (2009). Comparison of cefoxitin disc diffusion test, oxacillin screen agar, and pcr for mecA gene for detection of MRSA. Indian J. Med. Microbiol. 27(1): 27-9.
  • Arshnee M, Marc S, Arzu FB, Keith EB, Anette L, David HL, Nicola JW, Nola L, Yvonne A, Robert S, Luca G (2006). Spa typing of methicillin-resistant Staphylococcus aureus isolated from domestic animals and veterinary staff in the UK and Ireland. http://dx.doi.org/10.1093/jac/dkl394
  • Bamaiyi PH, Aniesona AT (2013). Prevalence and antimicrobial susceptibility patterns of bovine and ovine Staphylococcus aureus isolates in Maiduguri, Nigeria. Adv. Anim. Vet. Sci. 1: 59–64.
  • Bhargava K, Wang X, Donabedian S, Zervos M de RL, Zhang Y (2011). Methicillin-resistant Staphylococcus aureus in retail meat, Detroit, Michigan, USA. Emerg. Infect. Dis. 17:1135–1137.
  • Bidya S, Winny S, Samuel VR, Bharat MP, Tribhuban MM (2014). High Prevalence of Panton-Valentine Leukocidin (PVL) Genes in Nosocomial-Acquired Staphylococcus aureus Isolated from Tertiary Care Hospitals in Nepal. Volume 2014, Article ID 790350, 7 pages. http://dx.doi.org/10.1155/2014/790350.
  • Boost MV, Wong A, Ho J, O’Donoghue M (2013). Isolation of methicillin-resistant Staphylococcus aureus (MRSA) from retail meats in Hong Kong. http://dx.doi.org/10.1089/fpd.2012.1415.
  • Bose S, Khodke M, Basak S, Mallick SK (2009). Detection of Biofilm Producing Staphylococci: Need of the Hour. (3):1915-1920.
  • Bravo CN, Toufeer M, Weese SJ, Diarra MS, Deckert AE, Reid-Smith R, Aslam M (2015). Prevalence of methicillin-resistant Staphylococcus aureus in Canadian commercial pork processing plants. http://dx.doi.org/10.1111/jam.13024.
  • Broens EM (2012). Longitudinal study on transmission of MRSA CC398 within pig herds. BMC Vet. Res. 8, 58 (2012).
  • Buyukcangaz E, Velasco V, Sherwood JS, Stepan RM, Koslofsky RJ, Logue CM (2013). Molecular typing of Staphylococcus aureus and methicillin-resistant S. aureus (MRSA) isolated from animals and retail meat in North Dakota, United States. http://dx.doi.org/10.1089/fpd.2012.1427
  • Campos AKC, Cardonha MAS, Pinheiro LBG, Ferreira NR, Azevedo PRM, Stamford TLM (2009)Assessment of personal hygiene and practices of food handlers in municipal public schools of Natal, Brazil. Food Contl. 20:807–10.
  • Chambers HF (1997). Methicillin Resistance in Staphylococci: Molecular and Biochemical Basis and Clinical Implications. p. 781–791.
  • Charlene RJ, Johnnie AD, John BB (2013). Prevalence and Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from Retail Meat and Humans in Georgia. http://dx.doi.org/10.1128/JCM.03166-12
  • ClSI Guidelines 2013 Antimicrobial Susceptibility Testing
  • Crombe F, Argudín MAVanderhaeghen WHermans KHaesebrouck FButaye P (2013). Transmission Dynamics of Methicillin-Resistant Staphylococcus aureus in Pigs. http://dx.doi.org/10.3389/fmicb.2013.00057
  • Cuny C, Friedrich A, Kozytska S, Layer F, Nübel U, Ohlsen K, Strommenger B, Walther B, Wieler L, Witte W (2010). Emergence of methicillin-resistant Staphylococcus aureus (MRSA) in different animal species.  (2-3):109-17. http://dx.doi.org/10.1016/j.ijmm.2009.11.002. Epub 2009 Dec 16.
  • de BE, Zwartkruis NJT, Wit B, Huijsdens XW, de NAJ, Bosch T, van ORA, Vila A, Heuvelink AE (2009). Prevalence of methicillin-resistant Staphylococcus aureus in meat.  134 (1-2): 52-6. http://dx.doi.org/10.1016/j.ijfoodmicro.2008.12.007. Epub 2008 Dec 13.
  • Dharm RB, Lina MC, Gopal N, Kush K, Abhishek G, Shishir G, Dwij RB (2016). Association of Panton Valentine Leukocidin (PVL) genes with methicillin resistant Staphylococcus aureus (MRSA) in Western Nepal: a matter of concern for community infections (a hospital based prospective study). http://dx.doi.org/10.1186/s12879-016-1531-1
  • Doungue T, Gaurav K (2017). Prevalence of Staphylococcus aureus in Retail Chicken meat Samples in Jalandhar, Punjab. Res. J. Pharm. Tech. 10(1): January 2017.
  • Duarte CO, Hermínia de L (2002). Multiplex PCR Strategy for Rapid Identification of Structural Types and Variants of the mec Element in Methicillin-Resistant Staphylococcus aureus.http://dx.doi.org/10.1128/AAC.46.7.2155–2161.2002.
  • Dufour PGillet YBes MLina GVandenesch FFloret DEtienne JRichet H (2002). Community-acquired methicillin-resistant Staphylococcus aureus infections in France: emergence of a single clone that produces Panton-Valentine leukocidin. http://dx.doi.org/10.1086/342576
  • Fatima K, Indu S, Meher R, Tariq M, Sharma SC (2011). Detection of biofilm formation in Staphylococcus aureus. Does it have a role in Treatment of MRSA Infections? http://dx.doi.org/10.3923/tmr.2011.116.123
  • Ferreira JS, Costa WLR, Cerqueira ES, Carvalho JS, Oliveira LC, Almeida RCC (2014)Food handler‐associated methicillin‐resistant Staphylococcus aureus in public hospitals in Salvador, Brazil. Food Contl. 37:395–400.
  • Gillet Y, Issartel B, Vanhems P, Fournet JC, Lina G, Bes M, Vandenesch F, Piémont Y, Brousse N, Floret D, Etienne J (2002). Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immune-competent patients. 2002 2. 359 (9308):753-9. http://dx.doi.org/10.1016/S0140-6736(02)07877-7.
  • Hammad AM, Watanabe W, Fujii T, Shimamoto T (2012)Occurrence and characteristics of methicillin‐resistant and susceptible Staphylococcus aureus and methicillin‐resistant coagulase‐negative staphylococci from Japanese retail ready‐to‐eat raw fish. Intl. J. Food Microbiol. 156:286–9.
  • Hanning I, Gilmore D, Pendleton S, Fleck S, Clement A, Park SH, Scott E, Ricke SC (2012). Characterization of Staphylococcus aureus isolates from retail chicken carcasses and pet workers in Northwest Arkansas. J. Food Prot. 75:174–178.
  • Hanson BM, Dressler AE, Harper AL, Scheibel RP, Wardyn SE, Roberts LK, Kroeger JS, Smith TC (2011). Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J. Infect. Public Health. 4:169–174.
  • Herve DT, Kumar G (2017). Prevalence of Staphylococcus aureus in Retail Chicken meat Samples in Jalandhar, Punjab. https://doi.org/10.5958/0974-360X.2017.00058.0
  • Jackson CR, Johnnie AD, John BB (2013). Prevalence and Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from Retail Meat and Humans in Georgia. https://doi.org/10.1128/JCM.03166-12
  • Jamrozy D, Coll F, Mather AE, Harris SR, Harrison EM, MacGowan A, Karas A, Elston T, Török ME, Parkhill J, Peacock SJ (2017). Evolution of mobile genetic element composition in an epidemic methicillin-resistant Staphylococcus aureus: temporal changes correlated with frequent loss and gain events. https://doi.org/10.1186/s12864-017-4065-z.
  • Jevons MP (1961). ‘Celbenin’-resistant Staphylococci. British Med. J. 1: 124-125.
  • Jose CRJ, Ronaldo T, Bruna FS, Aline M de O, Fernando de GS, Francine FDS, Nayara AA, Vanerli B (2016). Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk. http://dx.doi.org/ 10.5433/1679-0359.2016v37n5p3069.
  • Kamal RM, Bayoumi MA, Abd El, Aal SF (2013). MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini –survey. Food Contl. 33:49-53.
  • Kamana B, Kalyan Rai, Dhiren SL, Hemanta K (2018). Food-borne bacterial pathogens in marketed raw meat of Dharan, eastern Nepal. https://doi.org/10.1186/s13104-018-3722-x
  • Kamelia Osman, Jihan B, Khalid SAM, Ihab MIM, Ashgan MH, Zeinab MS, Amin G, Usama HAS, Ahmed O, Aalaa S (2016). Prevalence of the antibiotic resistance gene in coagulase positive and negative Staphylococcus in chicken meat retailed to consumers. http://dx.doi.org/10.3389/fmicb.2016.01846
  • Kelman A, Soong YA, Dupuy N, Shafer D, Richbourg W, Johnson K, Brown T, Kestler E, Li Y, Zheng J, McDermott P, Meng J (2011). Antimicrobial susceptibility of Staphylococcus aureus from retail ground meats. J. Food Prot. 74: 1625–1629.
  • Kwoji ID, Tambuwal FM, Abubakar MB, Yakubu Y, Bitrus AA, Jauro S (2017). Occurrence of methicillin resistant Staphylococcus aureus in chickens and farm personnel in Sokoto, North-western Nigeria. http://doi.org/10.5455/javar.2017.d220 .
  • Kwon NH, Park KT, Jung WK, Youn HY, Lee Y, Kim SH, Bae W, Lim JY, Kim JY, Kim JM, Hong SK, Park YH (2006). Characteristics of Methicillin resistant Staphylococcus aureus isolated from chicken meat and hospitalized dogs in Korea and their epidemiological relatedness. 305-311.
  • Lee JH (2003). Methicillin (Oxacillin)-Resistant Staphylococcus aureus Strains Isolated from Major Food Animals and Their Potential Transmission to Humans. http://dx.doi.org/10.1128/AEM.69.11.6489-6494.2003.
  • Lina G, Piemont Y, Godail GF, Bes M, Peter MO, Gauduchon V, Vandenesch F Etienne J (1999). Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumoniaClin. Infect. Dis29:1128–1132.
  • Lipsitch M, Singer RS, Levin BR (2002). Antibiotics in agriculture: when is it time to close the barn door? Proc. Natl. Acad. Sci. 99:5752–4.
  • Livermore DM (2000). Antibiotic resistance in staphylococci. http://dx.doi.org/10.1016/S0924-8579(00)00299-5
  • Mazumder PB, Das P (2016). Prevalence of Staphylococcus in raw meat samples in Southern Assam, India. IOSR Journal of Agriculture and Veterinary Science (IOSR-JAVS), e-ISSN: 2319-2380, p-ISSN: 2319-2372. 9(1): 23-29.
  • Mehdi G, Maryam F, Hossein G, Mehdi A, Sima SS (2016). Spa Typing of Staphylococcus aureus Strains Isolated from Clinical Specimens of Patients with Nosocomial Infections in Tehran, Iran. http://dx.doi.org/10.5812/jjm.35685
  • Monaco MPedroni PSanchini ABonomini AIndelicato APantosti A (2013). Livestock-associated methicillin-resistant Staphylococcus aureus responsible for human colonization and infection in an area of Italy with high density of pig farming..https://doi.org/10.1186/1471-2334-13-258.
  • Mulders MN, Haenen AP, Geenen PL, Vesseur PC, Poldervaart ES, Bosch T, Huijsdens XW, Hengeveld PD, Dam DWD, Graat EA, Mevius D, Voss A, Van DGAW (2010). Prevalence of livestock-associated MRSA in broiler flocks and risk factors for slaughterhouse personnel in The Netherlands. Epidemiol. Infect. 138(5): 743-55.
  • Nam HM, Lee AL, Jung SC, Kim MN, Jang GC, Wee SH, Lim SK (2011). Antimicrobial susceptibility of Staphylococcus aureus and characterization of methicillin-resistant Staphylococcus aureus isolated from bovine mastitis in Korea. Foodborne Pathog. Dis. 8(2):231–8.
  • Narvaez CB, Toufeer M, Weese SJ, Diarra MS, Deckert AE, Reid RS, Aslam M (2016). Prevalence of methicillin-resistant Staphylococcus aureus in Canadian commercial pork processing plants. http://dx.doi.org/10.1111/jam.13024
  • Nelisiwe M, Oliver TZ, Samson M (2017). Genetic characterisation of antimicrobial resistance and virulence genes in Staphylococcus aureus isolated from commercial broiler chickens in the Durban metropolitan area, South Africa. http://dx.doi.org/10.4102/ jsava.v88i0.1416.
  • O’Brien AM, Hanson BM, Farina SA, Wu JY, Simmering JE, Wardyn SE, Forshey BM, Kulick M, Wallinga DB, Smith TC (2012). MRSA in conventional and alternative retail pork products. PLoS One, 7:e30092. http://dx.doi.org/10.1371/journal.pone.0030092.
  • Omer MAI, Naser EB , Omran FO , Magzoub AM (2017). Assessment of methicillin resistant Staphylococcus aureus detection methods: analytical comparative study. http://dx.doi.org/10.11604/pamj.2017.27.281.9016.
  • Papadopoulos P, Papadopoulos T, Angelidis AS, Kotzamanidis C, Zdragas A, Papa A, Filioussis G, Sergelidis D (2018). Prevalence, antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. http://dx.doi.org/10.1016/j.ijfoodmicro.2018.11.007.
  • Pu S, Han F, Ge B (2009). Isolation and Characterization of Methicillin-Resistant Staphylococcus aureus Strains from Louisiana Retail Meats. Appl. Environmen. Microbiol. Pp. 265–267. http://dx.doi.org/10.1128/AEM.01110-08
  • Quddoumi SS, Bdour SM, Mahasneh AM (2006). Isolation and characterization of methicillin‐resistant Staphylococcus aureus from livestock and poultry meat. Ann. Microbiol. 56: 155–161.
  • Reacher MH, Shah A, Livermore DM, Wale MC, Graham C, Johnson AP (2000). Bacteraemia and antibiotic resistance of its pathogens reported in England and Wales between 1990 and 1998: trend analysis. Brit. Med. J. 320, 213e216.
  • Riesen A, Perreten V (2009). Antibiotic resistance and genetic diversity in Staphylococcus aureus from slaughter pigs in Switzerland. 151(9):425-31. http://dx.doi.org/10.1024/0036-7281.151.9.425
  • Rodrı´guez-Noriega E, Seas C, Guzma´n-Blanco M, Mejı´a C, Alvarez C, Bavestrello L, Zurita J, Labarca JM, Luna CM, Salles MJC, Gotuzzo E (2010). Evolution of Methicillin-Resistant Staphylococcus aureus Clones in Latin America. Int. J. Infect. Dis. 2010; 14(7):560–566. https://doi.org/10.1016/j.ijid.2009.08.018.
  • Sathish G, Kurunchi CD (2017). Can methicillin-resistant Staphylococcus aureus prevalence from dairy cows in India act as potential risk for community-associated infections? A review. http://dx.doi.org/10.14202/vetworld.2017.311-318
  • Scott JW, Richard RS, Joyce R, Brent A (2010). Methicillin-resistant Staphylococcus aureus (MRSA) contamination of retail pork, Can. Vet. J. 51:749–752.
  • Shuaihua P, Feifei H, Beilei G (2009). Isolation and Characterization of Methicillin-Resistant Staphylococcus aureus Strains from Louisiana Retail Meats. http://dx.doi.org/10.1128/AEM.01110-08.
  • Smith DL, Harris AD, Johnson JA, Silbergeld EK, Morris JGJ (2002). Animal antibiotic use has an early but important impact on the emergence of antibiotic resistance in human commensal bacteria. Proc. Natl. Acad. Sci. USA. 99: 6434–6439. pmid:11972035. https://doi.org/10.1073/pnas.082188899
  • Som SC, Michael O (2013). Improved understanding of factors driving methicillin-resistant Staphylococcus aureus epidemic waves. Clin. Epidemiol. 5: 205–217. https://doi.org/10.2147/CLEP.S37071
  • Stinear TPHolt KEChua KStepnell JTuck KLCoombs GHarrison PFSeemann THowden BP (2014). Adaptive change inferred from genomic population analysis of the ST93 epidemic clone of community-associated methicillin-resistant Staphylococcus aureushttps://doi.org/10.1093/gbe/evu022.
  • Sun Y, Emolo C, Holtfreter S, Wiles S, Kreiswirth B, Missiakas D, Schneewind O (2018). Staphylococcal Protein A Contributes to Persistent Colonization of Mice with Staphylococcus aureus. https://doi.org/10.1128/JB.00735-17.
  • Tauxe RV (2002). Emerging foodborne pathogens. Sep 15; 78(1-2):31-41.
  • Van dBIV, Van CBA, Haenen A, Broens EM, Van dWPJ, Van dBMJ, Huijsdens XW, Kluytmans JA, Van DGAW, Tiemersma EW (2009). Methicillin-resistant Staphylococcus aureus in people living and working in pig farms. Epidemiol. Infect. 137(5):700-8. https://doi.org/10.1017/S0950268808001507
  • Waness A (2010). Revisiting Methicillin-Resistant Staphylococcus aureus Infections. https://doi.org/10.4103/0974-777X.59251.
  • Waters AE, Contente CT, Buchhagen J, Liu CM, Watson L, Pearce K, Foster JT, Bowers J, Driebe EM, Engelthaler DM, Keim PS, Price LB (2011). Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin. Infect. Dis. 52: 1227–1230. https://doi.org/10.1093/cid/cir181
  • Wulf MW, Tiemersma E, Kluytmans J, Bogaers D, Leenders AC, Jansen MW, Berkhout J, Ruijters E, Haverkate D, Isken M, Voss A (2008). MRSA carriage in healthcare personnel in contact with farm animals. https://doi.org/10.1016/j.jhin.2008.06.006
  • WHO (2014). Antimicrobial resistance: global report on surveillance Geneva, Switzerland. Pp 257.
  •