Short Communication
Allelic Diversity of the Endangered Taro White Cattle Population from Bali using BoLA Microsatellite Loci
I Nyoman Sulabda1*, I Nengah Wandia2, I Ketut Puja3
1Veterinary Physiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Bali, Indonesia; 2Veterinary Anatomy Laboratory, Faculty of Veterinary Medicine, Udayana University, Bali, Indonesia; 3Veterinary Genetics and Reproduction Technology Laboratory, Faculty of Veterinary Medicine, Udayana University, Bali, Indonesia.
Abstract | Taro white cattle is an indigenous and endangered cattle population in Taro village, Bali and only inhabiting restricted areas in forests of Taro village. Current population are 57 head. To provide basic information concerning allele and locus in BoLA gene, the BoLA microsatellite loci (DRB3 and BM1815) were used to evaluate allel diversity using 18 samples of Taro white cattle. Genetic variability was low, with observed heterozygosity and expected heterozygosity for locus BM1815 was 0.778 and 0.51, and for DRB3 was 0.556 and 0.478, respectively. Moreover, the polymorphic information content (PIC) for these two microsatellite was 0.397 for BM1815 and 0.413 for DRB3. The Taro white cattle showed low level of genetic diversity. This result would be used as an initial guide for conservation decisions in future for survival of this valuable genetic resource. The alleles identified from the present study should be further confirmed by sequencing.
Keywords | Taro white cattle, Microsatellite, BoLA, Allel, Heterozygosity
Received | September 15, 2021; Accepted | October 20, 2021; Published | December 15, 2021
*Correspondence | I Nyoman Sulabda, Veterinary Physiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Bali, Indonesia; Email: n.sulabda@unud.ac.id
Citation | Sulabda IN, Wandia IN, Puja IK (2022). Allelic diversity of the endangered taro white cattle population from bali using bola microsatellite loci. J. Anim. Health Prod. 10(1): 16-20.
DOI | http://dx.doi.org/10.17582/journal.jahp/2022/10.1.16.20
ISSN | 2308-2801
Copyright © 2022 Sulabda et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
INTRODUCTION
In Bali, apart from popular Bali cattle, there are small population of cattle inhabiting restricted areas in forests of Taro village. Taro white cattle is one of local cattle breed in Bali which tropically well adapted to local environment and raised by farmers in limited area of Taro village, district of Tegalalang, Gianyar Regency (Oka et al., 2020). The local people named these cattle as Taro white cattle due to their white skin and coat color. Because of its appearance as albino, this animal can be easily distinguished from Bali cattle. While it is known that Bali cattle is derived from Bos sondaicus (banteng), the origin of Taro white cows is not clearly understood as yet.
The Taro white cattle, sanctified by the surrounding communities and Balinese society utilized them for rituals and ceremonial purposes only. Its habitat is only in the forest of Taro village. The population of this breed is 57 heads. Now the breed status is at critical level and close to extinction according to FAO (2007).
Current management guidelines for populations at risk frequently emphasize genetic uniqueness over genetic diversity (Funk et al., 2012). Genomic tools can contribute to genetic resource management through accurate estimation of genetic uniqueness (Pertoldi et al., 2014). Genetic characteristics of breed and the uniqueness of genetic characteristics in a given population can be determined by performing molecular analysis, particularly microsatellite (Wang et al., 2021). Microsatellite is quite useful for breed identification as it can not be influenced by environmental factors. Moreover, microstellite has been known to be highly polymorphic for population due to variation in the number of repeated nucleotides (Wang et al., 2021). Currently, microstellite is a genetic marker mostly used for molecular characterization. Some of molecular studies applying microsatellite involves analysis in plant genetics studies (Vieira et al., 2016), population structure (Moges et al., 2016), prediction of genetic variation and inbreeding (Radko et al., 2021), pedigree recording (Ivankovic et al., 2021), and individual identity (Miller et al., 2016).
Microsatellite is a simple and short sequence (particularly a di-, tri-, and tetranucleotide) reappearing in sequence in eukaryote genome (Sathishkumar et al., 2011). It is also known as simple sequence repeats (SSRs) or simple tandem repeats (STRs). Polymorphism of microsatellite allele occurs due to difference in the number of motive copies (unit of sequence). Such polymorphism is often regarded as simple sequence length polymorphisms (SSLPs) or short tandem repeat polymorphisms (STRPs). Change in one nucleotide sequence results in movement of pair of bases and improper pair of bases. Improper pair of bases can be corrected by reducing or adding the number of motives or units of sequence. This in turn leads to polymorphism of microsatellite allele (Vieira et al., 2016).
Microsatellite-based mapping of major histocompatibility complex (MHC) is very useful in selection and can provide important information about variations and kin relationship in a given population (Bastos-Silviera et al., 2008). The high microsatellite polymorphism is a good molecular marker in study of population genetics. Such a high polymorphism results in different expression variation for each individual. Thus, microsatellite is a genetic marker that provides information about variation of allele at gene locus (Abdul-Muneer, 2014).
One of the factors that determine individual resistance to diseases is MHC known as bovine leucocyte antigen (BoLA) in cattle (Bohórquez et al., 2019). MHC can be classified into 3 classes: Class I, II, and III (Bastos-Silveira et al., 2008). MHC is characterized by large number of alleles at each locus and big difference in the number of amino acids in each allele. Bastos-Silviera et al. (2008) reported that there are significant differences in allele variation in microsatellite locus region of BoLA gene in eight species of cattle in Portugal, and these differences could be related to their physical position in the chromosome. Moreover, it was reported that BM1815 locus is situated in the side of BoLA-DRB gene and located at 5’. This locus has a low variation. Meanwhile, DRB3 and DRBP1 loci are located in the intron of BoLA gene and DRB3 gene can be considered as the most polymorphic gene amongst genes of BoLA (Takeshima et al., 2018; Mandefro et al., 2021).
The present study was aimed to characterize the genetic profile of Taro white cattle to get information that can be useful for designing breeding strategies to preserve genetic variation of the Taro white cattle.
MATERIALS AND METHODS
Animal
This experiment was conducted at Taro village and was the part of Taro white cattle conservation project. Cattle used in this study were 3-4 years old. The age was determined by examination of the teeth. Age was estimated by the stage of eruption of permanent pair of incisors. All animals were clinically examined prior to use. The study was approved by the Animal Ethics Committee, Faculty of Veterinary Medicine Udayana University.
DNA Exatraction
Eighteen cattle of Taro white breed were genotyped for BoLA microsatellite loci. Approximately 10 mL blood samples were collected from each animal. The DNA from blood samples were then extracted using QIAamp DNA Mini Kit (Qiagen).
BoLA microsatellite loci Amplification
Two microsatellites that were previously mapped along the BoLA genome segment on chromosome 23 (DRB3 and BM1815) were amplified (Table 1). Amplification reaction in PCR was carried out in PCT 100 (MJ Research, Inc., Watertown, Mass, USA) as much as 30 cycles with procedure as follow: denaturation at 94oC (35 seconds), annealing at 54oC for 35 seconds, and extension at 72oC for 35 second. Result of amplification was separated with gel bis-acrylamide 6% (electrophoresis) and visualization was done using silver staining. DNA typing was performed by measuring migration length of each DNA tape in gel compared to DNA tape standard 100 bp ladder.
Data analysis
Frequency of allele, the number of allele, HO (observed heterozygosity, and He (expected heterozygosity) was calculated using microsatellite toolkit v.3.1 program (Park, 2001).
RESULTS AND DISCUSSION
During the data collection, the total population of Taro white cattle was 57 head. From the total population, 18 cattle were used as sample. The cattle used in the study
Table 1: Primers used for the amplification of microsatellite markers in the Taro white cattle.
| No. | Primer | Chromosome | Sequence | Reference |
| 1 | DRB3 | 23 |
F: 5’GAGAGTTTCACTGTGCAG 3: R: 5’CGCGAATTCCCAGAGTGAGTGAAGTATCT 3’ |
|
| 2 | BM1815 | 23 |
F: 5’AGAGGATGATGGCCTCCTG 3’ R: 5’CAAGGAGACAAGTCAAGTTCCC 3’ |
Table 2: Analysis of heterozygosity and polymorphism information content (PIC) in Taro white cattle using BoLA microsatellite markers.
| Microsatellite marker | No.of Alleles | Allele size range (bp) | PIC | Heterozygosity | |
| Observed | Expected | ||||
| DRB3 | 4 | 166-172 | 0.413 | 0.556 | 0.478 |
| BM1815 | 3 | 152-176 | 0.397 | 0.778 | 0.51 |
showed the same exterior characteristics with white coat color (Figure 1). The cattle were reared intensively in colony houses and fed with grasses twice daily.
Figure 1: Taro white cattle.
A total of 7 alleles were detected in BoLA microsatellite of Taro white cattle. The BoLA microsatellite loci was polymorphic, with 4 alleles in BoLA DRB3 microsatellite locus and 3 alleles in BoLA BM1815 microsatellite locus. The mean number of allele, the size of allele, PIC, the HO and He were presented in Table 2.
The average expected hetrozygosity for DRB3 microsatellite locus in Taro white cattle was 0.478, and average observed hetrozygosity was 0.556. The mean polymorphism information content was 0.413. The average expected hetrozygosity for BM1815 microsatellite locus in Taro white cattle was 0.51, and average observed hetrozygosity was 0.778. The mean polymorphism information content was 0.397
In the present study, two locus of BoLA microsatellite were used to evaluate the genetic characteristic of Taro white cattle. Two microsatellites were found polymorphic. The number of alleles in this study were found lower as compared to number of alleles reported in Bangladesh, Ethiopian, and Korean cattle (Mandefro et al., 2021), also in South American Zebu cattle populations (Takeshima et al., 2018). The BoLA locus DRB3 microsatellite exhibited 59 alleles (Mandefro et al., 2021), 46 alleles in South American Zebu cattle populations (Takeshima et al., 2018), and 13 alleles detetcted in the BoLA locus BM1815 microsatellite (Bastos-Silveira et al., 2008).
Average values of HO and He in Taro white cattle were lower than those reported Bastos-Silveira et al. (2008) in Portuguese cattle breeds. Lower values of expected homozygosity in comparison with the observed homozygosity were found. High value of observed homozygosity than the expected homozygosity (van Haeringen et al., 1999) has been reported for DRB3 micrsatellite in cattle. Absence of gene flow, may explain the results observed for this breed
The average PIC value for BM1815 and DRB3 locus was 0.397 and 0.413, respectively. The low value of PIC may indicate the homogeneity of population. The PIC value for Taro white cows noted in the current study was lower compared to PIC value (0.533) in Bali cattle (Puja et al., 2013). Thus, the present findings reveal that population of Taro white cows in their natural habitat at village Taro, Tegallalang, Bali is homogeneous. The low PIC values for markers suggested their no usefulness for genetic polymorphism studies and linkage mapping programes.
A prerequisite for a structured and sustainable animal breeding and conservation programs is the identification of genetic diversity within the population (Unal et al., 2021). The distribution of genetic diversity is an important prerequisite for successful conservation strategies (Ivanova et al., 2021). This research which was carried out by BoLA microsatellite loci, showed that within population genetic diversity was low. The loss of genetic diversity resulted to a reduction of the effective population size and high levels of inbreeding (Radko and Podbielska, 2021). This situation indicates the difficulty of breeding programs and genetic conservation programs for this population. Therefore, this conservation effort requires scientific production systems to increase production, without losing significant genetic structure of this animal.
Conclusions
Taro white cattle have low level of genetic diversity and absence of genetic flow. This result, may be useful for conservation decisions in future. The alleles identified from the present study should be further confirmed by sequencing.
Conflict of Interests
The authors declare that they have no competing interests.
Acknowledgement
The authors thanks to the Ministry of Research, Technology and Higher Education of the Republic of Indonesia for financial support by Hibah Perguruan Tinggi.
Authors Contribution
All of the authors equally contributed and approved the manuscript.
References