<!DOCTYPE html>
<html xmlns="http://www.w3.org/1999/xhtml">
	<head>
		<meta charset="utf-8" />
		<title>JAHP_MH20150523120527_ Ahmed et al</title>
		<link href="http://nexusacademicpublishers.com/uploads/cssfiles/JAHP_MH20150523120527_ Ahmed et al.css" rel="stylesheet" type="text/css" />
	</head>
    <style> 
.pt{
	background-color:#BDF;
	border-top-style:solid;
	
	border-top-color:#d3d1d1;
	border-top-width: 1px;
	border-bottom-style: solid;
	
	border-bottom-color:#d3d1d1;
	border-bottom-width: 1px;
	height:90px;
	}
	  
.img_display{
	float:left;
	padding:5px;
	
	}
	.img_text{ padding:10px;
		
		}
		
		.Txt_Dis{
			padding-right:20px;
			}
</style>

<body id="JAHP_MH20150523120527_-Ahmed-et-al" xml:lang="en-GB">
		<div class="Basic-Text-Frame">
			<p class="Type-of-Article">&nbsp;</p>
			<p class="Type-of-Article">&nbsp;</p>
			<p class="Type-of-Article"><span class="CharOverride-1">Research Article</span></p>
		  <p class="Type-of-Article">&nbsp;</p>
    </div>
        <!-- Start CrossMark Snippet v1.5 -->
<meta name="dc.identifier" content="doi:10.14737/journal.jahp/2015/3.3.54.58">
<script type="text/javascript" src="http://smithandfranklin.com/js/jquery.min.js" ></script>
<script type="text/javascript" src="http://smithandfranklin.com/js/jquery-ui.min.js" ></script>
<script type="text/javascript" src="https://crossmark.crossref.org/javascripts/v1.5/crossmark.min.js"></script>
              <a id="open-crossmark" href="javascript:" style="padding: 3px 0 13px 0; float:right;"><img style="border: 0; display: none;" id="crossmark-icon" src="https://crossmark.crossref.org/images/crossmark_button.png" /></a>
              <div id="crossmark-dialog"  title="">
              <!-- the external CrossMark data is loaded inside this iframe -->
              <iframe id="crossmark-dialog-frame" frameborder="0"></iframe>
              </div>
			<!-- End CrossMark Snippet -->

<div class="Basic-Text-Frame">
			<p class="title- ParaOverride-1">&nbsp;</p>
			<p class="title- ParaOverride-1">Hepatocyte Nuclear Factor 4-<span class="CharOverride-2">α</span>, Glucocorticoid Receptor and Heat Shock Protein 70 mRNA Expression during Embryonic Development in Chickens</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Authors ParaOverride-1">&nbsp;</p>
			<p class="Authors ParaOverride-1"><span class="CharOverride-3">Abdelkareem Abdallah Ahmed</span><span class="CharOverride-4">1</span><span class="CharOverride-3">*, Hassan Hussein Musa</span><span class="CharOverride-4">2</span><span class="CharOverride-3">, Amal Zakaria Sifaldin, Taha Hussein Musa</span><span class="CharOverride-4"> 3</span><span class="CharOverride-3">, Jaafar Sulieman Fedail</span><span class="CharOverride-4">4</span></p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Affiliations ParaOverride-1"><span class="CharOverride-6">1</span>Department of Physiology and Biochemistry, Faculty of Veterinary Sciences, University of Nyala, Nyala, Sudan; <span class="CharOverride-6">2</span>Faculty of Medical Laboratory Sciences, University of Khartoum, Khartoum, Sudan; <span class="CharOverride-6">3</span>Key Laboratory of Environmental Medicine, Ministry of Education, School of Public Health, Southeast University, Nanjing 210009, Jiangsu, China; <span class="CharOverride-6">4</span>Department of Biology, Faculty of Education, University of Nyala, Nyala, Sudan.</p>
		</div>
		<div>
			<p class="Abstract ParaOverride-1">&nbsp;</p>
			<p class="Abstract ParaOverride-1"><span class="CharOverride-7">Abstract</span> | Glucocorticoids (GCs) play a vital role during embryonic development. Hepatocyte nuclear factor 4 alpha (HNF4<span class="CharOverride-2">α</span>) is a transcription factor that has been shown to be crucial for hepatocyte differentiation and development of the liver.&#160;Here we aimed to disclose the differences in embryonic expression of hepatic HNF4-<span class="CharOverride-2">α</span>, glucocorticoid receptor (GR) and heat shock protein 70<span class="CharOverride-7"> </span>(HSP70) between slow and fast growing broiler chickens embryos. Fast-growing chicken and slow-growing chicken eggs were incubated and liver samples from the embryonic development at embryo 10 (E10), (E14), (E18) and day 1 post hatch (D1) were collected. Quantitative PCR used to measure hepatic mRNA expression of GR, HSP70 and HNF4-<span class="CharOverride-2">α</span>. Hepatic mRNA expression of HNF4-<span class="CharOverride-2">α</span> was significantly higher in fast-growing chicken embryos at all the embryonic stages investigated. However, hepatic GR mRNA expression was significantly higher in fast-growing chicken embryos only on E10. Hepatic mRNA expression of HSP70 was significantly (P&lt;0.05) higher in fast-growing chicken embryos at E18 and D1 posthatch stages. Our data may provide the first evidence that hepatic expression of HNF4-<span class="CharOverride-2">α</span>, GR and HSP70 differs between fast-growing and slow-growing chickens embryos, which may account to some extent for the breed disparities in embryonic development.</p>
		  <p class="Abstract ParaOverride-1">&nbsp;</p>
			<p class="Abstract ParaOverride-1"><span class="CharOverride-7">Keywords </span>| Chicken embryo, GR, HSP70, HNF4-<span class="CharOverride-2">α</span>, Liver</p>
		  <p class="Abstract ParaOverride-1">&nbsp;</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Editor----Citation"><span class="CharOverride-8">Editor</span> | Asghar Ali Kamboh, Sindh Agriculture University, Tandojam, Pakistan.</p>
			<p class="Editor----Citation"><span class="CharOverride-7">Received</span> | May 23, 2015; <span class="CharOverride-7">Revised</span> | June 11, 2015; <span class="CharOverride-7">Accepted</span> | June 15, 2015; <span class="CharOverride-7">Published</span> | June 23, 2015&#9;&#9;</p>
			<p class="Editor----Citation"><span class="CharOverride-7">*Correspondence</span> | Abdelkareem Abdallah Ahmed, University of Nyala, Nyala, Sudan; <span class="CharOverride-7">Email:</span> kareemo151@gmail.com</p>
			<p class="Editor----Citation"><span class="CharOverride-7">Citation</span> | Ahmed AA, Musa HH, Sifaldin AZ, Musa TH, Fedail JF (2015). Hepatocyte nuclear factor 4-<span class="CharOverride-2">α</span>, glucocorticoid receptor and heat shock protein 70 mRNA expression during embryonic development in chickens. J. Anim. Health Prod. 3(3): 54-58.</p>
			<p class="Editor----Citation"><span class="CharOverride-8">DOI</span><span class="CharOverride-9"> | </span><a href="http://dx.doi.org/10.14737/journal.jahp/2015/3.3.54.58"><span class="Hyperlink">http://dx.doi.org/10.14737/journal.jahp/2015/3.3.54.58</span></a></p>
			<p class="Editor----Citation"><span class="Editor---Citation CharOverride-7">ISSN</span> | 2308–2801</p>
			<p class="Editor----Citation"><span class="CharOverride-8">Copyright </span>© 2015 Ahmed et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Heading-1--Introduction----">&nbsp;</p>
		  <p class="Heading-1--Introduction----">Introduction</p>
			<p class="Caps-on-First-Para ParaOverride-1">&nbsp;</p>
			<p class="Caps-on-First-Para ParaOverride-1"><span class="_idGenDropcap-1">A</span><span>vian </span>eggs contain a variety of maternal derived steroid hormones, which mediate maternal influences on offspring phenotype (<a href="#Gil-D--2008-"><span class="Hyperlink">Gil, </span><span class="Hyperlink CharOverride-11" xml:lang="en-GB">2008</span></a><span class="CharOverride-12" xml:lang="en-GB">; </span><a href="#Groothuis-TG--et-al.--2005"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Groothuis et al., 2005</span></a><span class="CharOverride-12" xml:lang="en-GB">). Glucocorticoids (GCs) are known to play vital roles in embryonic development and mediate maternal effects in mammals (</span><a href="#Gmelin-E--et-al.--1985"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Gmelin et al., 1985</span></a><span class="CharOverride-12" xml:lang="en-GB">) and birds (</span><a href="#Spencer-KA--et-al.--2009"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Spencer et al., 2009</span></a><span class="CharOverride-12" xml:lang="en-GB">). GCs exert their effects by binding to glucocorticoid receptor (GR) and mineralocorticoid receptors (MR) that belong to the steroid receptor family. GR and MR are present in almost every cell of the body; regulate expression and functions of many genes that controlling a variety of biological functions (</span><a href="#Shohami-E--et-al.--1995-."><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Shohami et al., 1995</span></a><span class="CharOverride-12" xml:lang="en-GB">). In birds, the CORT is the principal GCs, and its metabolism occurs mostly in liver (</span><a href="#Kucka-M--et-al.--2006-"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Kucka et al., 2006</span></a><span class="CharOverride-12" xml:lang="en-GB">). Cloning and characterization of GR in pituitary and tissues during chick embryonic development have been reported (</span><a href="#Kwok-AH--et-al.--2007"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Kwok et al., 2007</span></a><span class="CharOverride-12" xml:lang="en-GB">; </span><a href="#Porter-TE--et-al.--2007"><span class="Hyperlink CharOverride-11" xml:lang="en-GB">Porter et al., 2007</span></a><span class="CharOverride-12" xml:lang="en-GB">). However, the relevant information between breeds is scare.</span></p>
		  <p class="Caps-on-First-Para ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">Stressful condition increased synthesis of a group of stress related proteins that belonging to the heat shock protein (HSP) families. HSP classified into 6 families (HSP 10 to 100) based on their molecular weight (<a href="#van-Eden-W--et-al.--2005"><span class="Hyperlink">van Eden et al., 2005</span></a>). Heat shock proteins carry out essential housekeeping functions and are molecular chaperones which are vital for the survival of cells. Among these families, Hsp-70 is necessary for protein folding cell and translocation (<a href="#Mayer-MP--Bukau-B--2005"><span class="Hyperlink">Mayer and Bukau, 2005</span></a>). The HSP70 is expressed in both normal and is highly stress-inducible cells, and it has been extensively studied as stress biomarker (<a href="#El-Golli-Bennour-E--Bacha-H--2011"><span class="Hyperlink">El Golli-Bennour and Bacha, 2011</span></a>). Stress responses are start by activating corticotropin-releasing factor (<a href="#Shekhar-A--et-al.--2005-"><span class="Hyperlink">Shekhar et al., 2005</span></a>), which recruits endocrine, immune, and neural systems (<a href="#Kamimura-D--et-al.--2013"><span class="Hyperlink">Kamimura et al., 2013</span></a>). The type and level of stress determines the outcome, but constant responses are stimulated by of the hypothalamic pituitary adrenal axis. The ontogeny of temperature-regulated heat shock protein 70 synthesis in preimplantation bovine embryos has been reported (<a href="#Edwards-JL--et-al.--1997"><span class="Hyperlink">Edwards et al., 1997</span></a>). Upto date, the breed differences of HSP70 chicken embryo is not reported.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">Hepatocyte nuclear factor 4<span class="CharOverride-2">α</span> (HNF-4<span class="CharOverride-2">α</span>) is a liver-enriched transcription factor which, plays a crucial role in the tissue-specific expression of a variety of genes (<a href="#Sladek-FM--et-al.--1990"><span class="Hyperlink">Sladek et al., 1990</span></a>). In addition, HNF-4<span class="CharOverride-2">α</span> has a critical role in the adult liver, where it controls a number of genes involved in stress response such as endoplasmic reticulum stress-dependent gene (<a href="#Arensdorf-AM--et-al.--2013"><span class="Hyperlink">Arensdorf et al., 2013</span></a>) It has been implicated the function of HNF-4<span class="CharOverride-2">α</span> in early endodermal development (<a href="#Duncan-SA--2000-"><span class="Hyperlink">Duncan, 2000</span></a>). The absence of HNF-4<span class="CharOverride-2">α</span> in mouse embryos resulted in embryonic death before completing gastrulation due to the dysfunction of visceral endoderm system (<a href="#Chen-WS--et-al.--1994-"><span class="Hyperlink">Chen et al., 1994</span></a>). In gene expression patterns, the role of HNF-4<span class="CharOverride-2">α</span> was found to be vital for subsequent steps of hepatocyte differentiation (<a href="#Li-J--et-al.--2000-"><span class="Hyperlink">Li et al., 2000</span></a>). In humans, heterozygous mutations of HNF-4<span class="CharOverride-2">α</span> were strongly associated with so called maturity onset diabetes of the young 1 (<a href="#Yamagata-K--et-al.--1996-"><span class="Hyperlink">Yamagata, 1996</span></a>). However, the expression of HNF-4<span class="CharOverride-2">α</span> during embryonic development in chicken and its association with egg deposition of CORT between slow and fast growing broiler chickens has not been investigated. Therefore, the objectives of this study were to investigate the expression of HNF-4<span class="CharOverride-2">α</span> and GR and HSP70 mRNA in the developing embryos of slow and fast growing chickens.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">Materials and Methods</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Breeder Eggs, Incubation and Tissue Sampling</p>
			<p class="Body-Text ParaOverride-1">Forty fertile eggs of slow-growing chicken (n=20) and the fast-growing chicken (n=20) were incubated at 37.5 ± 0.5°C and 60% relative humidity following standard settings for automatic turning and ventilation. The eggs were put side by side and distributed equally on different shelves in the incubator so as to minimize possible variations which may occur during the incubation period. The first day of incubation was assigned as embryonic day 1 (E1) and the day of hatching was assigned as day 1 (D1). On E10, E14, E18 and D1, liver samples (n= 10 per each breed) were collected. Liver samples were quickly frozen in liquid nitrogen then stored at −80°C for RNA extraction. </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">RNA Extraction and mRNA Quantification</p>
			<p class="Body-Text">The liver samples were ground with pestle and mortar in liquid N2 and a portion of approximately 50 mg was used for the RNA extraction using the TRIzol total RNA kit (Invitrogen, Biotechnology Co, Ltd, Carlsbad, CA, USA) according to the manufacturer’s instructions. To ensure that total RNA preparations were free of genomic DNA contamination, two methods were used. First, the total RNAs were treated with 10 U DNase I (RNase Free, D2215, Takara, Japan) for 30 min at 37°C, and were purified according to the manufacturer’s protocol. Second, the primers for the reference gene (<span class="CharOverride-2">β</span>-actin) were designed to span an intron, ensuring that any genomic DNA contamination can be reported easily by an extra product in the melting curves for real-time PCR. Real-time PCR was performed in an Mx3000P (Stratagene, USA) according to our previous publication (<a href="#Ahmed-AA--Ma-W--Ni-Y--Zhou-Q--Zhao-R--2014"><span class="Hyperlink CharOverride-14" xml:lang="en-US">Ahmed et al., 2014</span></a>). Mock RT and No Template Controls (NTC) were included to monitor the possible contamination of genomic and environmental DNA at the RT and PCR steps. A pooled sample made by mixing equal quantities of the RT products (cDNA) from all the samples was used for optimizing the PCR conditions and tailoring the standard curves for each target gene, and melting curves were performed to insure a single specific PCR product for each gene. The PCR products were sequenced to validate the identity of the amplicons. Primers specific for the HNF4<span class="CharOverride-2">α</span> and GR (<a href="#Table-1-"><span class="Hyperlink">Table 1</span></a>) were synthesized by Geneary, Shanghai, China. Chicken <span class="CharOverride-2">β</span>-actin was used as a reference gene for normalization purposes. The mRNA quantification was based on threshold cycles (Ct) rather than band densities in the quantitative <span class="CharOverride-19">real-time PCR. The method of 2</span><span class="CharOverride-20">−ΔΔCt</span><span class="CharOverride-19"> was used to analyze the real-time PCR data (</span><a href="#Livak-KJ--Schmittgen-TD--2001"><span class="Hyperlink CharOverride-21">Livak and Schmittgen, 2001</span></a><span class="CharOverride-19">).</span></p>
		  <p class="Body-Text">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Statistical Analysis </p>
			<p class="Body-Text ParaOverride-1">The relative quantitative data of gene expression were analysed by Two-way ANOVA using SPSS 16.0 for Windows followed by a least-significant difference (LSD) test for individual comparisons. Values of mRNA abundance are expressed as the fold change relative to the average value of one group. The data were expressed as mean ± SEM. A P-value &lt; 0.05 was considered significant. </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">Results</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Heading-2--History-in-MM- ParaOverride-1">Ontogeny of HNF4<span class="CharOverride-23">α</span>, GR and HSP70 in Fast Growing and Slow Growing Chicken Embryos Liver</p>
			<p class="Body-Text ParaOverride-1">In the present study, we reported the ontogeny of HNF-4<span class="CharOverride-2">α</span>, GR and HSP70. The HNF-4<span class="CharOverride-2">α</span> mRNA expression was significantly (P&lt;0.05) higher in fast-growing chicken embryos liver at all the embryonic stages investigated except E10 (<a href="#Figure-1-"><span class="Hyperlink">Figure 1A</span></a>). In contrast, GR mRNA expression was significantly (P&lt;0.05) higher in fast-growing chicken embryos liver at E10 but not on other stages (<a href="#Figure-1-"><span class="Hyperlink">Figure 1B</span></a>). However, the HSP70 mRNA expression was significantly (P&lt;0.05) higher in fast-growing chicken embryos liver at E18 and D1 (<a href="#Figure-1-"><span class="Hyperlink">Figure 1C</span></a>).</p>
			<p class="Body-Text ParaOverride-1"><span class="CharOverride-10"> </span></p>
			<p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-7"><a id="Table-1-"></a>Table 1:</span> Primers sequences used in Real-time PCR</p>
			<table width="658" height="269" class="Table-Style-1" id="table-1">
				<colgroup>
					<col />
					<col />
					<col />
					<col />
				</colgroup>
				<tbody>
					<tr class="_idGenTableRowColumn-1">
						<td width="75">
							<p class="Basic-Paragraph"><span class="CharOverride-15">Target genes</span></p>
						</td>
						<td width="146">
							<p class="Basic-Paragraph"><span class="CharOverride-15">Gen Bank accession number</span></p>
						</td>
						<td width="115">
							<p class="Basic-Paragraph"><span class="CharOverride-15">PCR products (bp)</span></p>
						</td>
						<td width="302">
							<p class="Basic-Paragraph"><span class="CharOverride-15">Primer sequences</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-2">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-16">β</span><span class="CharOverride-17">-actin</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">L08165</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">300</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">F : 5</span><span class="CharOverride-16">’</span><span class="CharOverride-17">- TGCGTGACATCAAGGAGAAG -3’</span></p>
							<p class="Basic-Paragraph"><span class="CharOverride-17">R : 5’- TGCCAGGGTACATTGTGGTA -3’</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-1">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">GR</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">DQ227738</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">102</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">F : 5’- CTTCCATCCGCCCTTCA -3’</span></p>
							<p class="Basic-Paragraph"><span class="CharOverride-17">R : 5’- TCGCATCTGTTTCACCC -3’</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-2">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">HNF4</span><span class="CharOverride-16">α</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">AY700581.1</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">116</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">F: 5’- GAGTGGGCCAAGTACATCCC -3’</span></p>
							<p class="Basic-Paragraph"><span class="CharOverride-17">R: 5’- TCGTTCCCTAGCAGCAAGAC -3’</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-1">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">HSP70</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">AY178443.1</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">230</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-17">F: 5’- GCGAGTGGCTGACTGACCA-3’</span></p>
							<p class="Basic-Paragraph"><span class="CharOverride-17">R: 5’-AAGTATGATGACCCCACA -3’</span></p>
						</td>
					</tr>
				</tbody>
			</table>
			<br>
            <div class="pt" > <a href="http://nexusacademicpublishers.com/uploads/figures/20150623212414.png" target="new"><img class="img_display" src="http://nexusacademicpublishers.com/uploads/figures/20150623212414.png" width="80" height="80"></a>
            
       <p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-7"><a id="Figure-1-"></a>Figure 1: </span><a href="http://nexusacademicpublishers.com/uploads/figures/20150623212414.png">Hepatic expression of HNF4<span class="CharOverride-2">α</span> (<span class="CharOverride-7">A</span>), GR (<span class="CharOverride-7">B</span>) and HSP70 (<span class="CharOverride-7">C</span>) mRNA in slow-growing and fast-growing broiler breeders’ embryos </a></p>
       </div>

			
		  <p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-13">Values are mean ± SEM; n=6/group; Different superscript letters on the bars indicate significantly different mean values at P&lt;0.05</span></p>
			
		  <p class="Heading-1--Introduction----">&nbsp;</p>
		  <p class="Heading-1--Introduction----">Discussion</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">Glucocorticoids (GCs) are known to play critical roles in embryonic development and maternal programming both in mammals and birds (<a href="#Gmelin-E--et-al.--1985"><span class="Hyperlink">Gmelin et al., 1985</span></a>; <a href="#Spencer-KA--et-al.--2009"><span class="Hyperlink">Spencer et al., 2009</span></a>). Heat shock proteins (HSPs), a molecular chaperones play a critical role in the protection of cells from extreme pathological, physiological, and environmental conditions (<a href="#Kiang-JG--Tsokos-GC--1998-."><span class="Hyperlink">Kiang and Tsokos, 1998</span></a>). HSPs increase glucocorticoid receptor (GR) activity in cells and implicate cross-talk between the heat shock and GR signal pathways. In the present study, fast-growing chicken embryo livers expressed high HSP70 mRNA than that of slow-growing broiler chicken embryo. Moreover, the fast-growing chicken embryo livers expressed high abundant HSP70 mRNA than that of slow-growing broiler chicken embryo. &#160;Based on our findings, we postulate that the differences in GR and HSP70 mRNA expression during the embryonic development may have a role in the embryonic development of the chick liver. Moreover, the differences in GR and HSP70 between these two chicken breeds during the embryonic development may explain the differences in stress response in life later.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text">Hepatocyte nuclear factor 4 alpha (HNF4<span class="CharOverride-2">α</span>) is crucial for the organization and maintenance of liver-specific gene expression. Here we reported for the first time that hepatic expression of HNF4<span class="CharOverride-2">α</span> was significantly abundant in fast growing broiler chicken embryos livers than that of slow growing breed. This could be due to the fact that HNF4<span class="CharOverride-2">α</span> play a critical role in liver morphogenesis (<a href="#Chen-WS--et-al.--1994-"><span class="Hyperlink">Chen et al., 1994</span></a>; <a href="#Zaret-KS--2000-"><span class="Hyperlink">Zaret, 2000</span></a>; <a href="#Zaret-KS--2002-"><span class="Hyperlink">Zaret, 2002</span></a>) differentiation (<a href="#Costa-RH--et-al.--2003-"><span class="Hyperlink">Costa et al., 2003</span></a>) and metabolism (<a href="#Gonzalez-FJ--2008"><span class="Hyperlink">Gonzalez, 2008</span></a>). Previous studies reported that dexamethasone (Synthetic GCs) mediated up-regulation of human&#160;CYP2A6&#160;involves the glucocorticoid receptor and increased binding of HNF4<span class="CharOverride-2">α</span> to the Proximal Promoter (<a href="#Onica-T--et-al.--2008"><span class="Hyperlink">Onica et al., 2008</span></a>). However, the precise cross-talk between HSP, GR and HNF4<span class="CharOverride-2">α</span> is currently unclear. Further studies are required to clarify the cross-talk between those stress and differentiation related genes.</p>
		  <p class="Body-Text">&nbsp;</p>
			<p class="Heading-1--Introduction----">Acknowledgments</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">The authors are highly grateful to Professor Zhao and Shi Fangxiong at the Nanjing Agricultural University for their support to conduct this research. </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">Conflict of  interests</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">There exisit not any conflict of interest exists.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">Authors’ contributions</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">For creating this article, Abdelkareem, Jaafar and Amal conducted the experiment while Taha and Hassan wrote and revised the manuscript.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">References</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
		
			  <li class="References ParaOverride-2" xml:lang="en-US"><a id="Ahmed-AA--Ma-W--Ni-Y--Zhou-Q--Zhao-R--2014"></a>Ahmed AA, Ma W, Ni Y, Zhou Q, Zhao R (2014). Embryonic exposure to corticosterone modifies aggressive behavior through alterations of the hypothalamic pituitary adrenal axis and the serotonergic system in the chicken. Hormon. Behav. 65: 97-105.</li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Arensdorf-AM--et-al.--2013"></a>Arensdorf AM, McCabe D, Kaufman D, Rutkowski RJ (2013). Temporal clustering of gene expression links the metabolic transcription factor HNF4alpha to the ER stress-dependent gene regulatory network. Front Genet. 4: 188. <a href="http://dx.doi.org/10.3389/fgene.2013.00188"><span class="Hyperlink">http://dx.doi.org/10.3389/fgene.2013.00188</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Chen-WS--et-al.--1994-"></a>Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, Prezioso VR, Bachvarova RF, Darnell JE (1994). Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev. 8: 2466-2477. <a href="http://dx.doi.org/10.1101/gad.8.20.2466"><span class="Hyperlink">http://dx.doi.org/10.1101/gad.8.20.2466</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Costa-RH--et-al.--2003-"></a>Costa RH, Kalinichenko VV, Holterman AX, Wang X (2003). Transcription factors in liver development, differentiation, and regeneration. Hepatology. 38: 1331-1347. <a href="http://dx.doi.org/10.1016/j.hep.2003.09.034"><span class="Hyperlink">http://dx.doi.org/10.1016/j.hep.2003.09.034</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Duncan-SA--2000-"></a>Duncan SA (2000). Transcriptional regulation of liver development. Dev. Dyn. 219: 131-142. <a href="http://dx.doi.org/10.1002/1097-0177(2000)9999:9999&lt;::AID-DVDY1051&gt;3.3.CO;2-E"><span class="Hyperlink">http://dx.doi.org/10.1002/1097-0177(2000)9999:9999&lt;::AID-DVDY1051&gt;3.3.CO;2-E</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Edwards-JL--et-al.--1997"></a>Edwards JL, Ealy AD, Monterroso VH, Hansen PJ (1997). Ontogeny of temperature-regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mol. Reprod. Develop. 48: 25-33. <a href="http://dx.doi.org/10.1002/(SICI)1098-2795(199709)48:1&lt;25::AID-MRD4&gt;3.0.CO;2-R"><span class="Hyperlink">http://dx.doi.org/10.1002/(SICI)1098-2795(199709)48:1&lt;25::AID-MRD4&gt;3.0.CO;2-R</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="El-Golli-Bennour-E--Bacha-H--2011"></a>El Golli-Bennour E, Bacha H (2011). Hsp70 expression as biomarkers of oxidative stress: Mycotoxins’ exploration. Toxicology. 287: 1-7. <a href="http://dx.doi.org/10.1016/j.tox.2011.06.002"><span class="Hyperlink">http://dx.doi.org/10.1016/j.tox.2011.06.002</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Gil-D--2008-"></a>Gil D (2008). Hormones in avian eggs: physiology, ecology and behavior. Adv. Study Behaviorss. 38: 337–398.</li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Gmelin-E--et-al.--1985"></a>Gmelin E, Draude K, Leichle P (1985). ECG-directed DSA of the pulmonary arteries--technic and initial clinical experiences. Rontgenblatter. 38: 17-21.</li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Gonzalez-FJ--2008"></a>Gonzalez FJ (2008). Regulation of hepatocyte nuclear factor 4 alpha-mediated transcription. Drug Metab. Pharmacokinet. 23: 2-7. <a href="http://dx.doi.org/10.2133/dmpk.23.2"><span class="Hyperlink">http://dx.doi.org/10.2133/dmpk.23.2</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Groothuis-TG--et-al.--2005"></a>Groothuis TG, Muller W, von Engelhardt N, Carere C, Eising C (2005). Maternal hormones as a tool to adjust offspring phenotype in avian species. Neurosci. Biobehav. Rev. 29: 329-352. <a href="http://dx.doi.org/10.1016/j.neubiorev.2004.12.002"><span class="Hyperlink">http://dx.doi.org/10.1016/j.neubiorev.2004.12.002</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Kamimura-D--et-al.--2013"></a>Kamimura D, Yamada M, Harada M, Sabharwal L, Meng J, Bando H, Ogura H, Atsumi T, Arima Y, Murakami M (2013). The gateway theory: bridging neural and immune interactions in the CNS. Front. Neurosci. 7: 204. <a href="http://dx.doi.org/10.3389/fnins.2013.00204"><span class="Hyperlink">http://dx.doi.org/10.3389/fnins.2013.00204</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Kiang-JG--Tsokos-GC--1998-."></a>Kiang JG, Tsokos GC (1998). Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol. Therap. 80: 183-201. <a href="http://dx.doi.org/10.1016/S0163-7258(98)00028-X"><span class="Hyperlink">http://dx.doi.org/10.1016/S0163-7258(98)00028-X</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Kucka-M--et-al.--2006-"></a>Kucka M, Vagnerova K, Klusonova P, Miksik I, Pacha J (2006). Corticosterone metabolism in chicken tissues: Evidence for tissue-specific distribution of steroid dehydrogenases. Gen. Comp. Endocrinol. 147: 377-383. <a href="http://dx.doi.org/10.1016/j.ygcen.2006.02.007"><span class="Hyperlink">http://dx.doi.org/10.1016/j.ygcen.2006.02.007</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Kwok-AH--et-al.--2007"></a>Kwok AH, Wang Y, Wang CY, Leung FC (2007). Cloning of chicken glucocorticoid receptor (GR) and characterization of its expression in pituitary and extrapituitary tissues. Poult. Sci. 86: 423-430. <a href="http://dx.doi.org/10.1093/ps/86.2.423"><span class="Hyperlink">http://dx.doi.org/10.1093/ps/86.2.423</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Li-J--et-al.--2000-"></a>Li J, Ning G, Duncan SA (2000). Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha. Genes Dev. 14: 464-474.</li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Livak-KJ--Schmittgen-TD--2001"></a>Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25: 402-408. <a href="http://dx.doi.org/10.1006/meth.2001.1262"><span class="Hyperlink">http://dx.doi.org/10.1006/meth.2001.1262</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Mayer-MP--Bukau-B--2005"></a>Mayer MP, Bukau B (2005). Hsp70 chaperones: cellular functions and molecular mechanism. Cell Mol. Life Sci. 62: 670-684. <a href="http://dx.doi.org/10.1007/s00018-004-4464-6"><span class="Hyperlink">http://dx.doi.org/10.1007/s00018-004-4464-6</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Onica-T--et-al.--2008"></a>Onica T, Nichols K, Larin M, Ng L, Maslen A, Dvorak Z, Pascussi JM, Vilarem MJ, Maurel P, Kirby GM (2008). Dexamethasone-mediated up-regulation of human CYP2A6 involves the glucocorticoid receptor and increased binding of hepatic nuclear factor 4 alpha to the proximal promoter. Mol. Pharmacol. 73: 451-460.</li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Porter-TE--et-al.--2007"></a>Porter TE, Ghavam S, Muchow M, Bossis I, Ellestad L (2007). Cloning of partial cDNAs for the chicken glucocorticoid and mineralocorticoid receptors and characterization of mRNA levels in the anterior pituitary gland during chick embryonic development. Domest. Anim. Endocrinol. 33: 226-239. <a href="http://dx.doi.org/10.1016/j.domaniend.2006.05.006"><span class="Hyperlink">http://dx.doi.org/10.1016/j.domaniend.2006.05.006</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Shekhar-A--et-al.--2005-"></a>Shekhar A, Truitt W, Rainnie D, Sajdyk T (2005). Role of stress, corticotrophin releasing factor (CRF) and amygdala plasticity in chronic anxiety. Stress. 8: 209-219. <a href="http://dx.doi.org/10.1080/10253890500504557 "><span class="Hyperlink">http://dx.doi.org/10.1080/10253890500504557</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Shohami-E--et-al.--1995-."></a>Shohami E, Bass R, Trembovler V, Weidenfeld J (1995). The effect of the adrenocortical axis upon recovery from closed head injury. J. Neurotrauma. 12: 1069-1077. <a href="http://dx.doi.org/10.1089/neu.1995.12.1069"><span class="Hyperlink">http://dx.doi.org/10.1089/neu.1995.12.1069</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Sladek-FM--et-al.--1990"></a>Sladek FM, Zhong WM, Lai E, Darnell JE (1990). Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev. 4: 2353-2365. <a href="http://dx.doi.org/10.1101/gad.4.12b.2353"><span class="Hyperlink">http://dx.doi.org/10.1101/gad.4.12b.2353</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Spencer-KA--et-al.--2009"></a>Spencer KA, Evans NP, Monaghan P (2009). Postnatal stress in birds: a novel model of glucocorticoid programming of the hypothalamic-pituitary-adrenal axis. Endocrinology. 150: 1931-1934. <a href="http://dx.doi.org/10.1210/en.2008-1471"><span class="Hyperlink">http://dx.doi.org/10.1210/en.2008-1471</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="van-Eden-W--et-al.--2005"></a>van Eden W, van der Zee R, Prakken B (2005). Heat-shock proteins induce T-cell regulation of chronic inflammation. Nat. Rev. Immunol. 5: 318-330. <a href="http://dx.doi.org/10.1038/nri1593"><span class="Hyperlink">http://dx.doi.org/10.1038/nri1593</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Yamagata-K--et-al.--1996-"></a>Yamagata K (1996). Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1). Nature. 384: 458-460. <a href="http://dx.doi.org/10.1038/384458a0"><span class="Hyperlink">http://dx.doi.org/10.1038/384458a0</span></a></li>
		  <li class="References ParaOverride-2" xml:lang="en-US"><a id="Zaret-KS--2000-"></a>Zaret KS (2000). Liver specification and early morphogenesis. Mech. Dev. 92: 83-88. <a href="http://dx.doi.org/10.1016/S0925-4773(99)00326-3"><span class="Hyperlink">http://dx.doi.org/10.1016/S0925-4773(99)00326-3</span></a></li>
				<li class="References ParaOverride-2" xml:lang="en-US"><a id="Zaret-KS--2002-"></a>Zaret KS (2002). Regulatory phases of early liver development: paradigms of organogenesis. Nat. Rev. Genet. 3: 499-512. <a href="http://dx.doi.org/10.1038/nrg837"><span class="Hyperlink">http://dx.doi.org/10.1038/nrg837</span></a></li>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
			
		</div>
	</body>
</html>
