<!DOCTYPE html>
<html xmlns="http://www.w3.org/1999/xhtml">
	<head>
		<meta charset="utf-8" />
		<title>AAVS_20150104_Wani et al</title>
		<link href="http://nexusacademicpublishers.com/uploads/cssfiles/AAVS_20150104_Wani et al.css" rel="stylesheet" type="text/css" />
	</head>
    <style> 
.pt{
	background-color:#BDF;
	border-top-style:solid;
	
	border-top-color:#d3d1d1;
	border-top-width: 1px;
	border-bottom-style: solid;
	
	border-bottom-color:#d3d1d1;
	border-bottom-width: 1px;
	height:90px;
	}
	  
.img_display{
	float:left;
	padding:5px;
	
	}
	.img_text{ padding:10px;
		
		}
		
		.Txt_Dis{
			padding-right:20px;
			}
</style>

<body id="AAVS_20150104_Wani-et-al" lang="en-GB">
		<div class="Basic-Text-Frame">
			<p class="Type-of-Article">&nbsp;</p>
			<p class="Type-of-Article"><span class="CharOverride-1">Research Article</span></p>
	</div>
		<div class="Basic-Text-Frame">
			<p class="title- ParaOverride-1">&nbsp;</p>
			<p class="title- ParaOverride-1">Immunosuppressive Effects of Chicken Infectious Anaemia Virus on T Lymphocyte Populations Using Flow Cytometry and Hematological Parameters During Experimental Subclinical Infection in Chicks</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Authors ParaOverride-1">&nbsp;</p>
			<p class="Authors ParaOverride-1"><span class="CharOverride-2">Mohd Yaqoob Wani</span><span class="CharOverride-3">1*</span><span class="CharOverride-2">, Kuldeep Dhama</span><span class="CharOverride-3">2</span><span class="CharOverride-2">,</span><span class="CharOverride-3"> </span><span class="CharOverride-2">Ruchi Tiwari</span><span class="CharOverride-3">3</span><span class="CharOverride-2">, Rajamani Barathidasan</span><span class="CharOverride-3">2</span><span class="CharOverride-2">, Yashpal Singh Malik</span><span class="CharOverride-3">4</span><span class="CharOverride-2">, Shambhu Dayal Singh</span><span class="CharOverride-3">2</span><span class="CharOverride-2">, Raj Kumar Singh</span><span class="CharOverride-3">5</span></p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Affiliations ParaOverride-1"><span class="CharOverride-4">1</span>Immunology Section, Division of Veterinary Biotechnology, <span class="CharOverride-4">2</span>Avian Diseases Section, Division of Pathology, Indian Veterinary Research Institute, Izatnagar (U.P.)-243 122, India; <span class="CharOverride-4">3</span>Department of Microbiology, College of Veterinary Sciences and Animal Husbandry, Uttar Pradesh Pandit Deen Dayal Upadhayay Pashu Chikitsa Vigyan Vishwa&#160;Vidyalaya Evam Go-Anusandhan Sansthan (DUVASU), Mathura (U.P.) -281 001, India; <span class="CharOverride-4">4</span>Division of Biological Standardization, Indian Veterinary Research Institute, Izatnagar (U.P.) -243 122, India; <span class="CharOverride-4">5</span>Indian Veterinary Research Institute, Izatnagar (U.P.), India.</p>
		</div>
		<div>
			<p class="Abstract ParaOverride-1">&nbsp;</p>
			<p class="Abstract ParaOverride-1"><span class="CharOverride-5">Abstract</span> | Chicken infectious anaemia virus (CIAV) is an economically important pathogen affecting poultry industry worldwide, and renders birds susceptible to secondary infections. The present study was designed to investigate the systemic immunosuppressive effects of CIAV on T lymphocytes bearing CD4 and CD8 receptors using flow cytometry and hematological parameters during experimental subclinical infection in chicks.<span class="CharOverride-5"> </span>Forty specific pathogen free (SPF) chicks of 6 weeks of age were randomly and equally divided into two groups. Infected group received 10<span class="CharOverride-4">4.5 </span>TCID<span class="CharOverride-6">50</span> of CIAV while control chicks were mock inoculated. All the chicks were regularly monitored for clinical signs, hematology parameters and CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+ </span>cell populations in spleen and blood. The experimental CIAV infection was confirmed by PCR testing of the tissue samples of experimental chicks, using<span class="CharOverride-5"> </span>VP2 gene specific primers, which yielded an expected amplicon size of 651 base pairs. The analysis of the hematological parameters showed significant decline in hematocrit value (PCV), total leukocyte count (TLC) and peripheral lymphocyte count (PLC) after 15 days post infection (dpi) but with no clinical signs of CIA. Flow cytometric analysis revealed that the percentage of CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> and CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> T cells significantly decreased in the virus infected chicks at 15 dpi both in the spleen and blood (p&lt;0.05). The results supported the fact that subclinical CIAV infections are also immunodepressive in nature; the virus replicates in primary lymphoid tissues and induces immunosuppression by decreasing both CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+</span> T cells in chicks. </p>
		  <p class="Abstract ParaOverride-1">&nbsp;</p>
			<p class="Abstract ParaOverride-1"><span class="CharOverride-5">Keywords </span>| Chicken infectious anaemia virus, Poultry, Immunosuppression, Flow cytometry, T lymphocytes, Haematology, Subclinical infection</p>
		  <p class="Abstract ParaOverride-1">&nbsp;</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Editor----Citation"><span class="CharOverride-5">Editor</span> | Kuldeep Dhama, Indian Veterinary Research Institute, Uttar Pradesh, India.</p>
			<p class="Editor----Citation"><span class="CharOverride-5">Received</span> | January  04, 2015; <span class="CharOverride-5">Revised</span> | February 06, 2015; <span class="CharOverride-5">Accepted</span> | February 09, 2015; <span class="CharOverride-5">Published</span> | February 12, 2015&#9;&#9;</p>
			<p class="Editor----Citation"><span class="CharOverride-5">*Correspondence</span> | Mohd Yaqoob Wani, Indian Veterinary Research Institute, Izatnagar (U. P.), India; <span class="CharOverride-5">Email:</span> mywani27@gmail.com</p>
			<p class="Editor----Citation"><span class="CharOverride-5">Citation</span> | Wani MY, Dhama K, Tiwari R, Barathidasan R, Malik YS, Singh SD, Singh RK (2015). Immunosuppressive effects of chicken infectious anaemia virus on T lymphocyte populations using flow cytometry and hematological parameters during experimental subclinical infection in chicks. Adv. Anim. Vet. Sci. 3(3): 143-150.  </p>
			<p class="Editor----Citation"><span class="CharOverride-5">DOI </span>| <a href="http://dx.doi.org/10.14737/journal.aavs/2015/3.3.143.150"><span class="Hyperlink">http://dx.doi.org/10.14737/journal.aavs/2015/3.3.143.150</span></a></p>
			<p class="Editor----Citation"><span class="Editor---Citation CharOverride-5">ISSN (Online)</span><span class="Editor---Citation"> | 2307-8316; </span><span class="Editor---Citation CharOverride-5">ISSN (Print) </span><span class="Editor---Citation"> | </span>2309-3331</p>
			<p class="Editor----Citation"><span class="CharOverride-5">Copyright</span> © 2015 Wani et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>
		</div>
		<div class="Basic-Text-Frame">
			<p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Heading-1--Introduction----">&nbsp;</p>
		  <p class="Heading-1--Introduction----">INTRODUCTION </p>
			<p class="Caps-on-First-Para ParaOverride-1">&nbsp;</p>
			<p class="Caps-on-First-Para ParaOverride-1"><span class="_idGenDropcap-1">C</span>hicken infectious anaemia virus (CIAV) is an important poultry pathogen, which causes chicken infectious anaemia (CIA), a clinical disease affecting young chickens of up to 3-4 weeks of age. The clinical disease is characterized by poor weight gain, aplastic anaemia, subcutaneous and muscular haemorrhages, generalized lymphoid atrophy and immunosuppression (<a href="#McNulty-MS--McIlroy-SG--Bruce-DW--Todd-D--1991-."><span class="Hyperlink">McNulty et al., 1991</span></a>; <a href="#Adair-BM--2000-"><span class="Hyperlink">Adair, 2000</span></a>; <a href="#Miller-MM--Schat-KA--2004-."><span class="Hyperlink">Miller and Schat, 2004</span></a>; <a href="#Schat-KA--2009-."><span class="Hyperlink">Schat, 2009</span></a>; <a href="#Todd-D--2000-"><span class="Hyperlink">Todd, 2000</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). However, subclinical infections characterized by production losses and vaccine associated complications can act as source of infection to other flocks (<a href="#McNulty-MS--McIlroy-SG--Bruce-DW--Todd-D--1991-."><span class="Hyperlink">McNulty et al., 1991</span></a>;<span class="CharOverride-5"> </span><a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). The virus infection increases the susceptibility of birds to secondary infections and due to its profound immunosuppressive effects, even vaccination failures may occur, altogether leading to huge economic losses to the poultry industry worldwide (<a href="#Pope-CR--1991-."><span class="Hyperlink">Pope, 1991</span></a>; <a href="#Hagood-LT--Kelly-TF--Wright-JC--Hoerr-FJ--2000-."><span class="Hyperlink">Hagood et al., 2000</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>; <a href="#Bhatt-P--Shukla-SK--Mahendran-M--Dhama-K--Chawak-MM--Kataria-JM--2011-."><span class="Hyperlink">Bhatt et al., 2011</span></a>). CIAV is the smallest avian virus (23-25 nm size) belonging to the genus <span class="CharOverride-8">Gyroviru</span>s of family <span class="CharOverride-8">Circoviridae</span>. The viral genome consists of a circular ss-DNA of 2.3 kb having three partially overlapping major open reading frames (ORFs) which encodes for VP1, VP2 and VP3 proteins (<a href="#Miller-MM--Jarosinski-KW--Schat-KA--2005-."><span class="Hyperlink">Miller et al., 2005</span></a>; <a href="#Natesan-S--Kataria-JM--Dhama-K--Rahul-S--Baradhwaj-N--2006-."><span class="Hyperlink">Natesan et al., 2006</span></a>). The VP1 (51 kD) acts as a major capsid protein and VP2 as a scaffold protein essential for virus assembly, while VP3 (apoptin) is important for the disease pathogenesis (<a href="#Miller-MM--Jarosinski-KW--Schat-KA--2005-."><span class="Hyperlink">Miller et al., 2005</span></a>). The CIA has attained much importance due to the frequent outbreaks in commercial poultry farms in various countries and is considered as one of the emerging diseases with potential to act as severe threat to the poultry industry at global level (<a href="#Ducatez-MF--Owoade-AA--Abiola-JO--Muller-CP--2006-."><span class="Hyperlink">Ducatez et al., 2006</span></a>; <a href="#Ducatez-MF--Chen-H--Guan-Y--Muller-CP--2008-."><span class="Hyperlink">Ducatez et al., 2008</span></a>; <a href="#Kim-HR--Kwon-YK--Bae-YC--Oem-JK--Lee-OS--2010-."><span class="Hyperlink">Kim et al., 2010</span></a>; <a href="#Oluwayelu-DO--2010-."><span class="Hyperlink">Oluwayelu, 2010</span></a>; <a href="#Bhatt-P--Shukla-SK--Mahendran-M--Dhama-K--Chawak-MM--Kataria-JM--2011-."><span class="Hyperlink">Bhatt et al., 2011</span></a>; <a href="#Snoeck-CJ--Komoyo-GF--Mbee-BP--Nakoun--E--Le-Faou-A--Okwen-MP--Muller-CP--2012-"><span class="Hyperlink">Snoeck et al., 2012</span></a>; <a href="#Nayabian-H--Mardani-K--2013-."><span class="Hyperlink">Nayabian and Mardani, 2013</span></a>).</p>
		  <p class="Caps-on-First-Para ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">Pathogenesis of CIAV involves adsorption and penetration of the virus into hematopoietic and thymic precursor cells. The virus multiplies in the nucleus by a rolling circle model, thereby cause damage to stem cells in bone marrow and precursor T-lymphocytes in the thymus (<a href="#Smyth-JA--Moffett-DA--McNulty-MS--Todd-D--Mackie-DP--1993-."><span class="Hyperlink">Smyth et al., 1993</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). Previous reports have shown that CIAV either destroys cells expressing CD4, CD8, and CT1 molecules on their surface or interferes with the expression of these molecules (<a href="#Hu-LB--Lucio-B--Schat-KA--1993-."><span class="Hyperlink">Hu et al., 1993</span></a>). Also, there are reports that mature T lymphocytes in the spleen are affected by CIAV infection (<a href="#Adair-BM--McNeilly-F--McConnel-CDG--McNulty-MS--1993-."><span class="Hyperlink">Adair et al., 1993</span></a>). Few experimental studies indicated that CIAV has greater effect on CD8+ cells than CD4+ cells (<a href="#Adair-BM--McNeilly-F--McConnel-CDG--McNulty-MS--1993-."><span class="Hyperlink">Adair et al., 1993</span></a>), while in few other studies no selective decrease in cytotoxic T lymphocytes (CTL) was detected (<a href="#Hu-LB--Lucio-B--Schat-KA--1993-."><span class="Hyperlink">Hu et al., 1993</span></a>). The age-related resistance develops to CIAV infection by antibody production by B cells; however CIAV can persist as a latent virus in spite of the presence of neutralizing antibodies (<a href="#Miller-MM--Schat-KA--2004-."><span class="Hyperlink">Miller and Schat, 2004</span></a>). A recent molecular epidemiological study from India indicated CIAV positivity of 66.6% and 25%, respectively, in 3-7 week and 7-12 week age groups of chickens (<a href="#Wani-MY--Dhama-K--Barathidasan-R--Gowthaman-2013"><span class="Hyperlink">Wani et al., 2013</span></a>). Also, recent findings have shown that CIAV can cause characteristic histopathological changes and immunosuppressive effects involving various cytokines in the adult susceptible birds (<a href="#Haridy-M--Sasaki-J--Ikezawa-M--Okada-K--Goryo-M--2012a-"><span class="Hyperlink">Haridy et al., 2012a</span></a>; <a href="#Wani-MY--Dhama-K--Lateef-SK--Singh-SD--Tiwari-R--2014-"><span class="Hyperlink">Wani et al., 2014</span></a>).</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">Therefore, the present study was designed to determine the immunosuppressive effects of CIAV on T lymphocyte populations bearing CD4 and CD8 receptors using flow cytometry and hematological parameters during experimental subclinical infection in chicks.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">MATERIALS AND METHODS</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Virus isolate</p>
			<p class="Body-Text ParaOverride-1">An Indian field isolate of CIAV (CIAV-E strain; GenBank accession no. AY583757), maintained in Avian Diseases Section, Division of Pathology, Indian Veterinary Research Institute (IVRI), Izatnagar was used during the present study.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Specific pathogen free (SPF) chicks</p>
			<p class="Body-Text ParaOverride-1">Embryonated specific pathogen free (SPF) chicken eggs (n=45) were obtained from M/S Venkateshwara Hatcheries Private Limited (VHL), Pune, Maharashtra, India and hatched in Hatchery Unit of Central Avian Research Institute, Izatnagar. The chicks were reared in Experimental Sheds of Avian Diseases Section, IVRI, under strict isolated conditions and good management practices. All the experimental procedures on animals were carried out according to the recommendations and approval of the Institute Animal Ethics Committee (IAEC) as per the guidelines set forth by the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Ministry of Environment and Forests, Government of India.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Experimental design and sampling</p>
			<p class="Body-Text ParaOverride-1">Forty 6-week-old SPF chickens were randomly divided into infected (n=20) and control group (n=20). The chicks of the infected group were inoculated with 10<span class="CharOverride-4">4.5 </span>tissue culture infective dose (TCID<span class="CharOverride-6">50</span> / ml) of CIAV in 0.5 mL volume intramuscularly in thigh muscle; whereas control chicks received uninfected cell lysate as described previously (<a href="#Natesan-S--Kataria-JM--Dhama-K--Rahul-S--Baradhwaj-N--2006-."><span class="Hyperlink">Natesan et al., 2006</span></a>). All the chicks were regularly monitored for the clinical signs of the disease, and blood samples were collected at 0, 3, 7, 14 and 21 days post infection (dpi). For determining the effect of CIAV on CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+ </span>T cell populations, three birds from each group were sacrificed at 5, 15 and 25 dpi, and spleen and blood were collected for flow cytometry analysis.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Hematology</p>
			<p class="Body-Text ParaOverride-1">The hematological parameters assessed in this study included packed cell volume (PCV) (hematocrit values) using micro-hematocrit capillary tube method, total leukocyte count (TLC), peripheral lymphocyte count (PLC) and peripheral heterophil count (PHC) as per the standard procedures (<a href="#Campbell-TW--1995-"><span class="Hyperlink">Campbell, 1995</span></a>). All these parameters were assessed using EDTA (<span class="A8">2.0 mg mL</span><span class="A8 CharOverride-9">-1</span>) anti-coagulant-added blood from at least five birds in each group.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Flow cytometry </p>
		  <p class="Heading-2--History-in-MM-">&nbsp;</p>
			<p class="Heading-3">Sample preparation</p>
			<p class="Body-Text ParaOverride-1">Single cell suspension of lymphocytes from the blood and spleen were prepared for flow cytometric analysis. The single cell suspension of splenocytes were obtained by triturating and sieving the tissue through a nylon screen using Ca<span class="CharOverride-4">2+</span>- and Mg<span class="CharOverride-4">2+</span>-free  phosphate buffered saline  solution (PBS, pH 7.4) as described previously (<a href="#Erf-GF--Bottje-WG--Bersi-TK--1998-."><span class="Hyperlink">Erf et al., 1998</span></a>). Further, purification of lymphocytes was carried out by using Ficoll density gradient method (Histopaque 1077, Sigma Chemical Co., USA). The lymphocytes were then immunostained with mouse anti-chicken CD4<span class="CharOverride-4">+</span> FITC and CD8<span class="CharOverride-4">+</span> RPE conjugated antibodies (AbDSero Tech, U.K.) for flow cytometry. Briefly, the cells were enumerated by hemocytometer using trypan blue dye exclusion method and 10<span class="CharOverride-4">6</span> cells were resuspended in 0.3 mL of FACS (fluorescent activated cell sorter) buffer (3% FCS, 0.09% NaN<span class="CharOverride-6">3 </span>in PBS; pH 7.4) in 1.5 mL micro-centrifuge tube. For staining the cells, 10 µL of CD4<span class="CharOverride-4">+</span> FITC and 6 µL CD8<span class="CharOverride-4">+</span> RPE antibodies were added to each tube. After proper mixing, the cells were incubated for 1 hour at 4<span class="CharOverride-4">o</span>C. The cells were washed with FACS buffer at 3,000 rpm for 5 minutes and finally resuspended in 200 µL of FACS buffer for acquisition. </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-3">Analysis of CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+ </span>T cells</p>
			<p class="Body-Text ParaOverride-1">For enumeration of CD4+ and CD8+ T cells, flow cytometric analysis of peripheral blood mononuclear cells (PBMCs) was performed on FACS Calibur® instrument from Bioscience. The instrument setting was decided by using unstained cells and cells were stained with isotype control and each sample was acquired by taking 30,000 cell counts. The samples were analysed in “Cell quest” software of FACS Calibur (BD). As the monoclonals for CD4 and CD8 were conjugated to FITC and RPE labeled dyes, which are detected in FL2 channel and FL1 channels, respectively, histograms and dot plots were drawn with FL 1 and FL 2 channel. The positive cell counts were displayed in histogram stat and dot plots.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Virus detection by PCR</p>
			<p class="Body-Text ParaOverride-1">The technique of polymerase chain reaction (PCR) was used for confirmation of the establishment of CIAV infection in experimentally infected chicks using whole DNA isolated from host tissues (thymus, liver and spleen). In brief, the DNA was isolated from the pooled tissue samples from sacrificed birds at 15 dpi, using DNeasy® Blood and Tissue Kit (QIAGEN, Germany) following manufacturer’s instructions. The PCR amplification of VP2 was performed using gene-specific forward (5’ atgcacgggaacggcggac 3’) and reverse (5’ tcacactatacgtaccgggg 3’) primers (<a href="#Basaraddi-MS--Dhama-K--Wani-MY--Sawant-PM--Tiwari-R--Kumar-D--Singh-SD--Singh-R--2013-."><span class="Hyperlink">Basaraddi et al., 2013</span></a>). The known CIAV positive and negative DNA samples were used as standard positive control and negative control, respectively. </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Statistical analysis</p>
			<p class="Body-Text ParaOverride-1">All the data are presented as mean ± MSD and the experimental groups were compared by ANOVA followed by a post hoc Tukey’s test using SPSS v.16.0 statistical software. The values with p&lt;0.05 were considered statistically significant. </p>
			<p class="Body-Text ParaOverride-1">&nbsp;</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">RESULTS </p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Hematological changes</p>
			<p class="Body-Text">The hematological parameters including haematocrit value (HV), total leukocyte count (TLC), peripheral lymphocyte count (PLC) and peripheral heterophil count (PHC) assessed in heparinized blood collected at 3, 7, 14 and 21 dpi of CIAV infection showed significant decrease in HV and TLC values. However, no apparent clinical signs of CIA were observed in the virus infected group of chicks. The HV in normal uninfected control chicks and in experimental group before the virus infection was in the range between 30.08 ± 2.87 and 33.30 ± 3.71, respectively. The HV reduced to 25.52 ± 4.12 and 28.21 ± 3.02 in infected chicks on 14 and 21 dpi, respectively. At 14 dpi, TLC was reduced to 12.67 ± 1.26 x 10<span class="CharOverride-4">3</span>/mm<span class="CharOverride-4">3 </span>compared to 56.71 ± 7.25 x 10<span class="CharOverride-4">3</span>/mm<span class="CharOverride-4">3 </span>in uninfected birds at 0 dpi. Similarly, significant differences were also observed in PLC (%) among the infected chicks and control groups. However, no significant differences were observed in PHC in the infected and control group chicks (<a href="#Table-1-"><span class="Hyperlink">Table 1</span></a>).</p>
		  <p class="Body-Text">&nbsp;</p>
			<p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-5"><a id="Table-1-"></a>Table 1: </span>Effect of CIAV inoculation on packed cell volume (PCV), total leukocyte count (TLC), peripheral lymphocyte count (PLC) and peripheral heterophil count (PHC) in experimentally infected chicks.</p>
			<table width="657" class="Table-Style-1" id="table-1">
				<colgroup>
					<col class="_idGenTableRowColumn-1" />
					<col class="_idGenTableRowColumn-2" />
					<col class="_idGenTableRowColumn-3" />
					<col class="_idGenTableRowColumn-4" />
					<col class="_idGenTableRowColumn-5" />
					<col class="_idGenTableRowColumn-6" />
				</colgroup>
				<tbody>
					<tr class="_idGenTableRowColumn-7">
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-12">Parameters </span></p>
						</td>
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-12">Group </span></p>
						</td>
						<td colspan="4">
							<p class="Basic-Paragraph ParaOverride-2"><span class="CharOverride-12">CIAV Post inoculation day</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-8">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">3</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">7</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">14</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">21</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-7">
						<td />
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13"> </span></p>
						</td>
						<td />
						<td />
						<td />
						<td />
					</tr>
					<tr class="_idGenTableRowColumn-9">
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-13">PCV (%)</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Control </span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">33.30 ± 3.71</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">32.17±3.60</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">30.08 ± 2.87</span><span class="CharOverride-14">B</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">31.08 ± 3.30</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-7">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Infected</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">32.77 ± 1.76</span><span class="CharOverride-14">a</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">30.12±3.61</span><span class="CharOverride-14">b</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">25.52 ±4.12</span><span class="CharOverride-14">Ac</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">28.21 ± 3.02</span><span class="CharOverride-14">b</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-8">
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-13">TLC (x10</span><span class="CharOverride-14">3</span><span class="CharOverride-13">/mm</span><span class="CharOverride-14">3</span><span class="CharOverride-13">)</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Control </span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">16.72 ± 3.76</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">16.13 ± 2.06</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">17.56 ± 2.48</span><span class="CharOverride-14">A</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">17.68 ± 2.96</span><span class="CharOverride-14">C</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-7">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Infected</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">17.02 ± 2.87</span><span class="CharOverride-14">a</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">14.51 ± 1.87</span><span class="CharOverride-14"> b</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">12.67 ± 1.26</span><span class="CharOverride-14">Bc</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">15.64 ± 2.88</span><span class="CharOverride-14">b</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-8">
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-13">PLC (%)</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Control </span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">55.34 ± 5.32</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">56.76 ± 4.29</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">56.71 ± 7.25</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">56.71 ± 6.86</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-7">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Infected</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">57.89 ± 7.36</span><span class="CharOverride-14">a</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">54.63 ± 6.56</span><span class="CharOverride-14">a</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">48.76 ± 3.69</span><span class="CharOverride-14">Bb</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">49.80 ± 5.76</span><span class="CharOverride-14">b</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-8">
						<td rowspan="2">
							<p class="Basic-Paragraph"><span class="CharOverride-13">PHC (%)</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Control </span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">23.53 ± 2.43</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">25.70 ± 3.18</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">23.98 ± 2.44</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">25.63 ± 3.74</span></p>
						</td>
					</tr>
					<tr class="_idGenTableRowColumn-7">
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">Infected</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">24.76± 3.67</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">23.67 ± 2.55</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">26.07 ± 2.65</span></p>
						</td>
						<td>
							<p class="Basic-Paragraph"><span class="CharOverride-13">27.83 ± 4.81</span></p>
						</td>
					</tr>
				</tbody>
			</table>
			<p class="Figure--and-Table-Heading ParaOverride-1">&nbsp;</p>
			<p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-11">The values (Mean ± SD) having at least one common superscript (Capital letters in columns and small letters in rows) do not differ significantly (P &lt;0.05) for a given parameter.</span></p>
			<p class="Figure--and-Table-Heading ParaOverride-1">&nbsp;</p>
		  <p class="Figure--and-Table-Heading ParaOverride-1">&nbsp;</p>
			<div class="pt" > <a href="http://nexusacademicpublishers.com/uploads/figures/20150212170145.png" target="new"><img class="img_display" src="http://nexusacademicpublishers.com/uploads/figures/20150212170145.png" width="80" height="80"></a>
            
         <p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-5"><a id="Figure-1-"></a>Figure 1: </span><a href="http://nexusacademicpublishers.com/uploads/figures/20150212170145.png">Effect of CIAV infection on splenic T lymphocytes in 6-week-old infected chicks at various post infection days. Values are represented as Mean ± SD, * p &lt;0.05</a></p>
       </div><br>

			
		  
			
            <div class="pt" > <a href="http://nexusacademicpublishers.com/uploads/figures/20150212174245.png" target="new"><img class="img_display" src="http://nexusacademicpublishers.com/uploads/figures/20150212174245.png" width="80" height="80"></a>
            
         <p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-5"><a id="Figure-2-"></a>Figure 2: </span><a href="http://nexusacademicpublishers.com/uploads/figures/20150212174245.png">Effect of CIAV infection on T lymphocytes in blood at various post infection days. Values are represented as Mean ± SD, * p &lt;0.05</a></p>
       </div><br>
			
		  <p class="Heading-2--History-in-MM-">CD4 and CD8 T cell population analysis</p>
			<p class="Body-Text ParaOverride-1">In the spleen, the percentage of CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells was greater as compared CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> to CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">+</span> cells. The CIAV infection was found to decrease all the three T cell population types. Significant differences were observed in CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> and CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> cells at 15 dpi. The ratio of CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> : CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells was always less than one in both the infected as well as control groups, however it increased in chicks of the virus infected group at 25 dpi (<a href="#Figure-1-"><span class="Hyperlink">Figure 1</span></a>).  </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">In blood, flow cytometric analysis of cells indicated the presence of higher percentage of CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> compared to CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells. Thus, CIAV infection significantly decreased the peripheral CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> and CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells. However, the CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span>: CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> ratio was always higher (&gt;1) compared to that of splenic ratio (<a href="#Figure-2-"><span class="Hyperlink">Figure 2</span></a>).</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-2--History-in-MM-">Virus detection by PCR</p>
			<p class="Body-Text ParaOverride-1">The CIAV VP2 gene specific PCR, performed for the detection of the CIAV in the pooled tissue samples (liver, thymus and spleen) in both the infected and control group of chicks, showed a distinct amplicon of 651 bp in 1% agarose gel electrophoresis only with the tissues of the virus infected chicks (<a href="#Figure-3-"><span class="Hyperlink">Figure 3</span></a>). No amplification was observed in tissues obtained from uninfected control group chicks.</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			
            <div class="pt" > <a href="http://nexusacademicpublishers.com/uploads/figures/20150212173346.png" target="new"><img class="img_display" src="http://nexusacademicpublishers.com/uploads/figures/20150212173346.png" width="80" height="80"></a>
            
        <p class="Figure--and-Table-Heading ParaOverride-1"><span class="CharOverride-5"><a id="Figure-3-"></a>Figure 3: </span><a href="http://nexusacademicpublishers.com/uploads/figures/20150212173346.png">Confirmation of CIAV infection by PCR amplification of the VP2 gene of CIAV in the experimentally infected birds</a></p>
       </div>
			<p class="Figure--and-Table-Heading ParaOverride-1"> Lane 1, 2, 3, 4: tissues samples from chicks of CIAV infected group; Lane 5: Negative control; Lane 6: CIAV positive control; Lane M: 1Kb DNA ladder.</p>
			<p class="Figure--and-Table-Heading ParaOverride-1">&nbsp;</p>
		  <p class="Figure--and-Table-Heading ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">DISCUSSION</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">In the present study, distinctive haematological changes were observed in the CIAV infected chicks. A significant (P&lt;0.05) decline in the haemoglobin (Hb), PCV and TEC was observed in the CIAV infected group as compared to the healthy control chicks, although clinical signs of CIA were not apparent in the infected group chicks. The PCV was significantly decreased in comparison to control chicks at 15 dpi, however PCV at 25 dpi showed hint of recovery which may be due to regeneration of haematopoietic precursor cells and recovery from the infection by the involvement of humoral immune responses (<a href="#Adair-BM--2000-"><span class="Hyperlink">Adair, 2000</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). The leukocytic lineages also showed a significant (P&lt;0.05) decline in TLC and PLC values in the chicks of virus infected group as compared to control. All these changes were in agreement with the previous reports (<a href="#Bhatt-P--Shukla-SK--Wani-MY--Tiwari-R--Dhama-K--2013-."><span class="Hyperlink">Bhatt et al., 2013</span></a>; <a href="#Latheef-SK--Dhama-K--Wani-MY--Samad-HA--Tiwari-R--Singh-SD--2013-."><span class="Hyperlink">Latheef et al., 2013</span></a>). Recent findings have shown that in the adult susceptible birds, CIAV replicates at high concentration in the thymus, and causes characteristic histopathological changes in the thymus, spleen, bursa of Fabricius, proventriculus and caecal tonsils (<a href="#Kaffashi-A--Noormohammadi-AJ--Allott-ML--Browning-GF--2006-."><span class="Hyperlink">Kaffashi et al., 2006</span></a>; <a href="#Haridy-M--Sasaki-J--Ikezawa-M--Okada-K--Goryo-M--2012a-"><span class="Hyperlink">Haridy et al., 2012a</span></a>; <a href="#Wani-MY--Dhama-K--Lateef-SK--Singh-SD--Tiwari-R--2014-"><span class="Hyperlink">Wani et al., 2014</span></a>). Infections with CIAV increases the susceptibility of birds to secondary (bacterial/viral) infections, depresses vaccinal immunity, aggravates residual pathogenicity of attenuated virus and vaccine strains leading to vaccination failures and various disease outbreaks (<a href="#Pope-CR--1991-."><span class="Hyperlink">Pope, 1991</span></a>; <a href="#Adair-BM--McNeilly-F--McConnel-CDG--McNulty-MS--1993-."><span class="Hyperlink">Adair et al., 1993</span></a>; <a href="#Todd-D--2000-"><span class="Hyperlink">Todd, 2000</span></a>; <a href="#Dhama-K--Kataria-JM--SenthilKumar-N--Dash-BB--Tomar-S--Ghalsasi-GE--2003-."><span class="Hyperlink">Dhama et al., 2003</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). Although the clinical disease generally occurs during first 2-3 weeks of age, subclinical infections frequently occur in adult birds. The virus causes suppression of hematopoietic precursor cell proliferation and differentiation and, thereby leads to transient destruction of erythroblastoid and granuloblastoid cell lineages in bone marrow. This is characterized by drastic reduction in the production of mature red blood cells (erythropoiesis) and myelopoiesis leading to hypoplasia, anaemia and panleukopenia (<a href="#McNulty-MS--McIlroy-SG--Bruce-DW--Todd-D--1991-."><span class="Hyperlink">McNulty, 1991</span></a>; <a href="#Pope-CR--1991-."><span class="Hyperlink">Pope, 1991</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">The primary target of CIAV includes the T lymphocytes while B lymphocytes are resistant to the virus penetration and replication. In the present study, the T lymphocytes were analysed in the spleen and peripheral blood using CD4 and CD8 cell specific monoclonal antibodies. The results showed that even in adult infected birds the CIAV replication decreased the cells bearing CD4 and CD8 receptors at all the post infection time intervals. The effects were more pronounced and highly significant at 15 dpi (p&lt;0.05). In spleen, the ratio of CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span>:CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells was always less than one (&lt;1), both in the infected and control groups, however it was increased in infected chicks at 25 dpi indicating the recovery and clearance of the CIAV as indicated by simultaneous recovery in haematological parameters. Similarly, flow cytometric analysis of peripheral blood lymphocytes indicated significant decrease of CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span> and CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> cells in the chicks of CIAV infected group. Such destructive effects on lymphoid organs in adult infected chicks were observed immunohistochemically by other workers during subclinical infection (<a href="#Smyth-JA--Moffett-DA--Connor-TJ--McNulty-MS--2006-."><span class="Hyperlink">Smyth et al., 2006</span></a>; <a href="#Haridy-M--Sasaki-J--Ikezawa-M--Okada-K--Goryo-M--2012a-"><span class="Hyperlink">Haridy et al., 2012a</span></a>). The blood CD4<span class="CharOverride-4">+</span>CD8<span class="CharOverride-4">-</span>:CD4<span class="CharOverride-4">-</span>CD8<span class="CharOverride-4">+</span> ratio was low (1-1.2: 1) as compared to 1.2–3.25 ratio which may be due to SPF nature of the chicks. It is suggested that in SPF chicks the immune system is not stimulated properly as compared to commercially raised chicks which may be responsible for less number of T helper cells. Even in adult birds, experimental CIAV infection was found to cause significant decrease in thymic to body weight ratio and reduce the cytokine expression levels of important cytokines responsible for mounting effective immune responses and T cell development (<a href="#Wani-MY--Dhama-K--Lateef-SK--Singh-SD--Tiwari-R--2014-"><span class="Hyperlink">Wani et al., 2014</span></a>). Further, to confirm that the pathological changes were indeed induced by CIAV, PCR was used to detect the presence of virus in the infected chicks. The detection of CIAV by PCR has advantages like of being easy, economical, convenient and rapid as compared to the virus isolation or serological and immunohistochemical diagnostic methods (<a href="#Kataria-JM--Mohan--MC--Dey-S--Dash-BB--Dhama-K--2005-"><span class="Hyperlink">Kataria et al., 2005</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>; <a href="#Oluwayelu-DO--2010-."><span class="Hyperlink">Oluwayelu, 2010</span></a>; <a href="#Wani-MY--Dhama-K--Barathidasan-R--Gowthaman-2013"><span class="Hyperlink">Wani et al., 2013</span></a>). The VP2 gene amplification produced the expected product size of 651 bp, which was in conformity with earlier reports (<a href="#Basaraddi-MS--Dhama-K--Wani-MY--Sawant-PM--Tiwari-R--Kumar-D--Singh-SD--Singh-R--2013-."><span class="Hyperlink">Basaraddi et al., 2013</span></a>).</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">It is important to mention here that by 3-6 weeks of age period the maternally derived antibodies vanish and makes chicks highly susceptible to horizontally transmitted CIAV infection (<a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). Also, the co-infection with immunosuppressive pathogens like Marek’s disease virus, infectious bursal disease virus increases the severity of CIAV-associated complications to the growing and susceptible adult chicks (<a href="#Haridy-M--Sasaki-J--Ikezawa-M--Okada-K--Goryo-M--2012a-"><span class="Hyperlink">Haridy et al., 2012a</span></a>;<span class="CharOverride-5"> </span><a href="#Haridy-M--Sasaki-J--Okada-K--Goryo-M--2012b-."><span class="Hyperlink">Haridy et al., 2012b</span></a>). Although clinical disease does not occur in adult birds but such infections lead to decrease in body weight gain, contamination of pathogen-free eggs and vaccination failures; besides acting as source of infection to other susceptible birds. CIAV-infected birds show profound immunosuppression during concurrent infection with other viruses such as fowl adenovirus, reoviruses and Newcastle disease virus, leading to synergistic effects of both agents and increase in the susceptibility age period (<a href="#Pope-CR--1991-."><span class="Hyperlink">Pope, 1991</span></a>; <a href="#Todd-D--2000-"><span class="Hyperlink">Todd, 2000</span></a>; <a href="#Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"><span class="Hyperlink">Dhama et al., 2008</span></a>). </p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">In conclusion, the findings of the present study supported that CIAV can replicate and induce immunosuppression in the susceptible chicks during subclinical infection stages as indicated by the reduction in haematological parameters and in both of the CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+</span> T lymphocyte populations at 15 dpi in the virus infected birds. The systemic effects of CIAV on T lymphocytes bearing CD4 and CD8 receptors during subclinical infection as analysed by flow cytometry indicated non-specific tropism of the virus for these cells. The replicative nature, carrier stages and immunosuppressive potential of the virus both in clinical and subclinical infection warrants the effective implementation of rapid diagnostic and appropriate control measures so as to prevent the production losses caused by this economically important pathogen of poultry, particularly the developing countries like India. </p>
			<p class="Body-Text ParaOverride-1">&nbsp;</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">ACKNOWLEDGEMENTS</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">The authors are highly thankful to DBT and ICAR-NAE Projects, Delhi for strengthening facilities for CIAV research at IVRI, Izatnagar.</p>
			<p class="Body-Text ParaOverride-1">&nbsp;</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">COMPETING INTERESTS </p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			<p class="Body-Text ParaOverride-1">The authors declare that they have no competing interests.</p>
			<p class="Body-Text ParaOverride-1">&nbsp;</p>
		  <p class="Body-Text ParaOverride-1">&nbsp;</p>
			<p class="Heading-1--Introduction----">REFERENCES</p>
		  <p class="Heading-1--Introduction----">&nbsp;</p>
			
			  <li class="References ParaOverride-8" lang="en-US"><a id="Adair-BM--2000-"></a>Adair BM (2000). Immunopathogenesis of chicken anemia virus infection. Dev. Comp. Immunol. 24(2-3): 247-255. <a href="http://dx.doi.org/10.1016/S0145-305X(99)00076-2"><span class="Hyperlink">http://dx.doi.org/10.1016/S0145-305X(99)00076-2</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Adair-BM--McNeilly-F--McConnel-CDG--McNulty-MS--1993-."></a>Adair BM, McNeilly F, McConnel CDG, McNulty MS (1993). Characterization of surface markers present on cells infected by CIAV in experimentally infected chickens. Avian Dis. 37(4): 943-950. <a href="http://dx.doi.org/10.2307/1591898"><span class="Hyperlink">http://dx.doi.org/10.2307/1591898</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Basaraddi-MS--Dhama-K--Wani-MY--Sawant-PM--Tiwari-R--Kumar-D--Singh-SD--Singh-R--2013-."></a>Basaraddi MS, Dhama K, Wani MY, Sawant PM, Tiwari R, Kumar D, Singh SD, Singh R (2013). Downregulation in cytokines profiles and immunopathological changes in chicks infected with chicken infectious anaemia virus. Afr. J. Microbiol. Res<span class="CharOverride-18">.</span><span class="apple-converted-space CharOverride-19">&#160;</span>7(21): 2464-2474. </li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Beirao-BC--Favaro-C-Jr--Nakao-LS--Caron-LF--Zanata-SM--Mercadante-AF--2012-."></a>Beirao BC,&#160;Favaro C Jr,&#160;Nakao LS,&#160;Caron LF,&#160;Zanata SM,&#160;Mercadante AF (2012). Flow cytometric immune profiling of specific-pathogen-free chickens before and after infectious challenges.<span class="apple-converted-space CharOverride-19">&#160;</span>Vet. Immunol. Immunopathol. 145(1-2): 32-41. <a href="http://dx.doi.org/10.1016/j.vetimm.2011.10.004"><span class="Hyperlink">http://dx.doi.org/10.1016/j.vetimm.2011.10.004</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Bhatt-P--Shukla-SK--Mahendran-M--Dhama-K--Chawak-MM--Kataria-JM--2011-."></a>Bhatt P, Shukla SK, Mahendran M, Dhama K, Chawak MM, Kataria JM (2011). Prevalence of chicken infectious anaemia virus (CIAV) in commercial poultry flocks of Northern India: A Serological Survey. Transbound. Emerg. Dis. 58(5): 458-460. <a href="http://dx.doi.org/10.1111/j.1865-1682.2011.01215.x"><span class="Hyperlink">http://dx.doi.org/10.1111/j.1865-1682.2011.01215.x</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Bhatt-P--Shukla-SK--Wani-MY--Tiwari-R--Dhama-K--2013-."></a>Bhatt P, Shukla SK, Wani MY, Tiwari R, Dhama K (2013). Amelioration of chicken infectious anaemia virus induced immunosuppression by immunomodulator and haematinic supplementation in chicks. Veterinarski Arhiv. 83(6): 639-652.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Campbell-TW--1995-"></a>Campbell TW (1995). Avian haematology and cytology (2<span class="CharOverride-4">nd</span><span class="apple-converted-space CharOverride-13">&#160;</span>ed), Iowa State University Press, Ames, USA. </li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Dhama-K--Kataria-JM--SenthilKumar-N--Dash-BB--Tomar-S--Ghalsasi-GE--2003-."></a>Dhama K, Kataria JM, SenthilKumar N, Dash BB, Tomar S, Ghalsasi GE (2003). Immunosuppressive effects of the Indian isolate of chicken infectious anaemia virus (CAV) in specific pathogen free chicks. Indian J. Poult. Sci. 38(3): 185-194.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Dhama-K--Mahendran-M--Somvanshi-R--Chawak-MM--2008-"></a>Dhama K, Mahendran M, Somvanshi R, Chawak MM (2008). Chicken infectious anaemia virus: an immunosuppressive pathogen of poultry - A Review. Indian J. Vet. Pathol. 32(1): 158-167.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Ducatez-MF--Owoade-AA--Abiola-JO--Muller-CP--2006-."></a>Ducatez MF, Owoade AA, Abiola JO, Muller CP (2006). Molecular epidemiology of chicken anemia virus in Nigeria. Arch. Virol. 151(1): 97-111. <a href="http://dx.doi.org/10.1007/s00705-005-0609-7"><span class="Hyperlink">http://dx.doi.org/10.1007/s00705-005-0609-7</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Ducatez-MF--Chen-H--Guan-Y--Muller-CP--2008-."></a>Ducatez MF, Chen H, Guan Y, Muller CP (2008). Molecular epidemiology of chicken anemia virus (CAV) in southeastern Chinese live birds markets.<span class="ti CharOverride-13"> Avian Dis. 52(1): 68-73. </span><a href="http://dx.doi.org/10.1637/8049-070407-Reg"><span class="Hyperlink">http://dx.doi.org/10.1637/8049-070407-Reg</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Erf-GF--Bottje-WG--Bersi-TK--1998-."></a>Erf GF, Bottje WG, Bersi TK (1998). CD4, CD8, and TCR defined T-cells subsets in thymus and spleen of 2 and 7-week old commercial broiler chickens. Vet. Immunol. Immunopathol. 62(4): 339-348. <a href="http://dx.doi.org/10.1016/S0165-2427(97)00070-6"><span class="Hyperlink">http://dx.doi.org/10.1016/S0165-2427(97)00070-6</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Hagood-LT--Kelly-TF--Wright-JC--Hoerr-FJ--2000-."></a>Hagood LT, Kelly TF, Wright JC, Hoerr FJ (2000). Evaluation of chicken infectious anemia virus associated risk factors with disease and production losses in broilers. Avian Dis. 44: 803-808. <a href="http://dx.doi.org/10.2307/1593052"><span class="Hyperlink">http://dx.doi.org/10.2307/1593052</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Haridy-M--Sasaki-J--Ikezawa-M--Okada-K--Goryo-M--2012a-"></a>Haridy M,&#160;Sasaki J,&#160;Ikezawa M,&#160;Okada K, Goryo M (2012a). Pathological and immunohistochemical studies of subclinical infection of chicken anemia virus in 4-week-old chickens. J. Vet. Med. Sci.<span class="CharOverride-18"> </span>74(6): 757-764. <a href="http://dx.doi.org/10.1292/jvms.11-0374"><span class="Hyperlink">http://dx.doi.org/10.1292/jvms.11-0374</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Haridy-M--Sasaki-J--Okada-K--Goryo-M--2012b-."></a>Haridy M, Sasaki J, Okada K, Goryo M (2012b). Persistence of inclusions and antigens of chicken anemia virus in Marek’s disease lymphoma. Res. Vet. Sci. 93(3): 1353-1360. <a href="http://dx.doi.org/10.1016/j.rvsc.2012.05.004"><span class="Hyperlink">http://dx.doi.org/10.1016/j.rvsc.2012.05.004</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Hu-LB--Lucio-B--Schat-KA--1993-."></a>Hu LB, Lucio B, Schat KA (1993). Depletion of CD4<span class="CharOverride-4">+</span> and CD8<span class="CharOverride-4">+</span> T lymphocyte subpopulation by CIA-1, a chicken infectious anemia virus. Avian Dis. 37(2): 492-500. <a href="http://dx.doi.org/10.2307/1591677"><span class="Hyperlink">http://dx.doi.org/10.2307/1591677</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Kaffashi-A--Noormohammadi-AJ--Allott-ML--Browning-GF--2006-."></a>Kaffashi A, Noormohammadi AJ, Allott ML, Browning GF (2006). Virus load in 1-day-old and 6-week-old chickens infected with chicken anaemia virus by the intraocular route. Avian Pathol. 35(3): 471-474. <a href="http://dx.doi.org/10.1080/03079450601028837"><span class="Hyperlink">http://dx.doi.org/10.1080/03079450601028837</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Kataria-JM--Mohan--MC--Dey-S--Dash-BB--Dhama-K--2005-"></a>Kataria JM, Mohan, MC, Dey S, Dash BB, Dhama K (2005). Diagnosis and immunoprophylaxis of economically important poultry diseases: a review.<span class="apple-converted-space CharOverride-19">&#160;</span>Indian J. Anim. Sci.<span class="CharOverride-18"> </span>75(5): 555-567.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Kim-HR--Kwon-YK--Bae-YC--Oem-JK--Lee-OS--2010-."></a>Kim HR, Kwon YK, Bae YC, Oem JK, Lee OS (2010). Molecular characterization of chicken infectious anemia viruses detected from breeder and broiler chickens in South Korea. Poult. Sci. 89: 2426-2431. <a href="http://dx.doi.org/10.3382/ps.2010-00911"><span class="Hyperlink">http://dx.doi.org/10.3382/ps.2010-00911</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Latheef-SK--Dhama-K--Wani-MY--Samad-HA--Tiwari-R--Singh-SD--2013-."></a>Latheef SK, Dhama K, Wani MY, Samad HA, Tiwari R, Singh SD (2013). Ameliorative effects of <span class="CharOverride-8">Withania somnifera, Azadirachta indica, Tinospora cordifolia </span>and E care Se herbal preparations on chicken infectious anaemia virus induced haematological changes in chicks and their live body weights. South Asian&#160;J. Exp.&#160;Biol. 3(4): 172‐182.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="McNulty-MS--McIlroy-SG--Bruce-DW--Todd-D--1991-."></a>McNulty MS, McIlroy SG, Bruce DW, Todd D (1991). Economic effects of subclinical chicken anemia agent infection in broiler chickens. Avian Dis. 35: 263-268. <a href="http://dx.doi.org/10.2307/1591175"><span class="Hyperlink">http://dx.doi.org/10.2307/1591175</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Miller-MM--Jarosinski-KW--Schat-KA--2005-."></a>Miller MM, Jarosinski KW, Schat KA (2005). Positive and negative regulation of chicken anemia virus transcription. J. Virol. 79(5): 2859-2868. <a href="http://dx.doi.org/10.1128/JVI.79.5.2859-2868.2005"><span class="Hyperlink">http://dx.doi.org/10.1128/JVI.79.5.2859-2868.2005</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Miller-MM--Schat-KA--2004-."></a>Miller MM, Schat KA (2004). Chicken infectious anaemia virus: an example of the ultimate host-parasite relationship. Avian Dis. 48(4): 734-745. <a href="http://dx.doi.org/10.1637/7271-090304R"><span class="Hyperlink">http://dx.doi.org/10.1637/7271-090304R</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Natesan-S--Kataria-JM--Dhama-K--Rahul-S--Baradhwaj-N--2006-."></a>Natesan S, Kataria JM, Dhama K, Rahul S, Baradhwaj N (2006). Biological and molecular characterization of chicken anaemia virus isolates of Indian origin. Virus Res. 118(1-2): 78-86. <a href="http://dx.doi.org/10.1016/j.virusres.2005.11.017"><span class="Hyperlink">http://dx.doi.org/10.1016/j.virusres.2005.11.017</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Nayabian-H--Mardani-K--2013-."></a>Nayabian H, Mardani K (2013). Molecular characterisation of the chicken anemia viruses isolated from broiler farms of west Azerbaijan, Iran. Avian Pathol. 42(2): 108-113. <a href="http://dx.doi.org/10.1080/03079457.2013.766668"><span class="Hyperlink">http://dx.doi.org/10.1080/03079457.2013.766668</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Oluwayelu-DO--2010-."></a>Oluwayelu DO (2010). Diagnosis and epidemiology of chicken infectious anemia in Africa. Afr. J. Biotechnol. 9(14): 2043-2049.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Pope-CR--1991-."></a>Pope<span class="CharOverride-21"> CR (</span>1991). Chicken anemia agent. Vet. Immunol. Immunopathol. 30(1): 51-65. <a href="http://dx.doi.org/10.1016/0165-2427(91)90008-Z"><span class="Hyperlink">http://dx.doi.org/10.1016/0165-2427(91)90008-Z</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Schat-KA--2009-."></a>Schat KA (2009). Chicken infectious anaemia. Current Topics Microbiol. Immunol. 331: 151-183. <a href="http://dx.doi.org/10.1007/978-3-540-70972-5_10"><span class="Hyperlink">http://dx.doi.org/10.1007/978-3-540-70972-5_10</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Smyth-JA--Moffett-DA--Connor-TJ--McNulty-MS--2006-."></a>Smyth JA, Moffett DA, Connor TJ, McNulty MS (2006). Chicken anaemia virus inoculated by the oral route causes lymphocyte depletion in the thymus in 3-week-old and 6-week-old chickens. Avian Pathol. 35(3): 254-259. <a href="http://dx.doi.org/10.1080/03079450600717349"><span class="Hyperlink">http://dx.doi.org/10.1080/03079450600717349</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Smyth-JA--Moffett-DA--McNulty-MS--Todd-D--Mackie-DP--1993-."></a>Smyth JA, Moffett DA, McNulty MS, Todd D, Mackie DP (1993). A sequential histopathologic and immunocytochemical study of chicken anaemia virus infection at one day of age. Avian Dis.<span class="CharOverride-8"> </span>37: 324-338. <a href="http://dx.doi.org/10.2307/1591656"><span class="Hyperlink">http://dx.doi.org/10.2307/1591656</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Snoeck-CJ--Komoyo-GF--Mbee-BP--Nakoun--E--Le-Faou-A--Okwen-MP--Muller-CP--2012-"></a>Snoeck CJ, Komoyo GF, Mbee BP, Nakouné E, Le Faou A, Okwen MP, Muller CP (2012). Epidemiology of chicken anemia virus in Central African Republic and Cameroon. Virol. J. 9:189. <a href="http://dx.doi.org/10.1186/1743-422X-9-189"><span class="Hyperlink">http://dx.doi.org/10.1186/1743-422X-9-189</span></a></li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Todd-D--2000-"></a>Todd D (2000). Circoviruses: immunosuppressive threats to avian species: a review. Avian Pathol. 29(5): 373-394. <a href="http://dx.doi.org/10.1080/030794500750047126"><span class="Hyperlink">http://dx.doi.org/10.1080/030794500750047126</span></a></li>
		  <li class="References ParaOverride-8" lang="en-US"><a id="Wani-MY--Dhama-K--Barathidasan-R--Gowthaman-2013"></a>Wani MY, Dhama K, Barathidasan R, Gowthaman<span class="CharOverride-4"> </span>V, Tiwari R,  Bhatt P, Mahajan NK, Chawak MM, Singh SD,<span class="CharOverride-4"> </span>Kataria JM (2013). Molecular detection and epidemiology of chicken infectious anaemia virus in India. South Asian. Exp. Biol. 3(4): 145‐151.</li>
				<li class="References ParaOverride-8" lang="en-US"><a id="Wani-MY--Dhama-K--Lateef-SK--Singh-SD--Tiwari-R--2014-"></a>Wani MY, Dhama K, Lateef SK, Singh SD,<span class="CharOverride-4"> </span>Tiwari R (2014). Correlation between cytokine profile, antibody titre and viral load during sub-clinical chicken anaemia virus infection. Veterinarni Medicina.<span class="CharOverride-8"> </span>59(1): 33-43.</li>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
                <p>&nbsp;</p>
			
		</div>
	</body>
</html>
