Research Article

 

The Effect of Aflatoxin B1 Contamination on the Antioxidant Status of Broilers’ Liver and Breast Muscle

 

Abdou Khaled1, Walaa A. Moselhy1, Marwa A. Ibrahim2*, Mahmoud A. R.3, Rowaida R. Abd El-Wahab4

1Department of Forensic Medicine and Toxicology, Faculty of Veterinary Medicine, Beni-Suef University, Egypt; 2Department of Biochemistry and Chemistry of Nutrition, Faculty of Veterinary Medicine, Cairo University, Egypt; 3Department of Toxicology and Biochemistry, Animal Health Research Institute, Dokki, Egypt; 4Department of Toxicology and Biochemistry Beni Suef provincial Lab, Animal Health Research Institute, Dokki, Egypt.

 

Abstract | Aflatoxin (AFB1) hampers the animal husbandry and causes a health hazard to human through the transfer of toxins through contaminated animal products leading to hepatocellular carcinoma. The aim of this study was to assess the presence of AFB1 in feed, liver and breast muscles among five broiler farms in Egypt by immune affinity fluorometric method.The effects of aflatoxin on antioxidant components (Lipid peroxidation (LPO), glutathione (GSH) and superoxide (SOD)) were determined. Moreover, the expression levels of the SOD And GPx genes were determined. A total of 300 samples (100 feed stuff, 100 liver 100 and breast muscles samples) were collected from different farms at age of marketing. The results revealed that the aflatoxin B1 level in the feed stuff, liver and muscle samples were higher than the permissible limit of European Commission with increased significant difference in feed samples comparing with permissible limit. Also the mean values of liver samples were higher than those detected in muscle. On the other hand, the concentrations of LPO and SOD were increased in chicken livers at farms with high AFB1 concentration, whereas GSH levels decreased. Both SOD and GPx genes were up-regulated in positive correlations to the AFB1 levels.

 

Keywords | Aflatoxin B1, AFB1, Broiler, LPO, SOD, GPx

 

Received | January 06, 2019; Accepted | February 02, 2019; Published | April 23, 2019

*Correspondence | Marwa Ibrahim Abd El Hamid, Department of Biochemistry and Chemistry of Nutrition, Faculty of Veterinary Medicine, Cairo University, Egypt; Email: [email protected]

Citation | Khaled A, Moselhy WA, Ibrahim MA, Mahmoud AR, El-Wahab RRA (2019). Current trend on the economic and public health significance of salmonellosis in Iraq. Adv. Anim. Vet. Sci. 7(6): 492-497.

DOI | http://dx.doi.org/10.17582/journal.aavs/2019/7.6.492.497

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2019 Khaled et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Introduction

 

The most economic influences of mycotoxins are the loss of human and animal life, the increased veterinary care costs, the disposal of contaminated food and feed andthe reduced livestock production. Internationally, efforts have continued to set guidelines and control mycotoxins, but practical measures have not been implemented (Zain, 2011).

 

Mycotoxins mainly contaminated the animals feed. However, their levels were not high enough to cause apparent diseases but may cause subclinical changes in animal growth, production, immunosuppression and consequently economic loss (Nahla et al., 2015). Significantly, mycotoxins not only cause problems for the animal feed industry but also threaten the consumer’s safety (Bryden, 2012). In Egypt, the poultry industry is highly based on the imported feed ingredients thus, the contamination with fungi are very high either during the stages of production or during transportation period or may occur during storage stages in the markets (Hassan et al., 2012).

 

The oxidative stress caused by AFB1 may be one of the underlining mechanisms for AFB1-induced cell injury and DNA, protein and lipid damages, which might lead to tumorigenesis (Daniela & Ionelia, 2012). Oxidative stress describes various deleterious processes resulting from an imbalance between limited antioxidant defenses and the excessive formation of ROS (Hossam El-Din, 2013). The cell can tolerate a small and moderate amount of oxidative stress which, under normal conditions are cleared from the cell through antioxidant molecules (Halliwell & Gutteridge, 2007). This study aimed to evaluate the prevalence of aflatoxins among broiler farms in Beni-Suef province and determine the effect of AF1 on the antioxidant status. We examined feed, liver and muscle samples.

 

Materials and methods

 

Study Area

Five poultry farms were selected from West, North, South and Central of Beni Suef province respectively [Ehnasiadistrict (farm 1), Naser district (farm 2), Bebadistrict (farm 3), New Beni Suef (farm 4) and Beni Suefdistrict (farm 5).

 

Data Collection

This survey was conducted between July and September 2017. A questionnaire was collected from each visited farms which focused on the information of the general farm management (Table 1).

 

Samples Collection

A total of 100 feedstuff samples and broiler chickens were collected from the five broiler farms at the age of marketing (40 days). The breast muscle and liver samples were taken after slaughtering.All collected samples were frozen at -80oC till the time of analysis.

 

Determination of Aflatoxin B1 Residuesin Feed Stuff, Liver and Muscle Samples

The VICAM AflaTest immunoaffinity fluorometric method VICAM, (1997) was used according to Hansen (1993).

 

Determination of the Antioxidant Status in Liver Homogenate

Determination of lipid peroxidation content (LPO) was done according to the method of Yagi, (1987) while determination of Glutathione (GSH) content was performed according to the method of Beutler et al. (1963). The estimation of SOD activity was done according to the method of Marklund & Marklund (1974).

 

Quantitative Real-Time Pcr Analysis of Gpx and Sod Genes

A 100 mg of liver tissue was used for total RNA extraction using a Total RNA Extraction Kit. After confirming the concentration and purity of RNA, (Reverse transcriptase) RT-PCR was performed using M-MuLV Reverse Transcriptase (NEB#M0253) (Abdel Aziz et al., 2018). Quantitative assessment of c-DNA amplification for each gene was performed relative to beta-actin (ACTB) by a fluorescence based real-time detection method with a fluorescent SYBR Green dye (Thermo Scientific, Cat. No. K0221). The sequence of primers sets used for qRT- PCR analysis of gene expression were designed using primer 3 program. Glutathione peroxidase (GPx) (NM_001277853.2) Forward:-GATGACCAACCCGCAGTACA Reverse: AGCTTTGAAAACATCGGGCG Superoxide dismutase (SOD) (NM_204211.1) Forward:- TACAGCTCAGGTGTCGCTTC Reverse: GCGAAGGAACCAAAGTCACG. Changes in the concentration of the product were assessed by measuring the fluorescence level during the elongation phase of PCR. The real-time PCR conditions were performed as follows: 95 °C for 5 min (initial denaturation) and then 40 cycles at 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 15 s. After the final cycle, the melting curve analysis of all samples was performed through one cycle of 95 °C for 15 s, 58 °C for 15 s, and 95 °C for 15 s. B-actin is used as internal control (Afifi et al., 2018). Negative controls that were free of the template were included in each experiment. Each qRT-PCR was performed with three biological replicates and each biological replicate was assessed three times (Kamel et al., 2018). The comparative 2−ΔΔCTmethod was used to calculate the relative transcription levels (Ibrahem and Ibrahim, 2014) using Mxpro software Stratgene (Morgan et al., 2017).

 

Statistical Analysis

Data were subjected to statistical analysis using the One-Way Analysis of Variance as a Complete Randomized Design (CRD) using the general linear model’s procedure of statistical analysis software (SPSS 16 for windows). The means showing significant differences (P<0.05) were compared using Duncan’s Multiple Range Test (DMR).

 

Results

 

Aflatoxin B1 Concentrations

The mean values of AFB1 in the feed (Table 2) were significantly higher in all examined farmsin comparing with the permissible limit of the European Commission, 2003 (20μg/kg).

 

Moreover, the mean values of AFB1 in muscles samples (Table 2) were significantly higher than the permissible limit of the European Commission (EC) No 1881/2006 (5μg/kg). The highest significant difference was detected in farm 2.

 

In the other hand, the mean values of AFB1 in liver samples were higher than the permissible limit ofthe European Commission (EC) No 1881/2006 (5μg/kg) in farm 1,2 and 5. The farm 3 and 4 recorded non-significant higher values than the permissible limits.

 

Table 1: The data collected from the farms

 

Item Farm 1 Farm 2 Farm 3 Farm 4 Farm 5
Number of chicken in the farm 12000 36000 2000 14000 12000
Age of chicken at the time of experiment. 40 day 40 day 40 day 39 day 40 day
Weight of bird 1600-2100 g 1800-2100 g 1800-2000 g 1600- 2200 g 1600- 2200 g
System of breeding On the floor Battery On the floor On the floor On the floor

System of ventilation.

 

Window and ventilator Window and ventilator Window and ventilator Ventilator Window
Composition of ration and feed additives. yellow corn- Soybean oil- soya- Gluten of corn- Mineral salts and vitamins yellow corn- Soybean oil- Gluten of corn- antioxidant- antifungal- Mineral salts and vitamins yellow corn- Soybean oil- soya- Gluten of corn- antioxidant- antifungal- Mineral salts and vitamins yellow corn- Soybean oil- soya- Gluten of corn- antioxidant- antifungal-anticoccidial and clostridia Mineral salts and vitamins yellow corn- Soybean oil- soya- Gluten of corn- antioxidant- antifungal-anticoccidial and clostridia Mineral salts and vitamins
Frequency of bedding exchange. Sawdust change according to the conditions Sawdust change according to the conditions Sawdust change according to the conditions Sawdust change according to the conditions Sawdust change according to the conditions
Source of water supply. Tap water Tap water Tap water Tap water

Tap water

 

 

The correlation coefficient between the levels of AFB1 residues in feed and their levels in breast muscle and liver.

 

Table 2: Aflatoxin B1 residues (ppb) in samples collected from Beni-suef province (mean± S.E).

 

Item Feed stuff Liver Breast Muscle
Farm 1

70±2.30 b

27±1.73 a

4.67±1.35 a

Farm 2

47±1.73 a

15±2.64 c

9.37±1.66 b

Farm 3

42.67±2.60 a

9.33±1.56 b

6.20±1.70 ab

Farm 4

41±2.01 a

8.50±0.92 b

7.30±1.68 ab

Farm 5

60±2.30 c

27±1.70 a

6.26±1.21 ab

 

−Data expressed as mean ± S.E.

− The different letter in the same column indicates significant difference according to one way ANOVA (p≤ 0.05).

 

Table 3: The correlation between levels of AFB1 residues in feed stuff and their levels in muscles and liver

 

Item Feed to muscles Feed to liver
Farm 1

-1**

1**

Farm 2 -0.991 0.982
Farm 3

0.999*

-0.996
Farm 4 0.334 0.207
Farm 5 1

1**

 

-* Correlation is significant at the 0.05 level (2-tailed).

-** Correlation is significant at the 0.01 level (2-tailed).

 

The positive feed to muscle correlation was detected in the farms 3, 4 and 5, while the negative correlation was detected in the farms 1 and 2. In addition to, the highest significant correlation between feed and liver was recorded in the farms 1 and 5, followed by the farms 2, 4 which were showed positive correlation but the negative correlation was recorded in farm 3, (Table 3).

 

Table 4: The mean values of (LPO), (GSH) and (SOD) in liver tissue homogenate of different broiler farms

 

Item LPO nmoles/100mg tissue/hr GSH nmoles/100mg tissue SOD

mu/100mg tissue

Farm 1

4.026±0.67 a

15.049±2.04 a

59.885±4.92a

Farm 2

2.355±0.24 b

 

16.133±2.25 a

45.200±3.59b

Farm 3

2.231±0.46 b

21.723±2.89 a

51.054±4.14ab

Farm 4

2.147±0.26 b

30.50±2.58 b

48.648±5.53ab

Farm 5

3.200±0.30 b

17.353±3.20 a

56.157±2.43ab

 

Table 5: The relative m-RNA expression level of the GPx and SOD genes.

 

Farms GPx SOD
Farm 1

1.1±0.2a

5.76±0.4a

Farm 2

1±0a

1±0b

Farm 3

2.3±0.4b

5.4±-0.23a

Farm 4

4.1±0.32c

4.2±0.55c

Farm 5

3.2±0.22b

5.5±0.23a

 

−Data expressed as mean ± S.E.

− The different letter in the same column indicates significant difference according to one way ANOVA (p≤ 0.05).

 

Oxidative Stress

The highest LPO level was recorded in farm 1 followed by 5, 2, 3 and 4 respectively. The GSH were low in farm 1, 2, 5, 3 and finally 4 respectively. While, the SOD was high in farm 1, 5, 3, 4 then farm 2 respectively, (Table 4).

 

The relative mRNA expression levels of GPx and SOD:

The results of relative m-RNA levels of both SOD and GPx were shown in Figure 1 and Table 5. Up-regulation of the studied genes were detected in farm 3,4 and 5 for the GPx and in farms 1,3,4 and 5 for the SOD genes.

 

Figure 1: Agarose gel Electrophoresis of the PCR products for the examined genes. Lane Lane 1: farm1; lane 2: farm 2; lane 3: farm 3: lane 4: farm 4; lane 5: farm5.

 

Discussion

 

AFB1 is the most toxic agent of aflatoxins and it is categorized as a human carcinogen (Talebi et al., 2011). AFB1 is known in experimental humans and animals as the most potent hepatocarcinogen (Lopez et al., 2002). Significantly, the cell-mediated immunity was reduced in chicks fed on ration contaminated with (2 ppm) Aflatoxin B1 (Nedeljković-Trailović et al., 2004; Verma et al., 2004).

 

At this study, the highest results of AFB1 in feedstuff samples were recorded in farm 1 and5 and the same results were detected by Alkhalaf et al. (2010), Mngadi et al. (2008) and Azab et al. (2005). However, Khalil et al. (2015) reported the lower levels of AFB1 in the feed. The differences in the prevalence and levels of contamination of aflatoxins in poultry feed depend on a number of factors such as the geographical area, climatic conditions, storage conditions, type of raw material andthe damage of the grains by insects (Rashid et al., 2012).

 

Consequently, high levels of AFB1 in feed samples led tohighlevels of AFB1 in liver and muscle samples respectively. Similar results were recorded in the liver and muscle (Faten et al., 2016; Eleftheriadou et al., 2004) whereas, the higher results of AFB1 residues were reported in liver and muscle samples (Begum et al., 2001) while Saqer, (2013) and Zahid et al. (2010) detected the lower average of AFB1 in liver and muscles.Our results were in accordance with the positive correlation between feed and liver whereas, the correlation between feed and muscle showed a direct relationship (Hussain et al. 2010).

 

Low qualified, poor hygienic handling of chicken carcasses and improper evisceration lead to an increase in the bacterial count. In addition, bad chilling cause mold contamination and food spoilage enhanced toxins production as aflatoxins (Martín-Sánchez et al., 2011).

 

AFB1 caused ROS production and lipid peroxidation (Farombi et al., 2005). The enzymatic antioxidants are the major determinants of the antioxidant status of the cell (Verma and Nair, 2001). SOD, and GPx are vital antioxidant enzymes responsible for scavenging ROS.We recorded up-regulation the SOD and GPx genes. The increases in the expression level were correlated to AFB1 concentration in feed and muscle samples. The GSH-Px, SOD were markedly decreased in the AFB1 group (Wang et al., 2013). The elevated expression of the hepatic SOD and GPx genes might reduce the conjugation of the reactive metabolites by the hepatocytes.

 

Our results were supported by the detection of LPO, GSH and SOD in the homogenized liver. The LPO results offarms 1, 2 and 5 were higher than other farms which might be due to higher levels of AFB1in liverat these farms. Our findings agreed with those of Hou et al. (2013); Yang et al. (2012). The increased LPO levels may lead to depletion of non-enzymatic antioxidants (Salem et al., 2018). The GSH is mainly responsible for converting oxidized glutathione into reduced glutathione, and increased GSH activity means that reduced glutathione is increased (Yang et al., 2012). The levels of AFB1 increased the SOD levels and which is in accordance with Gökhan et al. (2005) and disagreed with Hou et al. (2013) who detected low levels of SOD associated toAFB1 contamination.The SOD plays a vital role in the conversion of O2–into H2O2 thus; the increase in SOD might be attributed to the removal of increased oxygen free radicals in AFB1 contamination (Yang et al., 2012).

 

Conclusion

 

The detected concentrations of aflatoxin B1 in feedstuff, muscles and liver samples were higher than the permissible limits. The AFB1 elevated the LPO and SOD and decreased the GSH activity. In addition, up-regulation of both SOD and GPx genes were detected in positive correlations with AFB1 levels.

 

Conflict of interest

 

The authors declare that they have no conflict of interests.

 

Authors’ contributions

 

All authors contributed equally in the planning of the study, drafting the manuscript. All of them approve the final version of the article.

 

References

 

  • Abdel Aziz RL, Abdel-Wahab A, Abo El-Ela FI, Ibrahim MA, Khalil A-TAY (2018). Dose- dependent ameliorative effects of quercetin and L-Carnitine against atrazine- induced reproductive toxicity in adult male Albino rats. Biomed. Pharmacother. 102: 855-864. https://doi.org/10.1016/j.biopha.2018.03.136
  • Afifi NA, Ibrahim MA, Galal MK (2018). Hepatoprotective influence of quercetin and ellagic acid on thioacetamide-induced hepatotoxicity in rats. Can. J. Physiol. Pharmacol. 96(6):624-629. https://doi.org/10.1139/cjpp-2017-0651
  • Alkhalaf NA, Osman AK, Salama KA (2010). Monitoring of aflatoxins and heavy metals in some poultry feeds. African J. Food Sci. 4: 192-199.
  • Azab RM, Tawakkol WM, Hamad AM, Abou-Elmagd MK, El-Agrab H M, Refai MK (2005). Detection and estimation of aflatoxin B1 in feeds and its biodegradation by bacteria and fungi. Egypt. J. Natural Toxins. 2: 39-56.
  • Begum F, Rehman A, Maliha G, Nuzhat J (2001). Distribution of aflatoxin B1 from poultry feed to different body tissues of broilers. Pak. Vet. J. 21: 121-123.
  • Beutler E, Duron O, Kelly BM (1963). Improved method for the determination of blood glutathione. J. Lab. Clin. Med. 61: 882-888.
  • Bryden WL (2012). Mycotoxin contamination of the feed supply chain: Implications for animal productivity and feed security. Anim. Feed Sci. Technol. 173(1): 134-158. https://doi.org/10.1016/j.anifeedsci.2011.12.014
  • Daniela EM, Ionelia T (2012). Overview on aflatoxins and oxidative stress. Informa Healthcare USA, Inc. https://doi.org/10.3109/15569543.2012.730092
  • Eleftheriadou A, Kaniou I, Mouratidou T, Moumtzis A, Libitakis N (2004). Tracing and quantitative evaluation of aflatoxins (B1, B2, G1, G2) in animal feeds and fattening chickens. Arch. Food. Hyg. 55: 16- 18.
  • European Commision (2003). Commision Directive 2003/100/EC OF 31 October 2003 amending Annex 1 to Directive 2002/32/EC of the European Parliament and of the Council on undesirable substances in animal feed. Off. J. Eur. Commun. l(46): 33-37.
  • European Commission Regulation (EC) NO 1881/2006 (of 19 December 2006). Setting Maximum Levels for Certain Contaminants in Foodstuffs, Official Journal of the European Union Series L. No. 364: 5-24.
  • Farombi EO, Adepoju BF, Ola-Davies OE, Emerole GO (2005). Chemoprevention of aflatoxin B1-induced genotoxicity and hepatic oxidative damage in rats by kolaviron, a natural biflavonoid of Garcinia kola seeds. Eur. J. Cancer. Prev. 14: 207-214. https://doi.org/10.1097/00008469-200506000-00003
  • Faten SH, Mousa MM, Mahomud AH, Wafaa MH, Fatma HA (2016). Aflatoxins residues in chicken and turkey tissues. Benha Vet. Med. J. 31(2): 130-135.
  • Gökhan E, Mehmet A, Ender Y, Fatma S, Dinç E, Levent A (2005). The Effects of Aflatoxins on Oxidative Stress in Broiler Chickens. Turk. J. Vet. Anim. Sci. 29: 701-707.
  • Halliwell B, Gutteridge JMC (2007). Free Radicals in Biology and Medicine. Fourth Edition, Oxford University Press, Oxford, UK.
  • Hansen TJ (1993). Quantitative testing for mycotoxins, VICAM, American Association of cereal. Chemists. Inc. 38/5-8.
  • Hassan AM, Youssef AI, Reddy PG (2012). Ochratoxin-A and Mold in Some Broiler Farms of Ismailia, Egypt and Evaluation of Common Mycotoxin Binders. Int. J. Poult. Sci. 11(4): 288-293. https://doi.org/10.3923/ijps.2012.288.293
  • Hossam El-Din MO (2013). Mycotoxins-Induced Oxidative Stress and Disease. INTECH, Chapter 3.
  • Hou Y-J, Zhao Y-Y, Xiong B, Cui X-S, Kim N-H (2013). Mycotoxin-Containing Diet Causes Oxidative Stress in the Mouse. PLoS ONE. 8(3): e60374 .https://doi.org/10.1371/journal.pone.0060374
  • Hussain Z, Khan MZ, Khan A, Javed I, Saleemi MK, Mahmood S, Asi MR (2010). Residues of aflatoxin B1 in broiler meat: effect of age and dietary aflatoxin B1 levels. Food Chem. Toxicol. 48:3304-3307. https://doi.org/10.1016/j.fct.2010.08.016
  • Ibrahem MD, Ibrahim MA (2014). The potential effects of Spirulina platensis (Arthrospira platensis) on tissue protection of Nile tilapia (Oreochromis niloticus) through estimation of P53 level. J. Adv. Res. 5(1):133-6. https://doi.org/10.1016/j.jare.2013.03.009
  • Inger V, Eva S, Claus-Peter C (2011). The Carry-Over of Mycotoxins in Products of Animal Origin with Special Regard to Its Implications for the European Food Safety Legislation. Food Nutr. Sci. 2: 852-867. https://doi.org/10.4236/fns.2011.28117
  • Kamel S, Ibrahim M, Awad ET, El-Hindi HMA, Abdel-Aziz SA (2018). Differential expression of CYP2j2 gene and protein in Camelus dromedarius. J. Biol. Regul. Homeost. Agents. 32(6):1473-1477.
  • Khalil A, Alkhalaileh NI, Anas A, Abdur-Rahman AA, Saqer MH (2015). Occurrence of Aflatoxin B1 in Poultry Feed and Feed Ingredients in Jordan Using ELISA and HPLC. American-Eurasian J. Toxicol. Sci. 7(4): 316-320.
  • Lopez C, Ramos L, Bulacio L, Ramadan S, Rodriguez F (2002). Aflatoxin B1 content in patients with hepatic diseases. Medicina. 62(4): 313-316.
  • Marklund S, Marklund G (1974). Involvement of the super-oxide anion radical in the autoxidation of pyrogallol and convenient assay for super-oxide dismutase. Eur. J. Biochem. 47: 469-474. https://doi.org/10.1111/j.1432-1033.1974.tb03714.x
  • Martín-Sánchez AM, Chaves-López C, Sendra E, Sayas E, Fenández-López J, Pérez-Álvarez JA (2011). Lipolysis, proteolysisand sensory characteristics of a Spanish fermented dry-cured meat product (salchichón) with oregano essential oil used as surface moldinhibitor. Meat. Sci. 89: 35-44. https://doi.org/10.1016/j.meatsci.2011.03.018
  • Mngadi PT, Govinden R, Odhav B (2008). Co-occurring mycotoxins in animal feeds. African J. Biotechnol. 7: 2239-2243.
  • Morgan A, Ibrahim MA, Noshy PA (2017). Reproductive toxicity provoked by titanium dioxide nanoparticles and the ameliorative role of Tiron in adult male rats. Biochem. Biophys. Res. Commun. 486(2):595-600. https://doi.org/10.1016/j.bbrc.2017.03.098
  • Nahla EF, Mahmoud ME, Radi AM, Wael FE, Samy AE (2015). Management of Poultry Farms and the Likelihood of Contamination of Poultry Feed with Mycotoxins in Gharbia Governorate, Egypt. World. Vet. J. 5(4):51-58. https://doi.org/10.5455/wvj.20151056
  • Nedeljkovic-Trailovic J, Jovanovic N, Sinovec ZJ (2004). Effects of exposure time and dietary ochratoxin a level on broiler performance. Acta. Veterinaria. 54(5-6): 419-426. https://doi.org/10.2298/AVB0406419N
  • Rashid N, Bajwa MA, Rafeeq M, Khan MA, Ahmad Z, Tariq MM, Wadood A, Abbas F (2012). Prevalence of aflatoxin b1 in finished commercial broiler feed from west central Pakistan. J. Anim. Plant Sci. 22(1): 6-10. ISSN: 1018-7081.
  • Salem R, El-Habashi N, Fadl SE, Sakr OA, Elbialy ZI (2018). Effect of probiotic supplement on aflatoxicosis and gene expression in the liver of broiler chicken. Environ. Toxicol. Pharmacol. 60:118-127. https://doi.org/10.1016/j.etap.2018.04.015
  • Saqer MH (2013). Aflatoxin b1 residues in eggs and flesh of laying hens fed aflatoxin B1 contaminated diet. American J. Agric. Biolog. Sci. 8(2): 156-161. https://doi.org/10.3844/ajabssp.2013.156.161
  • SPSS (2001). SPSS/PC+ (2001), for the PC/XT, SPSS INC.
  • Talebi E, Khademi M, Rastad A (2011). An Over Review on Effect of Aflatoxin in Animal Husbandry. Asian J. Exp. Biol. Sci. 2(3): 754-757.
  • Wang F, Shu G, Peng X (2013). Protective effects of sodium selenite against aflatoxin B1-induced oxidative stress and apoptosis in broiler spleen. Int. J. Environ. Res. Public Health. 10(7):2834-44. https://doi.org/10.3390/ijerph10072834
  • Verma RJ, Nair A (2001). Ameliorative effect of vitamin E on aflatoxin-induced lipid peroxidation in the testis of mice. Asian J. Androl. 3: 217-221. https://doi.org/10.1080/00071660412331286226
  • Verma J, Johri T, Swain B, Ameena S (2004). Effect of graded levels of aflatoxin, ochratoxin and their combinations on the performance and immune response of broilers. Brit. Poult. Sci. 45(4): 512-518.
  • VICAM LP (1997). Afla Test Instruction Manual, USA.
  • Yagi K (1987). Lipid peroxides and human disease. Chem. Phys. Lipids. 45: 337-351. https://doi.org/10.1016/0009-3084(87)90071-5
  • Yang J, Bai F, Zhang K, Bai S, Peng X, Ding X, Li Y, Zhang J, Zhao L (2012). Effects of feeding corn naturally contaminated with aflatoxin B1 and B2 on hepatic functions of broilers. Poult. Sci. 91: 2792-2801. https://doi.org/10.3382/ps.2012-02544
  • Zahid H, Muhammad ZK, Ahrar K, IjazJ, Muhammad KS, Sultan M, Muhammad RA (2010). Residues of aflatoxin B1 in broiler meat: Effect of age and dietary aflatoxin B1 levels. Food. Chem. Toxicol. 48: 3304-3307. https://doi.org/10.1016/j.fct.2010.08.016
  • Zain ME (2011). Impact of mycotoxins on humans and animals. J. Saudi Chem. Societ. 15(2): 129-144. https://doi.org/10.1016/j.jscs.2010.06.006
  •