Research Article

 

Co-circulation of Major Avian Respiratory Viruses in Egypt: Avian Influenza and Newcastle Disease Viruses

 

Ahmed Mohamed El-Sadek Hegazy1, Abeer Fathy Ibrahim Hassan2, Hala Mohamed Nabil Tolba1*

1Department of Avian and Rabbit Medicine, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt; 2Veterinary Hospital, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt.

 

Abstract | Avian influenza (AI) and Newcastle disease (ND) viruses are continuously affecting the Egyptian poultry industry in spite of intense vaccination schemes leading to sever economic losses. The aim of this study is to track the effect role of AIV and NDV infections in commercial layers between November 2017 and February 2019. In the present study, fifty tissue samples were collected from different layer flocks suffered from cyanosis in comb and wattles, variable respiratory manifestations and egg production problems and subjected for avian respiratory viruses screening using different diagnostic tools. Virus isolation was carried through inoculation of tissue homogenate into allantoic cavity of 9 days old SPF ECEs revealed that out of 50 samples, allantoic 35 samples were haemagglutination (HA) positive then and subjected for molecular identification based on real-time RT-PCR assay. Twenty-six allantoic fluid samples were for NDV with percentage of 74.28% while the remaining sixteen samples were positive for AIVs with percentage of 45.71% at which four samples were positive for H5 (4/16; 25%)positive, nine samples were H9 subtype positive (9/16; 56.25%) and 3 samples have mixed infection with H5 and H9 (3/16; 18.75%). Sequence analysis of the (HA and NA gene of two H5 isolates has a multi-basic amino acid motif at the cleavage site (321-PLREKRRKR/GLF-333), which is specific to highly pathogenic AIV. All H5N8 influenza isolates belonged to clade 2.3.4.4b Russian like H5N8 reassortant. The H9N2 isolates had amino acid motif at the cleavage site (333-PARSSR/GLF-341), which is specific to Low Pathogenic AIV. Furthermore, sequencing and phylogenetic analysis of M gene of selected three NDV isolates showed all related to sub genotype VIIb field strain. Our obtained results revealed the co-circulation of two major avian respiratory viruses as avian influenza and Newcastle among layers.

 

Keywords | Avian Influenza virus, H5N8, H9N2, Newcastle disease virus, Layer flocks

 

Received | September 12, 2019; Accepted | October 26, 2019; Published | December 12, 2019

*Correspondence | Hala Mohamed Nabil Tolba, Department of Avian and Rabbit Medicine, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt, Mohammed Ali street No.3, 44519, Zagazig, Sharkia, Egypt; Email: [email protected]

Citation | Hegazy AME-S, Hassan AFI, Tolba HMN (2019). Co-circulation of major avian respiratory viruses in Egypt: avian influenza and newcastle disease viruses. Adv. Anim. Vet. Sci. 7(s2): 96-106.

DOI | http://dx.doi.org/10.17582/journal.aavs/2019/7.s2.96.106

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2019 Hegazy et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

INTRODUCTION

 

Poultry industry in Egypt includes both commercial enterprises and backyard rearing (Abdelwhab et al., 2009). It has a large percentage of the supply of animal protein. Layers participate as enormous resources to the national avian flocks and this asserts the value of commercial layer flocks (Fasina et al., 2008). The rapid growth of the poultry industry in Egypt and worldwide trade as well as the live birds movement have been associated with the appearance and spread of various viral diseases (Abdelwhab et al., 2010).

 

Nowadays, viral respiratory diseases are a major problem in the Egyptian poultry flocks. They caused by AIV, virulent velogenic NDV and IBV (Awad et al., 2016) These pathogens, are causing disease with a huge economic impact (Roussan et al., 2008).

 

Outbreaks of avian influenza viruses represent a main menace to industry of poultry worldwide (Abdelwhab and Hafez, 2011). Avian influenza viruses are divided into: highly pathogenic avian influenza viruses (HPAIV) and low pathogenic avian influenza viruses (LPAIVs), according to their pathogenicity to poultry (Alexander, 2000). Highly pathogenic AI viruses cause severe respiratory manifestation and decrease in egg production with mortality up to 100% (Capua et al., 2000). While LPAI viruses induce asymptomatic manifestation to mild respiratory diseases with drop in egg production. However, it can cause high mortality in case of coinfection with other secondary bacterial pathogens (El-Zoghby et al., 2011).

 

In the past few years, H9N2 of Eurasian G1-like lineage has emerged into the Egyptian poultry industry as low-pathogenic avian influenza and up till now still endemic in the domesticated birds (Peacock et al., 2019). Furthermore, in 2016, H5N8 highly pathogenic avian influenza (HPAI) viruses were originally came from China; reported in Egypt with clade 2.3.4.4 group b that was related to the Eurasian HPAI H5N8 viruses (Yehia et al., 2017).

 

Unfortunately, the continuous and intensive use of the currently used AI vaccines could not provide the birds with sterilized immunity and stop shedding of the virus. This fact, updating the strategy for AIV control and prevention in Egypt is very critical and mandatory (Kandiel et al., 2018). The presence of HPAI H5N1 and LPAI H9N2 in Egypt influence in the epizootiologic manner to each other particularly in mixed with different application of vaccine (Arafa et al., 2012b). Since the H5N1 outbreak in Egypt in mid-February 2006, enumerous loss in the poultry industry has occurred, and the slaughter campaign overwhelmed the resources of veterinary and public health authorities (Abdelwhab and Hafez, 2011). Despite vaccination and biosecurity measures have been implemented, the disease is still endemic in Egypt and affecting the poultry and public health sectors.

 

Newcastle disease virus is an important viral respiratory disease to all poultry industry and a very important problem for poultry in many countries due to its effect on poultry production. Huge efforts have been made for controlling this disease. Recent studies confirmed that widely spread and circulation of NDV of genotype VII that belongs to class II, in Egypt via commercing poultry and poultry products (Elhady et al., 2018). Here in our study we investigated the current field situation of avian respiratory viruses causing real time RT-PCR assay especially for AIV subtypes H5N8, H9N2 and ND virus in Egypt. Sequence analysis were done to monitor the genetic properties of the circulating viruses in Sharkia in commercial layer flock during 2017-2019.

 

MATERIAL AND METHODS

 

Collection and preparation of samples and data

Samples from layers suffered from respiratory signs, mortalities and decrease in egg production were collected in the period from November 2017 to February 2019 from different farms in Sharkia governorate, Egypt (Table 1). The affected flocks were subjected to clinical and postmortem examination. Tissue samples (liver, lung, spleen, ovaries and oviducts) of (3-5) freshly pooled dead birds from 50 chicken layer flocks were collected. The collected tissues were pooled and homogenized in 10 mL sterile PBS to make suspension, the tissue homogenate were centrifuged at 3,000 rpm for 15 min then we collected the supernatant and transferred to sterile Eppendorf tubes containing 100 µL PEN-STREP antibiotic (Biowest company, Lot no:0510X), stored at −80 oC until used for virus isolation and real-time RT-PCR screening. The study was approved by the Committee of Animal Welfare and Research Ethics (protocol #ZU-IACU/2/F/10/2018).

 

Virus isolation, Antigenic Characterization and Molecular identification

Specific pathogen-free embryonated chicken eggs (SPF ECEs) were obtained from Kom Oshim, EL-Fayoum were used for virus inoculation. The tissue homogenates were inoculated into the allantoic cavity of 9–11-day-old through the allantoic route according to standard procedures (OIE, 2012). The allantoic fluid was collected from eggs with dead embryo after 24h and tested by slide Haemagglutination assay (HA). At least three successive virus passages were made for each sample to assure to be negative from avian influenza and Newcastle viruses. Viral RNA was extracted from the harvested allantoic fluids using the QIAamp viral RNA Mini kit (Qiagen, Hilden, Germany, GmbH) following the manufacturer’s instructions. Primers and probes used targeting the H5 (Londt et al., 2008) and H9 (Ben Shabat et al., 2010) subtypes and M gene of NDV (Wise et al., 2004) were used and supplied from Metabion (Planegg, Germany) Table 2.

 

Real time RT-PCR were carried out by adding of 25 ul to 7 ul RNA template, 12.5 ul of RT-PCR 2X probe Quanti Tect Master Mix (Qiagen, Germany), 3.625ul PCR water,50 pmol of each primer, 30 pmol of each probe and 50 pmol of Quanti Tect RT Mix. All steps at temperature 50 oC for 30 min, primary denaturation at 95 oC for 15 min and 40 cycles of denaturation at 94c for 30s. the annealing at 54c for 30 s and extension at 72 oC for 10s. The same thermal amplification of M gene for Newcastle as HA gene except annealing temperature at 55 oC for 30s. The positive specimens of H9N2, H5N8 and ND subjected to conventional RT-PCR. Extracted RNA was transcribed to CDNA by Revert Aid H Minus First Strand CDNA

 

Table 1: Descriptive data of examined layers suspected to be infected with AIV and NDV within Sharkia province (2017-2019).

 

Locality Vaccination with H5 and H9 vaccine Effect on egg production Severity of respiratory signs Mortality/ daily Breed Age/week A Birds no Flock no fl
SHIBA

-VE -

↓10% +++ 10 Lohman elwadi 20 1000 1
Qinaiat -ve ↓1-2% + 10 H and N 16 1000 2
Hehya +ve (H5 vaccine) ↓5-10% ++ 15-20 Lohman elwadi 30 2350 3
Hehya +ve (H5 vaccine ↓5-10% ++ 15-20 Isa brown 30 2850 4
Tal Raq +ve ↓20% +++ 20-70 Bovans 30 5500 5
Fakous +ve ↓20-25% ++ 15 TITRA 24 1000 6
Fakous +ve ↓from 91% to 42% +++ 500 Lohman elwadi 25 12000 7
Ibrahimia -VE ↓10% ++

10-15, 10-1

H and N 24 1500 8
Abo Kabir A +ve Not affected + 20-25 Lohman elwadi 32 4000 9
Abo Kabir +ve ↓10% + 25 Bovans 40 4000 10
Bilbis +ve ↓15% ++ 1-2 H and N 30 8000 11
Kafr Sakr +ve ↓15-20% ++ 20-25 Bovans 28 3000 12
Hehya +ve ↓40%within 20 days +++ 10 Lohman elwadi 30 9500 13
Kafr Sakr +ve ↓25% ++ 30 H and n 28 6000 14
Shobak S +ve ↓15% + 10-15 lohman 31

250025

15
Diarb Negm D +ve ↓10% ++ 20 Lohman elwadi 28 5000 16
Ibrahimia +ve ↓25% +++ 15-20 TITRA 30 2500 17
Fakous +ve ↓20% +++ 50 H and N 28 7000 18
Hehya +ve ↓15% ++ 10-15 Bovans 29 3000 19
Hehya +ve ↓2-3% + 20 Lohman elwadi 29 10000 20
Elsalhia diarb Ne +ve ↓↓5-10% +++ 25 H and N 33 5500 21
Diarb Negm +ve ↓5% ++ 10-15 Lohman elwadi 31 2000 22
Fakous +ve ↓15% ++ 20

Isa brown

20 1000 23
qinaiat +ve ↓25% ++ 20 H and N 32 2500 24
Diarb Negm +ve ↓10% ++ 15-20 Lohman elwadi 40 4000 25
Kafr Sakr +ve ↓3-5% ++ 15-20 Lohman elwadi 35 5000 26
Shirwida +ve ↓15% +++ 30-35 Bovans 33 4000 27
Fakous +ve ↓10% ++ 25 H and N 29 1500 28
Ibrahimia +ve ↓10% ++ 10-15 Bovans 30 1500 29
Ibrahimia +ve ↓1-2% ++ 30-35 Lohman elwadi 30 8000 30
Hehya +ve Not affected + 15

Is a brown

29 4000 31
  +ve ↓5-10 ++ 20-25 Lohman elwadi 35 2000 32
Diarb Negm +ve ↓35% ++ 10 H and N 28 3000 33
Fakous +ve ↓20% ++ 25-30 Lohman elwadi 30 5500 34
Banayos +ve ↓3-5% ++ 25 Bovans 29 1000 35
Met abo ali +ve ↓15% ++ 50 H and N 30 3550 36
Hehya +ve ↓10% ++ 15-20 Bovans 29 2700 37
Fakous +ve ↓10% ++ 25 H and N 27 2000 38
Borden BO +ve ↓5% ++ 20 Lohman elwadi 33 1500 39
Ibrahimia +ve ↓2-3% ++ 25 Lohman elwadi 30 4000 40
Ibrahimia +ve ↓15% ++ 10 H and N 29 3000 41
Diarb Negm +ve ↓5% ++ 5 Bovans 30 2500 42
Hehya +ve ↓5% ++ 10-15 H and N 35 6000 43
Ibrahimia +ve ↓10% ++ 5 Lohman elwadi 48 4000 44
Kafr Sakr +ve ↓20% ++ 10 Bovans 29 2000 45
banayos +ve ↓10% ++ 25 Lohman elwadi 30 2000 46
Fakous +ve ↓25% ++ 20 H and N 33 9000 47
Hehya +ve ↓15% ++ 50-70 Lohman elwadi 30 5000 48
Shobak +ve ↓10% ++ 15 H and N 28 2000 49
Abo Kabir +ve ↓10% ++ 25 Bovans 40 10000 50

Table 2: Primers and probes used for real time PCR.

 

Virus Gene Primer/ probe sequence 5'-3' Ref
AI M

Sep1

AGATGAGTCTTCTAA CCGAGGTCG

Slomka et al., 2007

Sep 2

TGCAAAAACATCTTC AAGTCTCTG

SEPRO

[FAM]TCAGGCCCC CTCAAAGCCGA [TAMRA]

H5

H5LH1

ACATATGACTAC CCACARTATTCA G

Lȍndt et al., 2008

H5RH1

AGACCAGCT AYC ATGATTGC

H5PRO

[FAM]TCWACA GTGGCGAGT TCCCTAGCA[TAMRA]

H9

H9F

GGAAGAATTAATTATTATTGGTCGGTAC

Ben Shabat et al., 2010

H9R

GCCACCTTTTTCAGTCTGACATT

H9 Probe

[FAM]AACCAGGCCAGACATTGCGAGTAAGATCC[BHQ]

ND Matrix

M+4100

AGTGATGTGCTCGGACCTTC-3’

Wise et al., 2004

M-4220 CCTGAGGAGAGGCATTTGCTA-3’
M+4169 [FAM]TTCTCTAGCAGTGGGACAGCCTGC[TAMRA]-3’

 

Table 3: Primers used in Reverse Transcriptase-Polymerase Chain Reaction (one step RT-PCR) and Sequence reaction of HA and NA genes of H9N2.

 

Prime ID Primer Sequence for HA gene amplification Reference
F1-6 5’ TAG CAA AAG CAG GGG AAT TTC TT 3’ RLQP
H9- Rev 5’ GCC ACC TTT TTC AGT CTG ACA TT 3’

Ben Shabat et al., 2010

H9-For 5’GGA AGA ATT AAT TAT TAT TGG TCG GTA C 3’

Ben Shabat et al., 2010

HT7R 5’ TAA TAC GAC TCA CTA TAA GTA CAA ACA AGG GTG 3’ SEPRL
  Primer Sequence for NA gene amplification  
N2-R950 CGC CAA CAA GTC CTG AGC ACA CAT RLQP
N2-F630 CAT GGG ATG CTT ACC GAC AGT ATT RLQP

 

Table 4: Primers used in Reverse Transcriptase-Polymerase Chain Reaction (one step RT-PCR) and Sequence reaction of HA and NA genes of H5N8.

 

Prime ID Primer Sequence for HA gene amplification Reference
HGGT

5’ CTC TTC GAG CAA AAG CAG GGG T 3’

RLQP
KH3 5’ TAC CAA CCG TCT ACC ATK CCYTG 3’

Ben Shabat et al., 2010

H5F5-1088 5’ TTG GAG CTA TAG CAG GTT TTA TAG AGG 3’

Ben Shabat et al., 2010

Bm-NS-890R 5’ ATA TCG TCT CGT ATT AGT AGG AAA CAA GGG TGT TTT 3’ SEPRL
  Primer Sequence for NA gene amplification  
f1- N8

5’GCA AAA GCA GGA GTT TAA AAT GAA TCC 3’

RLQP
R778-N8

GCC TTG ATT TGC TTT GT 3’ 5’

RLQP

 

 

Synthesis Kit Fermentas Inc., Walthan, MA, USA, according to manufacturer instructions Tables 3 and 4.

 

Sequencing, Sequence analysis and phylogenetic analysis

we select Two H5N8, three H9N2 and three ND isolates as they cause high mortalities and severe decrease in egg production for sequencing by using Bigdye Terminator V3.1 cycle sequencing Kits (Perkin-Elmer, Foster city, USA). HA and NA subtypes for AIVS known by nucleotide BLAST (http://www.ncbi.nim.nih.gov/BLAST) and recorded in Gene Bank with accession numbers for HA were MK975994, MK975995, MK968882, MK968881 and MK968880 and for NA were MK975996, MK975997, MK968894, MK968893 and MK968892. The phylogenetic tree was performed by neighbor-Joining method in MEGA version 7 (http://www.megasoftware.net). The tree topology was evaluated by 1,000 bootstrap analyses.

 

Results

 

Clinical and postmortem examination

In the present study layers showed, comb and wattle edema with cyanosis, respiratory signs, greenish watery diarrhea, shell-less egg, and soft eggs were reported with drop in egg production percentage with 10-15% mortality were also recorded. Postmortem examination revealed congested trachea, pneumonic lung, air sacculitis. There was petechial hemorrhage in proventriculus and pectoral muscle, hemorrhagic enteritis, egg peritonitis and hemorrhage in ovarian follicle (Figure 1).

 

Figure 1: Clinical manifestations and PM lesions of laying chickens suspected to be infected with AIVs and NDV. (A) severe congestion in comb, wattle and face edema in 28week flock No.13. Belbais; (B) severe hemorrhage and congestion of ovary; (C) severe congestion in spleen and ascites in 28 week flock No.19. Hehia; (D) hemorrhage and congestion in duodenum, pancreas in 25 week flock No.5 Talraq.

 

Virus isolation, Haemagglutination and Molecular identification

Inoculation of embryonated chicken eggs with tissue homogenates from bird samples showed mortality and AIV and NDV lesions in embryos after 24 h in all samples. Haemagglutinating viruses were detected in 35 samples (70%) as in (Table 5). Positive HA allantoic fluids from samples were subjected to real-time RT-PCR to identify NDV and AIVs subtypes (H5N8 and H9N2). The results revealed that 26 (74.28%) out of 35 were positive NDV genotype VII field isolate and 16 (45.71%) out of 35 were positive for AIVs, out of 16 positive AIVs 4 flocks (25%) were H5 subtype positive 9 flocks (56.25%) were H9 subtype positive and 3 (18.75%) mixed flocks with H5 and H9. All the samples obtained from vaccinated flocks against both Newcastle and influenza viruses. The Ct values from examined samples are in (Table 5).

 

Table 5: Result of Haemagglutination assay and CT value of Real time RT PCR.

 

CT

Slide HA Code no Flocl no
ND H9 H5
16 NO CT NO CT + 5 1
15 19 26 + 7 2
17 NO CT 14 + 13 3
27 13 NO CT + 14 4
16 25 NO CT + 15 5
26 11 17 + 16 6
31 NO CT NO CT + 18 7
23 NO CT NO CT + 19 8
26 NO CT NO CT + 20 9
11 NO CT NO CT + 21 10
32 NO CT NO CT + 22 11
26 NO CT NO CT + 23 12
26 NO CT NO CT + 24 13
22 15 NO CT + 26 14
14 NO CT 14 + 30 15
14 26 NO CT + 31 16
14 NO CT NO CT + 32 17
27 NO CT NO CT + 33 18
18 NO CT NO CT + 34 19
26 14 NO CT + 35 20
22 26 29 + 36 21
16 NO CT 17 + 40 22
24 14 NO CT + 41 23
24 26 NO CT + 42 24
23 NO CT 28 + 49 25
22 26 NO CT + 50 26
-VE -VE -VE + 8 27
-VE -VE -VE + 9 28
-VE -VE -VE + 44 29
-VE -VE -VE + 47 30
-VE -VE -VE + 48 31
-VE -VE -VE + 39 32
-VE -VE -VE + 28 33
-VE -VE -VE + 10 34
-VE -VE -VE + 6 35

 

Sequencing and phylogenetic analysis

H5N8, H9N2 and NDV isolates from laying hens were confirmed further by sequencing. The phylogenetic analysis of HA gene sequences (Figure 2) and NA gene sequence (Figure 3) of the three Egyptian isolates (H9N2; A/chicken/Egypt/AB2/2018, A/chicken/Egypt/AB3/2018 and A/chicken/Egypt/AB4/2018) showed that they were closely related to the other Middle East H9N2 strains. Our isolates shared the common ancestor with A/Qa/HK/G1/97 present in Asia of one group (Egy/G1) related to the G1 lineage within group B. (Abdelhafez et al., 2019) Sequencing of the HA segment revealed amino acid motif at the cleavage site (333-PARSSR/GLF-341), which is characteristic of LPAIV. When comparing the three isolates togeather, the NA gene showed 100% identity whereas the HA showed approximately 99% amino acid identity. as in (Figure 7).

 

Figure 2: Phylogenetic tree of amino acid sequence of the hemagglutinin genes of three field isolate of avian influenza subtype H9N2 (black circle) viruses isolated in Egypt during 2017–2019 and with reference strains from GenBank.

 

Figure 3: Phylogenic tree of amino acid sequence of NA gene of three field isolate subtype H9N2 (black circle) with other reference strains in gene bank.

 

The phylogenetic analysis of HA gene sequences and NA gene sequence (Figures 4 and 5) of our Egyptian two isolate (H5N8) showed that our isolates belonged to Russian like H5N8 reassortant which was named A/chicken/Egypt/AB1/2018 and A/chicken/Egypt/AB2/2018. Sequencing of HA gene of the two isolates showed a multi-basic amino acid motif at the cleavage site (PLREKRRKR/GLF/), which is characteristic to HPAIV. They were compared with other H5N8 isolates and Avian influenza vaccines used commercially on the gene bank. The results showed that the two isolates present in one group with Russian strains and belonged to clade 2.3.4.4b, this indicated that the Russian HPAI H5N8 virus from Russia, Europe (A/great-creste_grebe/Uvs-Nuur_Lake/341/2016) is the origin of the reassortant Egyptian H5N8 viruses. No mutation and gross deletions was detected among the two Egyptian H5N8 viruses. The NA and HA gene of our isolates showed amino acid identity with other selected isolate with percentage of 84.7-100% as in (Figure 7).

 

Figure 4: Phylogenic tree of amino acid sequence of HA gene of two field isolates highly pathogenicH5N8 (black star) with other reference strains in gene bank

 

Figure 5: Phylogenic tree of amino acid sequence of NA gene of two field isolate subtype H5N8 (black circle) with other reference strains in gene bank.

 

Partial sequences of the selected isolated strains of NDV for M gene phylogenetically analyzed and showed that they belong to genotype VII vNDV (Figure 6). The vNDV isolates in our study were 100% typical to each other based on amino acid and nucleotide identities. Compared to other recent Egyptian strains isolated during 20112016, the identity ranged between 94.199.6% and 96.7 100% on nucleotide and amino acid levels, respectively.

 

Figure 6: Phylogenetic tree of selected field NDV (3 isolates) indicated by red circle with other related reference strains of NDV in gene bank.

 

Discussion

 

Layers shared enormous resources to the avian flock and this asserts the importance of layer flocks (Fasina et al., 2008), also the average mortality percent was the minimal. This may be as outcome of cage housing which prevent the movement and contact between infected and non-infected bird while in broilers reared in floor raised system and share water and feed sources. Not withstanding respiratory disease outbreaks have been in increase in layer flocks that caused by mainly by AIV, virulent NDv or IBv (Awad et al., 2016). These pathogens have a high significance and a big economic impact as they can cause diseases alone or mixed with each other (Roussan et al., 2008).

 

In the current study clinical examination of layers naturally layer flocks suspected to be infected with respiratory viruses revealed cyanosis in comb and wattle as well as facial edema, respiratory signs, greenish watery diarrhea and egg structural defects with drop in egg production. Postmortem examinations revealed congested trachea, pneumonic lung, air sacculitis and ovarian follicular hemorrhages. In Nigeria (Adene et al., 2006) cleared that laying hens naturally infected with AIV showed respiratory and intestinal lesions and 20% out of 248 laying hens showed nervous signs in young age. Also, other researchers confirmed the presence of neurological signs with no specific reference to age (Joannis et al., 2006) but Guan and colleagues (Guan et al., 2000) showed that coughing, sneezing and decline in production of egg with low percent is characteristic for H9N2 infection. The majority of AIV positive flocks were affected with H9 subtype with percentage 56.25%. Also, Francesco Bonfante et al. (2018) reported that H9N2 virus as a primary pathogen in layer hens, and is responsible for mild respiratory signs and drop of egg production with severe salpingitis. Infection of birds with LPAI viruses have no or few clinical signs (Bertran et al., 2014). Also, it may be transformed into pathogenic virus by way of mutation (OIE, 2008).

 

In the current study AIV subtypes H5N8 and H9N2 and NDV were investigated in commercial layer flocks in Egypt during the period of November 2017 to February 2019. All samples were isolated in SPF-ECEs though allantoic sac route and make death to the embryos with hemorrhagic lesions (Salaheldin et al., 2018). Also, our study showed that Haemagglutinating viruses were detected in 35 samples (70%) out of 50 flock samples. Positive harvested allantoic fluids were investigated by real-time (RT-PCR for detection NDV and AIVs subtypes (H5N8 and H9N2) as it represents accurate and sensitive method for AI detection (Bouwstra et al., 2015). The results revealed that 26 (74.28%) out of 35 were positive NDV genotype VIIb field isolate and 16 (45.71%) out of 35 were positive for AIVs. Out of 16 nine flocks (56.25%) were H9 subtype positive, four flocks (25%) were H5 subtype positive and 3 (18.75%) mixed flocks with H5 and H9. All the samples were from vaccinated flocks against Newcastle and influenza viruses. Our results were in accordance with those of (Arafat et al., 2018) they cleared that, the highest detection results for respiratory viruses were NDv (62.2%) followed by AI H9 (58%) then AI H5 virus (17.5%). Also (Samy and Naguib, 2018) reported that, in chickens Avian Influenza is one of the main causes of diseases affecting respiratory system with economic importance worldwide. In our study the mixed infection results observed only in three flocks where the H9N2, ND and H5N8 were isolated, this type of infection is very dangerous and causes high mortality to the infected laying birds. The causes of co- infection attributed to the infection with some viruses considered as a stress to the birds and facilitated the infection with other viruses. (Watanabe et al., 2018). The mixed infection with two subtypes of avian influenza has resulted in virus reassortment which associated with both increase in mortality and the dispersal of infection between poultry (Kayali et al., 2014). Egypt is believed to be a hotspot for the generation of new subtypes (Abdelwhab and Abdel-Moneim, 2015). Real time RT/PCR performing and then sequencing following by phylogenetic analysis is very remarkable and worthy protocol to identify subtypes of Avian influenza (Salaheldin et al., 2018).

 

Figure 7: Amino acid identity of HA and NA genes of H5N8 and H9N2.

 

In our study Two positive samples of PCR to (H5) were sequenced. The cleavage site of amino acids (PLREKRRKR/GLF) indicate that the two isolates are highly pathogenic Avian influenza virus as reported by (Kandeil et al., 2017) The HA and NA gene phylogenetic analyses showed that the two Egyptian HPAI H5N8 viruses clustered with 2.3.4.4b viruses from Russia, Europe, and Asia. Our results agreed with (Yehia et al., 2017) who registered the incursion of HPAI H5N8 virus of clade 2.3.4.4b and (Salaheldin et al., 2018). The present new subtypes need conciderations in vaccination prepare for good control and prevention. Also the three isolates of H9N2 have the same motif of low pathogenic avian influenza virus (PARSSR/GLF) as reported by (Steinhauer, 1999) and placed within G1B, the same lineage circulating in the Middle East as previously shown (Arafa et al., 2012). This motif has secreted only in respiratory organs and intestine (Neumann and Kawaoka, 2006) The incidence of H9N2 infections was low in layers and breeders. (Soliman et al., 2014). In previous studies HA gene was classified phylogeneticaly into 2 sub-lineages of group B (Kandeil et al., 2014). The proteolytic cleavage site on HA is the main pathogenicity factor of influenza viruses also the co- infection of NDV with H9 subtypes could be a factor in increased the severity of AI infection. The reason for that may be due to the cleavage activation of the HA. The cleavage of the HA play a key role in viral pathogenicity (El-Zoghby et al., 2011) The partial sequence analysis of HA and NA revealed that HA genes share similarity 100% with each other and NA 99% with other strains, the first Egyptian quail isolate in 2011 (Arafa et al., 2012)

 

The phylogenetic analysis of partial sequences of the selected isolated NDV strains for M gene showed that they belong to genotype VII velogenic strain. The amino acid sequences of the M protein proteolytic cleavage site motifs (residues 10 to 120) of the NDv strains M-gene were compared. The vNDV isolates in this study were 100% typical to each other based on amino acid identity. Compared to other recent Egyptian strains isolated during 2011–2016, the identity ranged between 90.6%–97.3% homology between each other, homology with field strain MH899832-1-2016-Egy-beh-chNR731(97%:98.4%) and homology with vaccinal strain Y18699Colone 30 is (77.5%: 79.1%). These results in accordance with (Awad et al., 2015).

 

CONCLUSIONS

 

In our study many respiratory viral diseases were recorded which make a threat to poultry industry in Egypt. NDV virus and H9N2, H5N8 avian influenza subtypes isolated from different localities in Egypt plus the high distribution of avian influenza H5N1among layer flocks in 2017 and 2019. Birds in ranches are stores assuming a role in the spread of the infection and delivering a general wellbeing hazard. Proper clean measures ought to be connected on ranches to control the presentation of birds and in this manner people to the wellspring of infection. Proceeds with surveillance and observing of the circulating viruses is significant for understanding the development of the viruses and to all the more likely selected viruses for immunization concentrates to limit the wide spread of the viral infection.

 

ACKNOWLEDGEMENTS

 

The authors are thankful to Prof Dr. Fatma Professor of Virology and Vet., Faculty of Veterinary Medicine, Zagazig University for her valuable advice in analyzing the sequencing data.

 

Authors Contribution

 

Ahmed Mohamed EL-Sadek Hegazy provided guidance, technical support and edited the manuscript and reviewed drafts of the paper, approved the final draft. Abeer Fathy Ibrahim Hassan prepared figures and/or tables. Hala Mohamed Nabil Tolba analysed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft.

 

CONFLICT OF INTEREST

 

The authors declare that there is no conflict of interest

 

REFERENCES

 

  • Abdelwhab EM,  Selim AA,  Arafa A,  Galal S,  Kilany WH, Hassan MK, Aly MM, Hafez MH (2010) . Circulation of avian influenza H5N1 in live bird markets in Egypt, Avian Dis.  54(2): 911-4.
  • Abdelwhab EM, Abdel-Moneim AS (2015). Epidemiology, ecology and gene pool of influenza A virus in Egypt: will Egypt be the epicentre of the next influenza pandemic? Virulence. 6: 6–8. https://doi.org/10.4161/21505594.2014.992662
  • Abdelhafez S, Amany A, Abdelsatar A, Hesham S, Hussein A. Hussein A (2019). Molecular pathogenic and host range determinants of reassortant Egyptian low pathogenic avian influenza H9N2 viruses from backyard chicken, Int. J. Vet. Sci. Med. 7(1): 10-19. https://doi.org/10.1080/23144599.2019.1637046
  • Abdelwhab EM, Arafa AS, Selim A, Samaha H, Kilany WH, Shereen G, Hassan MK, Aly MM, Hafez HM (2009). Highly pathogenic avian influenza in H5N1 in Egypt: current situation and challenges. Proc. Fifth Int. Meet. Working Group 10 (Turkey) of WPSA Berlin, Germany. pp. 308-316.
  • Abdelwhab EM, Hafez HM. (2011). An overview of the epidemic of highly pathogenic H5N1 avian influenza virus in Egypt: epidemiology and control challenges. Epidemi-ology Infect. 139: 647–657. https://doi.org/10.1017/S0950268810003122
  • Alexander DJ (2000). A review of avian influenza in different bird species. Vet. Microbiol. 74: 3-13. https://doi.org/10.1016/S0378-1135(00)00160-7
  • Adene DF, Wakawa AM, Abdu P.A, Lombin LH, Kazeem MM, Saidu L, Joannis TM, Adeyefa CAO and Obi TU (2006). Clinico-pathological and husbandry features associated with the maiden diagnosis of avian influenza in Nigeria. Nig. Vet. J. 27(1): 32-28
  • Arafa A, Hagag N, Erfan A, Mady W, El-Husseiny M, Adel A, Nasef, S. (2012). Complete genome characterization of avian influenza virus subtype H9N2 from a commercial quail flock in Egypt, Virus Genes. 45: 283–294. https://doi.org/10.1007/s11262-012-0775-0
  • Arafa AS, Hagag NM, Yehia N, Zanaty AM, Naguib MM, Nasef SA (2012b). Effect of cocirculation of highly pathogenic avian influenza H5N1 subtype with low pathogenic H9N2 subtype on the spread of infections. Avian Dis. 56: 849-857. https://doi.org/10.1637/10152-040812-Reg.1
  • Arafat N, Eladl AH, Marghani BH, Saif MA, El-Shafei RA (2018). Enhanced infection of avian influenza virus H9N2 with infectious laryngeotracheitis vaccination in chickens. Vet. Microbiol. 219: 8-16. https://doi.org/10.1016/j.vetmic.2018.04.009
  • Awad AM, Sedeik ME, Abdelkariem AA (2015). Isolation, molecular characterization, and pathotyping of NDV from field outbreak among broiler flocks in Egypt from 2014 to 2015. Int. J. Curr. Res. 7(2): 12925-12934.
  • Awad MA, Ali BA, Abd El-Hamid SH, El-Naggar LA, Sediek ME, El-Shall AN, El-Samahy SH (2016). Epidemiological Studies on H5N1 and H9N2 Avian Influenza Viruses during late 2013 and 2015 in Egypt. Alex. J. Vet. Sci. 1(2): 164-173. https://doi.org/10.5455/ajvs.221099
  • Ben Shabat M, Meir R, Haddas R, Lapin E, Shkoda I, Raibstein I, Perk S, Davidson I (2010). Development of a real-time TaqMan RT-PCR assay for the detection of H9N2 avian influenza viruses. J. Virol. Methods. 168 (1-2): 72-77. https://doi.org/10.1016/j.jviromet.2010.04.019
  • Bertran K, Dolz R, Majo N (2014) Pathobiology of avian influenza virus infection in minor gallinaceous species:a review. Avian Pathol. 43(1):9–25. https://doi.org/10.1080/03079457.2013.876529
  • Bonfante F, Mazzetto E, Zanardello C,Fortin A,Gobbo F, Maniero S, Bigolaro M, Davidson I, Haddas R,Cattoli G, Terregino C (2018). AG1 lineage H9N2 virus with oviduct tropism causes chronic pathological changes in the infundibulum and along-lasting drop in egg production.Vet. Res. 49: 83. https://doi.org/10.1186/s13567-018-0575-1
  • Bouwstra R, Heutink R, Bossers A, Harders F, Koch G, and Elbers A (2015). Full-Genome Sequence of Influenza A (H5N8) Virus in Poultry Linked to Sequences of Strains from Asia, the Netherlands. Emerg. Infect. Dis. J. 21(5): 872–874. https://doi.org/10.3201/eid2105.141839
  • Capua I, Mutinelli F, Bozza MA, Terregino C, Cattoli G (2000). Highly pathogenic avian influenza (H7N1) in ostriches (Struthio camelus). Avian Pathol., 29: 643-646. https://doi.org/10.1080/03079450020016913
  • Elhady MA, Ali A, Kilany WH, Elfeil WK, Ibrahim H, Nabil A, Samir A, El-Sayed M (2018). Field Efficacy of an Attenuated Infectious Bronchitis Variant 2Virus Vaccine in Commercial Broiler Chickens. Vet. Sci. 5(2): E49. https://doi.org/10.3390/vetsci5020049
  • El-Zoghby EF, Arafa A, Hassan MK, Aly MM, Selim A, Kilany WH, Selim U, Nasef S, Aggor MG, Abdelwhab EM, Hafez HM (2011). Isolation of H9N2 avian influenza virus from bobwhite quail (Colinus virginianus) in Egypt. Arch. Virol. 157(6):1167-1172. https://doi.org/10.1007/s00705-012-1269-z
  • Fasina FO, Sirdar MM, Bisschop SPR (2008). The financial cost implications of the highly pathogenic notifiable avian influenza H5N1 in Nigeria. Onderstepoort J. Vet. Res. 75(1): 39–46, 2008. https://doi.org/10.4102/ojvr.v75i1.86
  • Guan Y, Shortridge KF, Krauss S, Chin PS, Dyrting KC, Ellis TM, Webster RG Peiris M (2000). H9N2 influenza viruses possessing H5N1- like internal genomes continue to circulate in poultry in southeastern China. J. virol. 74: 9372–9380. https://doi.org/10.1128/JVI.74.20.9372-9380.2000
  • Guo YJ, Krauss S, Senne DA, Mo IP, Lo KS, Xiong XP, Norwood M, Shortridge KF, Webster RG, Guan Y (2000). Characterization of the pathogenicity of members of the newly established H9N2 influenza virus lineages in Asia. Virol. 267: 279-288. https://doi.org/10.1006/viro.1999.0115
  • Hassan KE, Ali A, Shany SAS, El-Kady MF (2017). Experimental co-infection of infectious bronchitis and low pathogenic avian influenza H9N2 viruses in commercial broiler chickens. Res. Vet. Sci. 115: 356-362. https://doi.org/10.1016/j.rvsc.2017.06.024
  • Joannis T, Lombin LH, de Benedictis P, Cattoli G, Capua I (2006). Confirmation of H5N1 avian influenza in Africa. Vet. Record. 158(9): 309–310. https://doi.org/10.1136/vr.158.9.309-b
  • Kandeil A, El-Shesheny R, Maatouq AM, Moatasim Y, Shehata MM, Bagato O, Rubrum A, Shanmuganatham K, Webby RJ, Ali MA (2014). Genetic and antigenic evolution of H9N2 avian influenza viruses circulating in Egypt between 2011 and 2013. Arch. Virol. 159: 2861-2876. https://doi.org/10.1007/s00705-014-2118-z
  • Kandeil A, Sabir JSM, Abdelaal A, Mattar EH, El-Taweel AN, Sabir MJ, Khalil AA, Webby R, Kayali G and Ali AM (2018). Efficacy of commercial vaccines against newly emerging avian influenza H5N8 virus in Egypt. Sci. Rep. (8): 9697-9702. https://doi.org/10.1038/s41598-018-28057-x
  • Kandeil A, Kayed A, Moatasim A,Webby RJ, McKenzie PM, Kayali G, Ali MA (2017). Genetic characterization of highly pathogenic avian influenza A H5N8 viruses isolated from wild birds in Egypt. J. Gen. Virol. 98(7): 1573-1586. https://doi.org/10.1099/jgv.0.000847
  • Kayali G, Kandeil A, El-Shesheny R, Kayed AS, Gomaa MM, Maatouq AM, Shehata MM, Moatasim Y, Bagato O, Cai Z, Rubrum A, Kutkat MA, McKenzie PP, Webster RG, Webby RJ, Ali MA (2014). Active surveillance for avian influenza virus, Egypt, 2010–2012. Emerg. Infect. Dis. 20: 542–551. https://doi.org/10.3201/eid2004.131295
  • Lee DH, Song CS (2013). H9N2 avian influenza virus in Korea: evolution and vaccination. Clin. Exp. Vaccine Res. 2: 26-33. https://doi.org/10.7774/cevr.2013.2.1.26
  • Lȍndt BZ, Nunez N, Banks J, Nili H, Johnson LK, Alexander DJ (2008). Pathogenesis of highly pathogenic avian influenza A/turkey/Turkey/1/2005 H5N1 in Pekin ducks (Anas platyrhynchos) infected experimentally. Avian Pathol. 37(6): 619-627. https://doi.org/10.1080/03079450802499126
  • Neumann G, Kawaoka Y (2006). Host range restriction and pathogenicity in the context of influenza pandemic. Emerg. Infect. Dis. 12: 881-886. https://doi.org/10.3201/eid1206.051336
  • OIE (2008). Manual of diagnostic test and vaccine for terrestrial animal. Paris, France: Avian Influenza. 465–481.
  • Peacock THP, James J, Sealy JE, Iqbal M (2019). A Global Perspective on H9N2 Avian Influenza Virus. Viruses, 11(7): 620. https://doi.org/10.3390/v11070620
  • Roussan DA, Haddad R, Khawaldeh G (2008). Molecular survey of avian respiratory pathogens in commercial broiler chicken flocks with respiratory diseases in Jordan. Poult. Sci. 87: 444–448. https://doi.org/10.3382/ps.2007-00415
  • Salaheldin AH, Abd El-Hamid HS, Elbestawy AR, Veits J, Hafez HM, Mettenleiter TC, Abdelwhab EM (2018). Multiple Introductions of Influenza A (H5N8) Virus into Poultry, Egypt. Emerg. Infect. Dis. J. 24 (5): 943-946. https://doi.org/10.3201/eid2405.171935
  • Slomka MJ, Pavlidis T, Banks J, Shell W, Mcnally A, Essen S, Brown IH (2007). Validated H5 Eurasianreal-time reverse transcriptase- polymerase chain reaction and its application in H5N1 outbreaks in 2005_2006. Avian Dis. 51: 373-377
  • Samy A, Naguib MM (2018). Avian Respiratory Coinfection and Impact on Avian Influenza Pathogenicity in Domestic Poultry:Field and Experimental Findings. Vet. Sci. 24(1): E23. https://doi.org/10.3390/vetsci5010023
  • Soliman M, Arafa A, Tammam S, Aly M, Madbouly H (2014). Molecular characterization of avian influenza virus subtype H9N2 in poultry in egypt during 2011-2013 with emerging of a new variant in quails. Glob. Vet-erinaria. 13: 117-126.
  • Steinhauer DA (1999). Role of hemagglutinin cleavage for the pathogenicity of influenza virus. Virol. 258: 1-20. https://doi.org/10.1006/viro.1999.9716
  • Swayne DE, Halvorson DA (2003). Influenza. In: Saif YM, Barnes HJ, Glisson JR, Fadly AM, McDougald LR, Swayne DE (eds): Diseases of Poultry, 11th Ed., Iowa State Univ. Press. Iowa, USA, pp. 135-160.
  • Watanabe Y, Arai Y, Kawashita N, Ibrahim MS, Elgendy EM, Daidoji T, Kajikawa J,Hiramatsu H, Sriwilaijaroen N, Ono T, Takagi T, Takahashi K, Shioda T, Matsumoto K, Suzuki Y, Nakaya T. (2018). Characterization of H5N1 influenza virus quasispecies with adaptive hemagglutinin mutations from single-virus infections of human airway cells. J. Virol. 14,92(11): 2004-2017. https://doi.org/10.1128/JVI.02004-17
  • Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ, Kapczynski DR, Erica SE (2004). Development of a Real-Time Reverse-Transcription PCR for Detection of Newcastle Disease Virus RNA in Clinical Samples. J. Clin. Microbiol. 42(1): 329–338. https://doi.org/10.1128/JCM.42.1.329-338.2004
  • World Organization for Animal Health (OIE).( 2012).Manual of diagnostic tests and vaccines for terrestrialanimals (Chapter 2.3.4). Available at http:// www.oie.int/ en/ international-standard-setting/ terrestrial-manual/ access-online/ (accessed on 25 May 2013).
  • Yang L, Zhu W, Li X, Zhang Y, Zou S, Gao R, Dong J, Zhai X, Chen W, Dong L, Xing Y, Wang D, Shu Y (2017). Genesis and dissemination of highly pathogenic H5N6 avian influenza viruses J. Virol. 14 (5): 91. https://doi.org/10.1128/JVI.02199-16
  • Yehia N, Mahmoud MN, Ruiyun L, Hagag N, El-Husseiny M, Mosaad Z, Nour A, Rabea N, Hasan WM, Hassan MK, Harder T, Arafa AA (2017). Multiple introductions of reassorted highly pathogenic avian influenza viruses (H5N8) clade 2.3.4.4b causing outbreaks in wild birds and poultry in Egypt. Infect. Genet. Evol. S1567-1348(17): 30437-30439. https://doi.org/10.1016/j.meegid.2017.12.011
  • Zhao M, Liu Q, Sun Q, Zhang W, Zhao G, Gu M, Wang X, Hu S, Liu X (2013). Full genome sequence of a natural reassortant H9N2 avian influenza virus isolated from domestic ducks in Jiangsu Province, China. Genome Announce. 1: 463-473. https://doi.org/10.1128/genomeA.00463-13
  •