Short Communication

 

Effect of Intrauterine Administration of Lipopolysaccharide (LPS) on the Transcriptional Profile of IL2, TNFα and IFNγ in Mice

 

Tumynak Loyi1, Harendra Kumar1*, Sukdeb Nandi2, Manas Kumar Patra1, Rafiqul Islam1, Narayanan Krishnaswamy1

1Division of Animal Reproduction; 2Centre of Animal Disease Research and Diagnosis, Indian Veterinary Research Institute, Izatnagar, 243 122, U.P. India.

 

Abstract | The effect of intrauterine (IU) infusion of lipopolysaccharide (LPS) on some of the proinflammatory cytokine was studied in a mice model. Female mice of nine week age (n=24) were divided into two equal groups; one group received LPS (E. coli O127:B8) 25μg in 100 μl PBS intrauterine while the other received PBS 100μl as vehicle. Immunokinetic study was done 12 and 24hrs post-LPS treatment by sacrificing 6 mice from each group at each time and relative expression of cytokines (IL2, TNFα and IFNγ) by real time PCR in the uterine tissue. Apparent up-regulation of IL2 cytokine mRNA expression at 12h (2-fold) and 24h (37-fold, P<0.05) was recorded in LPS-infused mice. Similarly, the expression of TNFα mRNA was elevated by 6 and 35-fold at 12 and 24h post infusion, respectively. The increase in the expression of IFNγ was found only at 12h (1.8-fold, P<0.05) in LPS infused mice. It is concluded that intrauterine administration of LPS in the mice elevated the expression of proinflammatory cytokines.

 

Keywords | Endometritis, Cytokine, Lipopolysaccharide, Mice, Intrauterine

 

Editor | Kuldeep Dhama, Indian Veterinary Research Institute, Uttar Pradesh, India.

Received | June 07, 2015; Revised | September 08, 2015; Accepted | September 11, 2015; Published | October 21, 2015

*Correspondence | Harendra Kumar, Indian Veterinary Research Institute, India; Email: [email protected]

Citation | Loyi T, Kumar H, Nandi S, Patra MK, Islam R, Krishnaswamy N (2015). Effect of intrauterine administration of lipopolysaccharide (LPS) on the transcriptional profile of IL2, TNFα and IFNγ in mice. Adv. Anim. Vet. Sci. 3(11): 613-616.

DOI | http://dx.doi.org/10.14737/journal.aavs/2015/3.11.613.616

ISSN (Online) | 2307-8316; ISSN (Print) | >2309-3331

Copyright © 2015 Loyi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Escherichia coli is the most common non-specific, opportunist pathogens that contaminate the postpartum uterus, thereby causing endometritis. The pathogenicity of E. coli is dependent on certain antigens that are essential for adhesion to epithelial cells, motility and cell wall associated endotoxin (like lipopolysaccharide, LPS) (Sheldon et al., 2010). Heat-killed E. coli and LPS initiate similar inflammatory responses by the endometrial cells vis-à-vis expression of inflammatory cytokines and enzymes of prostaglandin synthesis (Herath et al., 2006b), suggesting the importance of LPS in E. coli endometritis. Host cells recognize LPS via surface receptors, leading to initiation of downstream signaling that stimulate the production of nitric oxide, pro-inflammatory cytokines and chemokines (Herath et al., 2006b). These cytokines then further provide a positive feedback loop to increase the immune cell mobilization and further secretion of pro-inflammatory mediators. In addition to LPS, presence of virulent factor fim H gene of E. coli on postpartum day 1-3 was associated with a significantly increased risk of subsequent postpartum endometritis in the cow (Bicalho et al., 2012). A few studies have been carried out in mice with respect to the cytokine profile vis-à-vis the effect of LPS on uterine receptivity and embryonic development (Deb et al., 2005; Aisemberg et al., 2007). When endometrial specific strain of E. coli (cluster 4 O73:H16) and its purified LPS were infused into the uterine lumen of C57BL6 mice, it developed septic metritis with neutrophilic infiltration within 24 h (Sheldon et al., 2010). Recently, Hasan et al. (2013) demonstrated development of endometritis in the mice following intracervical inoculation of E. coli @ 104 cfu/mL after 24 h of treatment. In the present study, the relative expression of selected cytokines in uterine tissue subsequent to intrauterine infusion of E. coli LPS was studied.

 

Female mice of nine week age (n=24) were divided into two equal groups. One group received LPS (E. coli O127:B8) 25μg in 100 μl PBS intrauterine while the other

 

Table 1: Primers used to study the expression profile of genes coding for different cytokines in the mice

Gene

Sequence (5’-3’)

Primer length (bp)

Amplicon size (bp)

IL-2

F: CCTGAGCAGGATGGAGAATTACA

R: TCCAGAACATGCCGCAGAG

23

19

141

TNF-α

F: CATCTTCTCAAAATTCGAGTGACA A

R:TGGGAGTAGACAAGG TACAACCC

25

23

175

IFN-α

F: TCAAGTGGCATAGATGTGGAAGAA

R: TGGCTCTGCAGGATTTTCATG

24

21

92

β-actin

F:AGAGGGAAATCGTGCGTG AC

R:CAATAGTGATGACCTGGCCGT

20

21

148

 

administered PBS 100μl as vehicle. The stage of estrous cycle was determined based on vaginal cytology (Byers et al., 2012). Mice in estrus phase were secured in dorsal recumbency and the LPS or PBS was infused intrauterine. The mice were sacrificed at 12 or 24h interval and the uterine tissue were collected. A total of 1g tissue was weighed and used for total RNA extraction using Trizol reagent following the standard protocol. Extracted RNA was reverse transcribed to synthesize cDNA and polymerase chain reaction was done using specific primer sets (Overbergh et al., 1999) of target genes (Table 1). The PCR products were resolved in 2% (w/v) agarose gel along with a 100 bp DNA marker (Figure 1). The relative expression of IL2, TNFα and IFNγ in the uterine tissue of mice was evaluated by real-time PCR using SYBR green chemistry (Applied Biosystems). β-actin served as endogenous control gene while PBS treated group served as calibrator. The relative fold-change for each cytokine gene at 12 and 24h post-LPS infusion was analyzed by non-parametric Mann-Whitney U test.

 

Figure 1: RT-PCR products of β-actin, IL2, TNFα and IFNγ resolved in 2% agarose gel

 

In this study, IL2 and IFNγ expression were significantly (P<0.05) up-regulated at 24h and 12h post-LPS infusion, respectively as compared to control. However, a non-significant elevation in expression of TNFα at 12 and 24h post LPS infusion relative to control was recorded (Table 2). A numerical increase in the fold expression of the TNFα without significance might be due to low statistical power consequent to high heterogenity.

 

Table 2: Real-time transcriptional profile of the cytokine genes in the uterine tissue of LPS- infused mice relative to control

Cytokine gene

Time Post-LPS infusion (h)

Fold increase (n=6)

P value

IL2

12

2.38±1.36

0.647

24

36.75±23.48*

0.037

TNFα

12

6.258±3.00

0.647

24

35.14±17.64

0.431

IFNγ

12

1.81±0.02*

0.022

24

0.98±0.49

0.115

 

* Significance at 95% level (P<0.05)

 

 

LPS is the main pathogenic ligand of E. coli and a strong activator of innate immune response (Herath et al., 2006a). Following infection, an immune response is initiated by cell surface Toll-like receptor-4 (TLR4), CD14 and MD2 (Herath et al., 2006b; Herath et al., 2009), that detect pathogens and in turn trigger signaling pathways that activate molecules (transcription factors) that controls the induction of a proinflammatory immune response through activation of genes encoding cytokines (IFNγ, IL2 and TNFα) and chemokines (Bonizzi and Karin, 2004). It is suggested that LPS can trigger TNFα release by interferon-primed macrophages and induce IFNγ production, resulting in an additive effect on the production of TNFα. In addition, a higher endometrial expression of TLR4 in clinical endometritis was reported in buffaloes (Loyi et al., 2013). It is reported that treatment of bovine granulose cells in culture with LPS adversely affected oocyte maturation and increased IL6 transcripts (Bromfield and Sheldon, 2011) and steroidogenic capacity through TLR4 pathway (Price et al., 2013).

 

The elevated levels of TNFα and IFNγ in our study are in agreement with the reports of Nandi et al. (2010) who reported that bacterial LPS in the bloodstream induced production of inflammatory cytokines such as TNFα, IL1β and IFNγ. TNF is secreted from a variety of gestational cells upon stimulation with bacteria or lipopolysaccharides in vitro including placental fragments, amnion, and chorio-decidua (Sato et al., 2003). Herath et al. (2006b) also described the increased expression of TNFα in the cultured endometrial epithelial and stromal cells stimulated in vitro with LPS. However, Yang et al. (2009) did not observe a classical predominance of Th1 cytokine in the plasma of mouse of pre-term labour following intrauterine infusion of LPS.

 

Upregulation of IL2, IFNγ and TNFα transcripts in the uterine tissue of mice following LPS infusion in the present study indicates uterine inflammation. Intravaginal inoculation of mice with specific bovine uterine isolates of E. coli will further support the present observation. The efficacy of novel intrauterine drugs for the treatment of endometritis in the bovine may be tested using this model.

 

Acknowledgments

 

The authors are grateful to the Director, ICAR - Indian Veterinary Research Institute, Izatnagar for providing the facility to carry out the research work.

 

Conflict of interest

 

There is no conflict of interest.

 

AUTHORS CONTRIBUTION

 

The work was carried out by Tumnyak Loyi as part of her PhD thesis under the guidance of Harendra Kumar and Sukdeb Nandi. Manas Kumar Patra and Rafiqul Islam assisted in designing of experiment, sample collection, and analysis of result. Krishnaswamy Narayanan assisted in statistical analysis and preparation of the manuscript.

 

REFERENCES

 

  • Aisemberg J, Vercelli C, Billi S, Ribeiro ML, Ogando D, Meiss R, McCann SM, Rettori V, Franchi AM (2007). Nitric oxide mediates prostaglandins’ deleterious effect on lipopolysaccharide-triggered murine fetal resorption. Proc. Natl. Acad. Sci. USA. 104: 7534-7539. http://dx.doi.org/10.1073/pnas.0702279104
  • Bicalho MLS, Machado VS, Oikonomou G, Gilbert RO, Bicalho RC (2012). Association between virulence factors of Escherichia coli, Fusobacterium necrophorum and Arcanobacterium pyogenes and uterine diseases of dairy cows. Vet. Microbiol. 157: 125-131. http://dx.doi.org/10.1016/j.vetmic.2011.11.034
  • Bonizzi G, Karin M (2004). The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trend. Immunol. 25: 280-288.
  • Bromfield JJ, Sheldon IM (2011). Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology. 152: 5029-5040. http://dx.doi.org/10.1210/en.2011-1124
  • Byers SL, Wiles MV, Dunn SL, Taft RA (2012). Mouse estrous cycle identification tool and images. PLoS One. 7: e35538.
  • Deb K, Chaturvedi MM, Jaiswal YK (2005). Gram-negative bacterial LPS induced poor uterine receptivity and implantation failure in mouse: alterations in IL-1beta expression in the preimplantation embryo and uterine horns. Infect. Dis. Obstet. Gynecol. 13: 125-133. http://dx.doi.org/10.1080/10647440500147885
  • Hasan HF, Hamzah AM, Zghair ZR (2013). Study the comparative effect between Cyperus esculentus seeds extract and gentamicin on induced endometritis in mice. J. Pharm. Clin. Sci. 7: 40-47.
  • Herath SH, Bryant CE, Sheldon IM (2006a). Use of cow as a large animal model of uterine infection and immunity. J. Reprod. Immunol. 69: 13-22. http://dx.doi.org/10.1016/j.jri.2005.09.007
  • Herath S, Fischer DP, Werling D, Williams EJ, Lilly ST, Dobson H, Bryant CE, Sheldon IM (2006b). Expression and function of Toll-like receptor 4 in the endometrial cells of the uterus. Endocrinology. 147: 562–570. http://dx.doi.org/10.1210/en.2005-1113
  • Herath S, Lilly ST, Fischer DP, Williams EJ, Dobson H, Bryant CE, Sheldon IM (2009). Bacterial lipopolysaccharide induces an endocrine switch from prostaglandin F2α to prostaglandin E2 in bovine endometrium. Endocrinology. 150: 1912–1920.
  • Loyi T, Kumar H, Nandi S, Mathapati BS, Patra MK, Pattnaik B (2013). Differential expression of pro-inflammatory cytokines in endometrial tissue of buffaloes with clinical and sub-clinical endometritis. Res. Vet. Sci. 94: 336-340. http://dx.doi.org/10.1016/j.rvsc.2012.09.008
  • Nandi D, Mishra MK, Basu A, Bishayi B (2010). Protective effect of Interleukin-6 in lipopolysaccharide (LPS) - Induced experimental endotoxaemia are linked to alteration in hepatic anti-oxidant enzymes and endogenous cytokines. Immunology. 215: 443-451.
  • Price JC, Bromfield JJ, Sheldon IM (2013). Pathogen-associated molecular patterns initiate inflammation and perturb the endocrine function of bovine granulosa cells from ovarian dominant follicles via TLR2 and TLR4 pathways. Endocrinology. 154: 3377-3386. http://dx.doi.org/10.1210/en.2013-1102
  • Overbergh L, Valkx D, Waer M, Mathieu C (1999). Quantitation of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine. 11: 305-312.
  • Sato TA, Keelan JA, Mitchell MD (2003). Critical paracrine interactions between TNF-alpha and IL-10 regulate lipopolysaccharide-stimulated human choriodecidual cytokine and prostaglandin E2 production. J. Immunol. 170: 158–166. http://dx.doi.org/10.4049/jimmunol.170.1.158
  • Sheldon IM, Rycroft AN, Dogan B, Craven M, Bromfield JJ, Chandler A, Roberts MH, Price SB, Gilbert RO, Simpson KW (2010). Specific strains of Escherichia coli are pathogenic for the endometrium of cattle and cause pelvic inflammatory disease in cattle and mice. PLoS One 5: e9192. http://dx.doi.org/10.1371/journal.pone.0009192
  • Yang Q, El- Sayed Y, Rosenberg-Hasson Y, Hirschbeg DL, Nayak NR, Schilling J, Madan A (2009). Multiple cytokine profile in plasma and amniotic fluid in a mouse model of pre-term labor. Am. J. Reprod. Immunol. 62: 339-347. http://dx.doi.org/10.1111/j.1600-0897.2009.00743.x
  •