Aedes aegypti is the Major Vector for Transmission of Dengue Virus in Lahore, Pakistan

Farkhanda Manzoor1, Iram Amin2,*, Muhammad Shahid2, Samia Afzal2, Hania Ramzan1, Tahir Rehman Samiullah2 and Muhammad Idrees3

1Department of Zoology, Lahore College For Women University, Lahore, Pakistan

2Division of Molecular Virology, National Centre of Excellence in Molecular Biology, University of the Punjab, Quaid-i-Azam Campus, Lahore, Pakistan

3Centre of Applied Molecular Biology,University of the Punjab, Quaid-i-Azam Campus, Lahore, Pakistan

ABSTRACT

The present study focused on a rapid identification of dengue virus from larvae of Aedes aegypti (L) and Aedes albopictus (Skuse) by using PCR. During this study, larvae of A. aegypti and A. albopictus were collected from different localities of Lahore during May to September of 2012 to 2014. RNA extracted from each mosquito larvae pool was tested by nested PCR for detection of dengue virus. Out of total 50 pools of Aedes aegypti larvae, DV-2 was the most prevalent serotype. DENV-1 was not found in any pool. While all pools of Aedes albopictus were negative for dengue virus. Our study showed that the main cause of spreading of dengue virus was Aedes aegypti. Serotype DENV-2 was dominant in the field collected larvae of Aedes aegypti in Lahore and Sheikhupura, Pakistan.


Article Information

Received 04 November 2015

Revised 31 March 2016

Accepted 25 May 2016

Available online 10 February 2017

Authors’ Contributions

FM and IA conceived and designed the study. HR and FM collected samples and performed experimental work. MS, IA and SA analyzed the data. MI and TRS wrote the article.

Key words

Parasitism, Aquatic Mites, Mosquitoes, Culex pipiens.

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.2.sc6

* Corresponding author: [email protected]

0030-9923/2017/0002-0743 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan



Dengue infection is an arboviral infection caused by dengue virus that is taxonomically classified in the Family Flaviviridae and genus Flavivirus (Fatima et al., 2011). The important vector of dengue virus are the members of Aedes genus, i.e., Aedes aegypti and Aedes albopictus (Sabila et al., 2015). There are four different serotypes of the virus, DENV-1 to DENV-4, which are closely related to each other antigenically (Fauquet et al., 2005). Dengue virus can either cause dengue fever, dengue hemorrhagic fever or dengue shock syndrome due to the antibody-dependent enhancement (Chew et al., 2012). Infecton with a certain serotype gives life time immunity from that particular serotype but other serotypes may cause infection.

Over the last few years, Pakistan is emerging as a region of endemic dengue activity (Ahsan, 2008). It was reported for the first time in Pakistan as an undifferentiated fever in 1985. The first epidemic was reported in 1994 in Karachi. Serotype 1 and 2 of dengue virus were present in serum of children (Akram et al.,1998). The spread of serotype 1 and 2 was the reason for dengue fever in Balochistan (Paul et al.,1998).With the passage of time, cases of dengue were increased in 2003. Dengue serotype 2, 3 and 4 were reported from Lahore in 2008. In 2011, Pakistan was on worst attack of dengue due to the co-circulation of DENV-2 and DENV-3 (Chan et al.,1995). More recently, the incidence of dengue infection in 2013 with the presence of serotype 1-3 was reported (Khan and Khan, 2015).

The current study was conducted to detect the serotype of dengue virus isolated from the larvae of Aedes aegypti and Aedes albopictus from Lahore, Pakistan.

 

Materials and methods

Two species of mosquitoes Aedes aegypti and Aedes albopictus, were collected from different localities of Lahore (Aziz Bhatti Town, Wahga Town, Shalimar Town, Ferozwala Town and Gulberg Town), where there was high population of Aedes larvae. In the laboratory, mosquitoes were fed on cow liver powder and newly emerged larvae were fed on 10% sucrose solution. Fifty pools of A. aegypti and 50 pools of A. albopictus larvae were established, each containing one to 10 larvae in each vial. All pools were stored in freezer at -70°C.

Viral RNA was extracted from larvae using Viral Nucleic Acid extraction Kit (Favorgen Biotech Corporation, Australia). cDNA was synthesized from RNA of dengue virus in 30 cycles using 10 µl of RNA with a reaction mixture of 10 µl containing 4 µl 5X first strand buffer (FSB), 0.5 µl 0.1 M Dithiothreitol (DTT), 2 µl 10 mM dNTPs, 1 µl 20 pM antisense primers, 1.3 µl dH2O,

 

Table I.- Oligonucleotide sequences used to amplify C-prM gene junction of dengue virus.

Primer name 5´-3´ sequence Size of amplified product in base pairs Use in PCR round
D1-D TCAATATGCTGAAACGCGWGAGAAACCG 511 bp

1st round

D2-D TTGCACCARCARTCWATGTCTTCWGGYTC
TS1-F AGGACCCATGAAATTGGTGA 411 bp

2nd round

TS1-R ACGTCATCTGGTTCCGTCTC
TS2-F AGAGAAACCGCGTGTCAACT 403 bp

2nd round

TS2-R ATGGCCATGAGGGTACACAT
TS3-F ACCGTGTGTCAACTGGATCA 453 bp

2nd round

TS3-R CAGTAATGAGGGGGCATTTG
TS4-F CCTCAAGGGTTTGGTGAAGAG 401 bp

2nd round

TS4-R CCTCACACATTTCACCCAAGT

 

Table II.- Detection of all four serotypes of Dengue virus in positive pools of larvae in A. aegypti and A. albopictus.

Species

No. of pools assayed

Total no. of larvae

No.(%) of positive pools

No. (%) of dengue virus serotype
detected from positive pools

DEN1

DEN2

DEN3

DEN4

A. aegypti

50

1038

38(76%)

0(0%)

26(68.4%)

9(23.7%)

3(7.9%)

A. albopictus

50

979

0 (0%)

0(0%)

0(0%)

0(0%)

0(0%)

 

0.2 µl RNA inhibitor (RMI) and 1 µl of Moloney Murine Leukiemia Virus (MMLV) Reverse Transcriptase (RTse) (Invitrogen Biotechnology, USA). The 20 μl reaction mixture was incubated at 37°C for 50 min. followed by 2 min. heat inactivation of M-MLV at 95°C. The samples were then incubated for 2 min. at 22°C.

Dengue serotype specific degenerate primers designed according to the primer sequences targeting C-prM gene junction (Lanciotti et al., 1992) were used. The size of products was 411 bp for DENV-1, 403 bp for DENV-2, 453 bp for DENV-3 and 401 bp for DENV-4 (Table I).

PCR was used to detect the serotype of dengue virus from each sample. For amplification of cDNA, 2 µl of cDNA was used with 8 µl of master mix. PCR mix was made by mixing 1 µl 10X PCR buffer (with ammonium sulphate), 2.4 µl MgCl2, 1 µl 500 µM dNTPs, 1 µl pM forward and reverse primer each, 2.4 µl d H2O and 0.2 µl of 5 U of Taq DNA polymerase (Invitrogen Biotechnology, USA). The thermal profile for first round using outer sense D1-D and antisense D2-D was initial denaturation at 94ºC for 2 min followed by 30 cycles of denaturation at 94ºC for 45 sec, annealing at 52ºC for 45 sec, extension at 72ºC for 2 min and final extension at 72ºC for 10 min. Same thermal profile was used for second round using type specific primers. Only the annealing was done at 54ºC for 45 sec in 30 cycles. Isolated DENV- PK/45/2009 was used as positive control as it gave good results for each serotype 2 and 3 while HCV was used as a negative control.The PCR product was visualized by 2% agarose gel, stained with ethidium bromide, visualized under UV light.

 

Results and discussion

During the year 2012 to 2014 from the months of May to September each year, a total of 2017 larvaes were collected, out of which 1038 (51.5%) were A. aegypti and 979 (48.5%) were A. albopictus (Table II).

From the pools of A. aegypti, dengue serotypes 2, 3 and 4 were detected and serotype 1 was not present in any pool. Out of 50 pools, 36 were positive for serotype 2, 9 pools for serotype 3 and 3 for serotype 4. On the other hand, all pools of A. albopictus were 100% negative for any serotype. Figure 1 shows the positive samples of DENV 2 and DENV 3.

In the absence of a safe and effective vaccine for mass immunization, the prevention and control of dengue outbreaks are dependent upon the control of the vector mosquitoes A. aegypti and A. albopictus (Knudsen and Sloof, 1992; Gubler and Clarke, 1994). The current study suggests that A. aegypti is the main transmitting agent of dengue (WHO, 2011) and not the Aedes albopictus.

 

 

No doubt all the four distinct serotypes, DENV-1, DENV-2, DENV-3, and DENV-4 of dengue virus have been reported as the cause of dengue infection; however, serotypes 2 and 3 remained the major cause of infection in humans worldwide which is also supported by this study.

 

Conclusions

Based on the results of current study, it is concluded that Aedes aegypti is main source for the spread of dengue virus but not Aedes albopictus and the predominant serotypes of dengue virus in Pakistan are 2 and 3.

 

Acknowledgments

The authors wish to thank all the entomologists from different localities of Lahore and Shikhupura who helped in sample collection and transportation.

 

 

Statement of conflict of interest

We declare that we do not have conflict of interest.

 

References

Ahsan, T., 2008. J. Pak. med. Assoc., 58: 1-2.

Akram, D.S., Igarashi, A. and Takasu, T., 1998. Indian J. Pediat., 65: 735-740. https://doi.org/10.1007/BF02731055

Chan, Y.C., Salahuddin, N.I., Khan, J., Tan, H.C., Seah, C.L., Li, J. and Chow, V.T., 1995. Trans. R. Soc. trop. Med. Hyg., 89: 619-620. https://doi.org/10.1016/0035-9203(95)90412-3

Chew, M.H., Rahman, M.M. and Salleh, S.A., 2012. Pak. J. med. Sci., 28: 643-647.

Fatima, Z., Idrees, M., Bajwa, M.A., Tahir, Z., Obaid-Ullah, Zia, M.Q., Hussain, A., Akram, M., Khubaib, B., Afzal, S., Munir, S., Saleem, S., Rauff, B., Badar, S., Naudhani, M., Butt, S., Aftab, M., Ali, L. and Ali, M., 2011. BMC Microbiol., 11: 1-8. https://doi.org/10.1186/1471-2180-11-200

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A., 2005. Virus taxonomy. 8th Report of the international committee on the taxonomy of viruses. Elsevier-Academic Press. pp. 984-987.

Gubler, D.J. and Clarke, G.G., 1994. Am. J. trop. Med. Hyg., 50 (suppl): 50–60.

Khan, J. and Khan, A., 2015. Int. J. Faun. Biol. Stud., 2: 1-7.

Knudsen, A.B. and Slooff, R., 1992. Bull. Wld. Hlth. Org., 70: 1–6.

Lanciotti, R.S., Calisher, C.H., Gubler, D.J., Chang, G.J. and Vorndam, A.V., 1992. J. clin. Microbial., 30: 545-551.

Paul, R.E., Patel, A.Y., Mirza, S., Fisher-Hoch, S.P. and Luby, S.P., 1998. Expansion of epidemic dengue viral infections to Pakistan. Int. J. Infect. Dis., 2: 197–201. https://doi.org/10.1016/S1201-9712(98)90052-2

Sabila, A., Azhar, M., Shakila, Z., Muhammad, I., Aftab, A.A., Syed, S.S., Zareen, F., Irum, A. and Muhammad, L., 2015. Pakistan J. Zool., 47: 887-890.

World Health Organization, http://www.who.int/csr/disease/ dengue/en. Accessed on 2011 Apr 20.