mRNA Expression of Genes Associated with Puberty Onset in the Adipose and Hypothalamic Tissues of Anhui White Goat

Wenqiao Hui1, Jishun Tang1, Dejian Zhu1, Qian Ban2* and Sheng Chen1*

1Institute of Animal Husbandary and Veterinary Medicine, Anhui Academy of Agriculture Sciences, Road Nongkenan, Hefei, 230031, Anhui, People’s Republic of China

2Center for Stem Cell and Translational Medicine, School of Life Sciences, Anhui University, Road Jiulong, Hefei, 230000, Anhui, People’s Republic of China

ABSTRACT

Puberty is the process of physical maturation of an animal with the capability of sexual reproduction. In domestic animals, age at attainment of puberty is an event that contributes significantly to lifetime reproductive efficiency. Anhui white goat is a native Chinese breed, with the characters of early time puberty onset and high fecundity. However, the molecular mechanism of puberty onset has not been well understood. It has been demonstrated leptin act as a critical metabolic cue linking adipose and the onset of puberty. In the present study, we first assessed the morphological changes in adipose tissue at pre-puberty and puberty onset stages of goats, and then determined the role of leptin to activate signaling pathways which modulate the expression of hypothalamic genes involved in reproduction and metabolism. We found that leptin significantly upregulated the LEPR in the adipose tissue of goat at the puberty onset stage. Moreover, we observed that LEPR, JAK2, STAT3 (P<0.05), KISS1 (P<0.05) were also upregulated in the hypothalamic tissue, except NPY, which was downregulated. Taken together, it is, therefore, inferred that probably leptin secreted in the adipose tissue via its receptor leptin receptor through the JAK2/STA3 signal pathways, promote the upregulation of KISS1, which activates TRPC5, and, inhibit the release of NPY, thereby promoting the release of GnRH, thus hastening the onset of puberty in goat. During this process, leptin, LEPR and its signal pathways may act as a link between the adipose and puberty onset in goat. However, further more studies need to be carried out to verify this point.


Article Information

Received 31 August 2016

Revised 14 November 2016

Accepted 26 January 2017

Available online 26 July 2017

Authors’ Contributions

SC and QB conceived the project, and supervised the study. DZ obtained the animal samples. WH, JT, and QB conducted laboratory processing. WH wrote the article.

Key words

Goat, Puberty onset, Gene expression.

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.4.1483.1490

* Corresponding author: [email protected];

[email protected]

0030-9923/2017/0004-1483 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan



Introduction

 

Puberty is the process of physical maturation of an animal with the capability of sexual reproduction (Dorn et al., 2011). In animal, puberty is defined as age at first estrus when an animal will stand for breeding. Therefore, in domestic animals, age at attainment of puberty is an event that contributes significantly to lifetime reproductive efficiency (Haldar et al., 2014).

In fact, the onset of puberty is a complex phenomenon, which is known to be controlled by genetic, environmental and endogenous factors (Burns et al., 2010). Factors such as body weight, growth and body fat are important regulators of age at onset of puberty (Dunger et al., 2006; Rosales Nieto et al., 2013; Chan et al., 2015; Bohlen et al., 2016). Accumulating studies have been reported that adipose are crucial endogenous factors that affect the timing of sexual maturation (Dunger et al., 2006; Martos-Moreno et al., 2010; Sanchez-Garrido and Tena-Sempere, 2013; Roa and Tena-Sempere, 2014; Bohlen et al., 2016). Pubertal onset may be advanced by fatness, with leptin potentially acting as a permissive factor (Barash et al., 1996; Chehab et al., 1996; Sanchez-Garrido and Tena-Sempere, 2013). However, the mechanism how leptin exerts its effect is still a matter of debate.

The hypothalamus receives neural and endocrine input

from these systems to appropriately activate the pituitary-ovarian axis under conditions favorable for successful pregnancy to occur. Accumulating evidence demonstrates that the effects of leptin to regulate the onset of puberty are thought to be mediated mainly by its receptor LEPR action on hypothalamic neurons (Bellefontaine et al., 2014; de Luque et al., 2007; Sanchez-Garrido and TenaSempere, 2013; Sheffer-Babila et al., 2013). Therefore, to unravel Leptin receptors (LepR) are highly expressed in arcuate nucleus (Arc) neurons, where they partially colocalize with kisspeptin, one of the most potent regulators of the reproductive axis (Zuure et al., 2013). It has been reported that mutations of LEPR are associated with the time of puberty onset (Haldar et al., 2014; Juengel et al., 2015; Day et al., 2016). Kiss1 gene, encoding the kisspeptins that bind its receptor Gpr54, has been recognized as indispensable molecule in the neuroendocrine control of puberty and reproduction (Pinilla et al., 2012; Oakley et al., 2009; Navarro and Tena-Sempere, 2011). It has been reported kisspeptin neurons were depolarized by leptin via activating TRPC Channels in guinea pig (Qiu et al., 2010, 2011).

Anhui white goat is a native Chinese goat breed, well known for its characters of higher fertility and earlier age at puberty onset, although its physique is relatively smaller, compared with other Chinese native goat breed (Chen et al., 2009). However, the possible molecular mechanisms underlie the body mass and the capability of earlier puberty onset remains unclear.

Herein, the present study was designed to investigate the relationship between adipose and puberty onset. The morphological changes of adipose were analyzed by histological analysis in goat at pre-puberty and puberty onset stages. Furthermore, mRNA expression of Leptin, LEPR, JAK2, STAT3, KISS1 and TRPC5 were detected in the adipose and hypothalamic tissue of pre-puberty and puberty onset goats, respectively, by Real-time PCR, which was aimed to see whether the changes of adipose affect the ability of leptin to activate signaling pathways and modulate the expression of hypothalamic genes involved in reproduction and metabolism.

 

Materials and methods

Ethic statement

The animals were handled in strict accordance with Animal Ethics Procedure and Guidelines of the People’s Republic of China. All experiments protocol described here were approved by the Institutional Animal Care and Use Committee of Animal Science and Veterinary institute, Anhui Academy of Agriculture Science.

Determination of age at puberty onset

The age at puberty onset was determined according to the method described by Haldar et al. (2014) with some modifications. The data of Anhui white ewes were recorded when she was born, including birth date, weight, litter size, as well as the weaning weight and data at weaning. Age of puberty onset was determined using crayon marking by a vasectomized ram fitted with a mating harness. Estrus detection was performed daily from 60 days (served as pre-puberty stages), when ewe lambs were exposed to such rams. During which time herdsmen observed them for estrous behavior. The puberty age was defined as the date in which the first standing estrus was detected. Then, marked ewe was removed from the group and monitoring continued for all unmarked ewes.

Procedure adopted

Anhui white goat included in the study including four puberty onset female lambs and four pre-puberty counterparts. The animals were euthanized and the tissues were sampled immediately after death. The hypothalamus and abdominal adipose tissue were removed and quickly snap frozen in liquid nitrogen before being used for RNA extraction or fixed in 4% buffered formalin for histological evaluation.

Histological evaluation

Intra-abdominal (visceral) fat pads were fixed in Formalin solution and embedded in paraffin. Histological sections (5 µm) were stained with hematoxylin and eosin (H&E) stain according to standard procedures. Images were analysed by an inverted fluorescent microscope (Nikon Ti-s, Japan).

RNA extraction and cDNA synthesis

Total RNA was extracted and purified using the Tiangen RNAprep pure Tissue Kit (Tiangen, Beijing, China) with a genomic DNA removal step as per manufacturer’s protocol. RNA quality and concentration levels were determined using a photometer (Nanodrop2000, Thermofisher, USA), and RNA integrity was verified via electrophoresis. cDNA was synthesized with equal amounts of RNA samples using one-step reverse transcription kit (Tiangen, Beijing, China) according to the manufacturer’s instructions.

Real-time PCR

Expression of the target genes, (viz. Leptin, LEPR, JAK2, STAT3, KISS1, TRPC5) were analyzed through quantitative real-time PCR (qRT-PCR) and using the cDNA of various tissues in different stages of puberty as templates. The GAPDH was selected as an internal control based on its expression stability.

According to sequences obtained from GenBank, the primers for each target gene listed in Table I, were designed by Primer premier 5.0 and synthesized by Boshang biotechnology company (Shanghai, China). Real-time PCR was performed using the 7500TM system (Applied Biosystems) under the following condition: denaturation at 94°C for 4min, followed by 35 cycles of 94°C for 15s, annealing at 55-60°C for 20s, and extension at 72°C for 20s, and a final extension step of 10 min at 72°C. Each reaction was carried out in a total volume of 20μL, consisting of 12.5μL SYBR® Premix Ex, 0.5μL each prime

r

Table I.- Primers used for real-time polymerase chain reaction.

Gene Primer sequences (5’-3’)

Annea ling temper ature (°C)

Expec ted size (bp)

Reference/ accession no.

GAPDH

F: CAAGTTCAACGGCACAGTCA R: TGGTTCACGCCCATCACAA

59.0 249 XM_ 005680968.2
Leptin

F: AAGGCTACGGGCACATACA R: AGAGCCCTCAAGTCACTCAAA

60.0 209 XM_ 005679433.2
LEPR

F: TGAATGGAAGTGGGAGGAT R: CACGAGGAAGACATGGTGC

57.0 209 XR_ 001295509.1
JAK2

F: CAAAGTGAAAGAGCCTGGTG R: CATAAATTCCGCTGGTGGG

56.0 163 XM_ 013965950.1
STAT3

F: CTGGGCACAAACACGAAAG R: CACCACCACTGGCAATGAGT

60.0 231 KP343689.1
KISS1

F: CGCTCTGCCCCTCTGAGAG R: CCAGTTGTAGGCGGACACG

55.0 131

NM_ 001285710

NPY

F: GAAGAAGGGGAGACAATCTAAAA R: AACAAAGGACAAATCAAAAGC

56.5 119 XM_ 005679293.2
TRPC5

F: CTCAGATGGAGAAAGGGAAAG R: GGAACAGATGCTGGATACGC

58.0 119 XM_0 05700254.2

 

(10μ mol/L), 2μL cDNA and 4.5μL ddH2O. Amplification reaction for each sample was conducted in triplicate. And the levels of transcript were generated from a standard that was simultaneously amplified with the samples. Levels of gene expression were then normalized against GAPDH, which served as internal controls.

Statistical analysis

All data are shown as mean±SEM. The relative mRNA expression levels of goat LEPR, JAK2, STAT3, KISS1, NPY and TRPC5 were calculated by 2ΔΔCT method. Statistical analysis was carried out using SPSS version 17.0. One-way ANOVA test and repeated measure of ANOVA were used for statistical analysis of normalized gene copy number and differences were considered significant at P<0.05.

 

Results

Histological analysis

Histological analysis of selected tissues was clone to assess the morphology of adipose tissue in goat at pre-puberty stage and puberty onset stage. Figure 1A shows vascularization and ECM surrounding at the adipocyte in pre-puberty goat. The morphology of adipocyte is not clear. At puberty onset stage in goat, the adipocyte became mature and bigger (Fig. 1B), is suggested by the comparison of adipocyte area (Fig. 1C). At this stage vascularization and ECM disapear, adipocyte become more uniform, and are mostly unilocular.

 

mRNA expression of Leptin, LEPR, JAK2, and STAT3 in adipose tissue

Figure 2 shows mRNA level of genes of the leptin mediated signal pathways (leptin, LEPR, JAK2, STAT3) in the adipose tissue. Relatively higher expression of these genes was observed in the adipose tissue of goat at the onset of puberty compared to the pre-puberty stage. LEPR gene showed significantly high over-expression at the onset of puberty compared to the pre-puberty stage (P < 0.01).

 

 

mRNA expression of LEPR, JAK2, STAT3, NPY, KISS1 and TRPC5 in hypothalamus tissue

Figure 3 shows significantly higher mRNA levels of LEPR, JAK2, STAT3, KISS1, NPY, TRPC5, genes in the hypothalamus puberty at the onset of KISS1, and STAT3 showed substantially increased expression level in the pre-puberty stage (P<0.05). It appears leptin activates KISS1, TRPC5 in the hypothalamus tissue via LEPR through JAK2/STAT3 signal pathways in the hypothalamus of sheep at the onset of puberty. Figure 4 shows a model of interaction of genes of adipose tissue and hypothalamus involved during pre-puberty and onset of puberty in goats.

 

Discussion

 

Puberty is a developmental transition for attainment of reproductive capacity in human and animals, which is also the endpoint of a long-lasting developmental continuum and means sexual maturation (Castellano and Tena-Sempere., 2016). Epidemiological data in humans suggest that a critical amount of body fat is required for proper sexual maturation (Frisch, 1985), since adipose tissue plays an essential role in regulating energy balance

 

 

through its metabolic, cellular and endocrine functions during development. Adipose is, therefore, a key factor that affects the time of puberty. In the present study, firstly, we detected the morphological differences in the adipose tissue at puberty and pre-puberty stages. It has been acknowledged that angiogenesis and adipogenesis are tightly coupled during development (Lee et al., 2016). In conjunction with histological differences, it may be indicated that the adipose development is related to the puberty onset. We also detected alteration in expression of genes associated with adipose in goat at pre-puberty and onset of puberty.

Leptin, an adipocyte-derived hormone, is required for normal pubertal maturation in animals and human, therefore, it has been recognized as a critical metabolic cue linking energy stores and the onset of puberty (Cunningham et al., 1999; Elias, 2012; Roa et al., 2010). Increasing studies demonstrated that humans and mice lacking leptin or LepR are infertile and fail to enter puberty (Barash et al., 1996; Chehab et al., 1996; Mounzih et al., 1997; Moschos et al., 2002).

LEPR activates the activation of the Janus kinase/signal transducer and activator of transcription (JAK/STAT) signaling pathway. Numerous studies have showed evidences that the full effect of leptin in reproduction requires the recruitment of a STAT3-independent pathway (Zuure et al., 2013). In the present study, we found that leptin-mediated signaling genes (Leptin, LEPR, JAK2 and STAT3) were up-regulated in the adipose tissue of goat at the onset of puberty compared with pre-pubertal controls. Specifically, LEPR gene experienced a dramatically overexpression level at the puberty onset stage. The data may suggest that the leptin signaling pathways may be strongly activated in the adipose tissue of goat with puberty-onset stage, especially for LEPR.

Furthermore, in order to detect whether leptin from adipose tissue could transduce signals to the brain tissue, we detected LEPR, JAK2, STAT3, NYP, KISS1, and TRPC5 in the hypothalamic tissue of goat at the onset of puberty, and prepubertal stage. The up-regulation of leptin signal pathways, such as, LEPR, JAK2 and STAT3, were likewise observed in the hypothalamic tissue of goat at the puberty onset stage, compared with that of prepubertal goat. It is suggested that the JAK2/STA3 signal is activated during the pubertal onset in goat. LepR are highly expressed in arcuate nucleus (Arc) neurons, where they partially colocalize with kisspeptin, one of the most potent regulators of the reproductive axis (Smith et al., 2006; Oakley et al., 2009; Colledge, 2009; Pinilla et al., 2012).

Kiss1 gene, encoding the kisspeptins, that bind its receptor Gpr54, have been recognized as indispensable molecule in the neuroendocrine control of puberty and reproduction (Pinilla et al., 2012; Oakley et al., 2009; Navarro and Tena-Sempere, 2011). Loss-of-function mutations in Kiss1 genes cause infertility due to lack of pubertal maturation in mice and humans (d’Anglemont et al., 2007; Lapatto et al., 2007; Topaloglu et al., 2012; de Roux et al., 2003). Numerous reports have confirmed that leptin is a significant upregulator of hypothalamic kiss1 expression (Castellano et al., 2006; Smith et al., 2006; Backholer et al., 2010). In the present study, we found that Kiss1 gene is significantly up-regulated in the hypothalamic tissue of goat at puberty onset stage, compared with that of prepubertal controls. Our finding is consistent with the studies reported by Cravo et al. (2013), who found that prepubertal and leptin signaling-deficient mice display decreased numbers of Kiss1 neurons. Our result may partially suggested that upregulation of leptin may raise Kiss1 during the puberty onset stage.

Since kisspeptin signaling plays a critical role in modulating GnRH neuronal excitability, which controls pituitary gonadotropins secretion and ultimately reproduction. It has been reported that kisspeptin potently depolarizes GnRH neurons primarily through the activation of canonical transient receptor potential channels (TRPC). Qiu et al. (2010) and (2011) found that kisspeptin neurons were depolarized by leptin via activating TRPC in guinea pig. Zhang and Spergel (2012) found that kisspeptin activates TRPC though cSrc tyrosine kinase activation, which is a novel signaling pathway for peptidergic excitation of GnRH neurons. In the present study, we found that puberty onset stage witnessed an overexpression of TRPC5 in the hypothalamus of goat, which is suggestive of activation of the TRPC5, by Kiss1 gene which thus releases GnRH, thereby resulting in the onset of puberty.

Neuropeptide Y (NPY) neurons in the arcuate nucleus (ARC) contain the leptin receptor, which are responsive to changes in nutritional status (Baskin et al., 1999). It was reported that during the heifers peripubertical stages, increased leptin concentrations, could result in lower hypothalamic NPY release, and greater pulsatile of LH release, thereby hastening puberty onset (Cardoso et al., 2014). In the agonadal male, NPY expression pattern from birth to puberty was inversely related to that of pulsatile GnRH release (El Majdoubi et al., 2000). In the present study, we found that hypothalamic NPY in the goat of puberty onset stage was lower than that of pre-puberty, suggesting that NPY was negatively associated with the time of puberty onset, which is inversely related to the leptin expression.

 

Conclusion

 

In conclusion, our study firstly detected the morphology of adipose tissue during the puberty stage of goat, and found that morphology of adipocytes changed significantly. We next analyzed mRNA expression levels of genes related to leptin and signal pathways in the adipose tissue. It is observed that leptin, LEPR, and JAK2, STAT3 were up-regulated in the puberty onset stage. Furthermore, we analyzed the LEPR, KISS1, TRPC5, NPY, JAK2 and STAT3 in the hypothalamus tissue, we found that expression levels of LEPR, KISS1, TRPC5, JAK2, and STAT3 were upregulated, whereas NPY mRNA expression was downregulated. We gave a hypothesis that Leptin secreted in the adipose tissue via its receptor leptin receptor through the JAK2/STA3 signal pathways, promote the upregulation of KISS1, which activates TRPC5, while in turn, inhibit the release of NPY, thereby promoting the release of GnRH, thus hastening the onset of puberty in goat. However, the differences observed in the onset of puberty were perhaps caused by other neurotransmitters that were not evaluated in our study. It is, therefore, necessary to carry out furthermore studies to identify possible mechanisms of leptin or LEPR that may link the changes in adipose and hypothalamus with the timing of puberty.

 

Acknowledgements

 

This study was funded by Discipline Construction Project from Anhui Academy of Agriculture Sciences (17A0411), Dean Outstanding Youth Fund of Anhui Academy of Agriculture Sciences (14B0403), and National Natural Science Foundation of China (Grant No. 31402048).We would like to thank Dr. Dongwei Huang and Dr. Jiajun Yang for assistance with sampling obtain in the experiments.

 

Conflict of interest statement

The authors declare that they have no competing interests.

 

References

 

Backholer, K., Smith, J.T., Rao, A., Pereira, A., Iqbal, J. and Ogawa, S., 2010. Kisspeptin cells in the ewe brain respond to leptin and communicate with neuropeptide Y and proopiomelanocortin cells. Endocrinology, 151: 2233-2243. https://doi.org/10.1210/en.2009-1190

Barash, I.A., Cheung, C.C., Weigle, D.S., Ren, H., Kabigting, E.B., Kuijper, J.L., Clifton D.K. and Steiner, R.A., 1996. Leptin is a metabolic signal to the reproductive system. Endocrinology, 137: 3144-3147. https://doi.org/10.1210/endo.137.7.8770941

Baskin, D.G., Breininger, J.F. and Schwartz, M.W., 1999. Leptin receptor mRNA identifies a subpopulation of neuropeptide Y neurons activated by fasting in rat hypothalamus. Diabetes, 48: 828-833. https://doi.org/10.2337/diabetes.48.4.828

Bellefontaine, N., Chachlaki, K., Parkash, J., Vanacker, C., Colledge, W., d’Anglemont de Tassigny, X., Garthwaite, J. and Bouret, S.G., 2014. Leptin-dependent neuronal NO signaling in the preoptic hypothalamus facilitates reproduction. J. Clin. Invest., 124:2550-2559. http://doi.org. 10.1172/JCI65928.

Bohlen, T.M., Silveira, M.A., Zampieri, T.T., Frazão, R. and Donato, J., 2016. Fatness rather than leptin sensitivity determines the timing of puberty in female mice. Mol. Cell. Endocrinol., 423: 11-21. https://doi.org/10.1016/j.mce.2015.12.022

Burns, B.M., Fordyce, G. and Holroyd, R.G., 2010. A review of factors that impact on the capacity of beef cattle females to conceive, maintain a pregnancy and wean a calf-Implications for reproductive efficiency in northern Australia. Anim. Reprod. Sci., 122: 1-22. https://doi.org/10.1016/j.anireprosci.2010.04.010

Cannady, W.E., Brann, D.W. and Mahesh, V.B., 2000. The potential role of periovarian fat and leptin in initiation of puberty in the immature rat. Int. J. Obestet. Relat. Metab. Disord., 24 (Suppl. 2): S146-S147. https://doi.org/10.1038/sj.ijo.0801307

Cardoso, R.C., Alves, B.R., Prezotto, L.D., Thorson, J.F., Tedeschi, L.O., Keisler, D.H., Amstalden, M. and Williams, G.L., 2014. Reciprocal changes in leptin and NPY during nutritional acceleration of puberty in heifers. J. Endocrinol., 223: 289-298. https://doi.org/10.1530/JOE-14-0504

Castellano, J.M., Navarro, V.M., Fernandez-Fernandez, R., Roa, J., Vigo, E., Pineda, R., Dieguez, C., Aguilar, E., Pinilla, L. and Tena-Sempere, M., 2006. Expression of hypothalamic KiSS-1 system and rescue of defective gonadotropic responses by kisspeptin in streptozotocin-induced diabetic male rats. Diabetes, 55: 2602-2610. https://doi.org/10.2337/db05-1584

Castellano, J.M. and Tena-Sempere, M., 2016. Animal modeling of early programming and disruption of pubertal maturation. Endocrinol. Dev., 29: 87-121.

Castro-González, D., Fuente-Martín, E., Sánchez-Garrido, M.A., Argente-Arizón, P., Tena-Sempere, M., Barrios, V., Chowen, J.A. and Argente, J., 2015. Increased prepubertal body weight enhances leptin sensitivity in proopiomelanocortin and neuropeptide Y neurons before puberty onset in female rats. Endocrinology, 156: 1272-1282. https://doi.org/10.1210/en.2014-1759

Chan, K.A., Tsoulis, M.W. and Sloboda, D.M., 2015. Early-life nutritional effects on the female reproductive system. J. Endocrinol., 224: R45-62. https://doi.org/10.1530/JOE-14-0469

Chen, S., Cheng, G.L., Zhu, D.J., Jiang, X.C. and Zhao, H.L., 2009. Determination of body characters and meat performance of Anhui white goat. Anim. Husband. Feed Sc., (In Chinese), 30:150-152. http://doi.org.10.16003/j.cnki.issn1672-5190.2009.04.072

Chehab, F.F., Lim, M.E. and Lu, R., 1996. Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat. Genet., 12: 318-320. https://doi.org/10.1038/ng0396-318

Colledge, W.H., 2009. Kisspeptins and GnRH neuronal signalling. Trends. Endocrinol. Metab., 20: 115-121. https://doi.org/10.1016/j.tem.2008.10.005

Cravo, R.M., Frazao, R., Perello, M., Osborne-Lawrence, S., Williams, K.W., Zigman, J.M., Vianna, C. and Elias, C.F., 2013. Leptin signaling in Kiss1 neurons arises after pubertal development. PLoS One. 8: e58698. http://doi.org. 10.1371/journal.pone.0058698

Cunningham, M.J., Clifton, D.K. and Steiner, R.A., 1999. Leptin’s actions on the reproductive axis: perspectives and mechanisms. Biol. Reprod., 60: 216-222. https://doi.org/10.1095/biolreprod60.2.216

d’Anglemont de Tassigny, X., Fagg, L.A., Dixon, J.P., Day, K., Leitch, H.G., Hendrick, A.G., Zahn, D., Franceschini, I., Caraty, A., Carlton, M.B., Aparicio, S.A. and Colledge, W.H., 2007. Hypogonadotropic hypogonadism in mice lacking a functional Kiss1 gene. Proc. natl. Acad. Sci., 104: 10714-10719. https://doi.org/10.1073/pnas.0704114104

Day, F.R., Bulik-Sullivan, B., Hinds, D.A., Finucane, H.K., Murabito, J.M., Tung, J.Y., Ong, K.K. and Perry, J.R., 2015. Shared genetic aetiology of puberty timing between sexes and with health-related outcomes. Nat. Commun., 6: 8842. https://doi.org/10.1038/ncomms9842

de Ridder, C.M., Bruning, P.F., Zonderland, M.L., Thijssen, J.H., Bonfrer, J.M., Blankenstein, M.A., Huisveld I.A. and Erich, W.B., 1990. Body fat mass, body fat distribution and plasma hormones in early puberty in females. J. clin. Endocrinol. Metab., 70: 888-893. https://doi.org/10.1210/jcem-70-4-888

de Roux, N., Genin, E., Carel, J.C., Matsuda, F., Chaussain, J.L. and Milgrom, E., 2003. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. natl. Acad. Sci., 100: 10972-10976. https://doi.org/10.1073/pnas.1834399100

Dunger, D.B., Ahmed, M.L. and Ong, K.K., 2006. Early and late weight gain and the timing of puberty. Mol. Cell. Endocrinol., 254-255: 140-145. https://doi.org/10.1016/j.mce.2006.04.003

Dorn, L.D. and Biro, F.M., 2011. Puberty and its measurement: a decade in review. J. Res. Adolescence, 21: 180-195. https://doi.org/10.1111/j.1532-7795.2010.00722.x

Elias, C.F., 2012. Leptin action in pubertal development: recent advances and unanswered questions. Trends Endocrinol. Metab., 23: 9-15. https://doi.org/10.1016/j.tem.2011.09.002

El Majdoubi, M., Sahu, A., Ramaswamy, S. and Plant, T.M., 2000. Neuropeptide Y: A hypothalamic brake restraining the onset of puberty in primates. Proc. natl. Acad. Sci. U.S.A., 97: 6179-6184. https://doi.org/10.1073/pnas.090099697

Frisch, R.E., 1985. Fatness, menarche, and female fertility. Perspect. Biol. Med., 28: 611-633.

Haldar, A., French, M.C., Brauning, R., Edwards, S.J., O’Connell, A.R., Farquhar, P.A., Davis, G.H., Johnstone, P.D. and Juengel, J.L., 2014. Single-nucleotide polymorphisms in the LEPR gene are associated with divergent phenotypes for age at onset of puberty in Davisdale ewes. Biol. Reprod., 90: 33. https://doi.org/10.1095/biolreprod.113.115923

Juengel, J.L., French, M.C., O’Connell, A.R., Edwards, S.J., Haldar, A., Brauning, R., Farquhar, P.A., Dodds, K.G., Galloway, S.M., Johnstone, P.D. and Davis, G.H., 2015. Mutations in the leptin receptor gene associated with delayed onset of puberty are also associated with decreased ovulation and lambing rates in prolific Davisdale sheep. Reprod. Fertil. Dev., 18: 1318-1325.

Lapatto, R., Pallais, J.C., Zhang, D., Chan, Y.M., Mahan, A., Cerrato, F., Le, W.W., Hoffman, G.E., Seminara, S.B. and Mahan, A., 2007. Kiss1-/- mice exhibit more variable hypogonadism than Gpr54-/- mice. Endocrinology, 148: 4927-4936.

Lee, J.T., Huang, Z., Pan, K., Zhang, H.J., Woo, C.W., Xu, A. and Wong, C.M., 2016. Adipose-derived lipocalin 14 alleviates hyperglycaemia by suppressing both adipocyte glycerol efflux and hepatic gluconeogenesis in mice. Diabetologia., 59: 604-613.

Luque, R.M., Huang, Z.H., Shah, B., Mazzone, T. and Kineman, R.D., 2007. Effects of leptin replacement on hypothalamic-pituitary growth hormone axis function and circulating ghrelin levels in ob/ob mice. Am. J. Physiol. Endocrinol. Metabol., 294: E891-9. http://doi.org. 10.1152/ajpendo.00258.2006

Moschos, S., Chan, J.L. and Mantzoros, C.S., 2002. Leptin and reproduction: a review. Fertil. Steril., 77: 433-444. https://doi.org/10.1016/S0015-0282(01)03010-2

Martos-Moreno, G.A., Chowen, J.A. and Argente, J., 2010. Metabolic signals in human puberty: effects of over and undernutrition. Mol. Cell Endocrinol., 324: 70-81. https://doi.org/10.1016/j.mce.2009.12.017

Mounzih, K., Lu, R. and Chehab, F.F., 1997. Leptin treatment rescues the sterility of genetically obese ob/obmales. Endocrinology, 138: 1190-1193. https://doi.org/10.1210/endo.138.3.5024

Navarro, V.M. and Tena-Sempere, M., 2011. Kisspeptins and the neuroendocrine control of reproduction. Front. Biosci. (Schol Ed.), 3: 267-275. https://doi.org/10.2741/s150

Oakley, A.E., Clifton, D.K. and Steiner, R.A., 2009. Kisspeptin signaling in the brain. Endocrinol. Rev., 30: 713-743. https://doi.org/10.1210/er.2009-0005

Pinilla, L., Aguilar, E., Dieguez, C., Millar, R.P. and Tena-Sempere, M., 2012. Kisspeptins and reproduction: physiological roles and regulatory mechanisms. Physiol. Rev., 92: 1235-1316. https://doi.org/10.1152/physrev.00037.2010

Qiu, J., Fang, Y., Rønnekleiv, O.K. and Kelly, M.J., 2010. Leptin excites proopiomelanocortin neurons via activation of TRPC channels. J. Neurosci., 30:1560-1565. https://doi.org/10.1523/JNEUROSCI.4816-09.2010

Qiu, J., Fang, Y., Bosch, M.A., Rønnekleiv, O.K. and Kelly, M.J., 2011. Guinea pig kisspeptin neurons are depolarized by leptin via activation of TRPC channels. Endocrinology, 152: 1503-1514. https://doi.org/10.1210/en.2010-1285

Roa, J., Garcia-Galiano, D., Castellano, J.M., Gaytan, F., Pinilla, L. and Tena-Sempere, M., 2010. Metabolic control of puberty onset: new players, new mechanisms. Mol. Cell. Endocrinol., 324: 87-94. https://doi.org/10.1016/j.mce.2009.12.018

Roa, J. and Tena-Sempere, M., 2014. Connecting metabolism and reproduction: roles of central energy sensors and key molecular mediators. Mol. Cell. Endocrinol., 397: 4-14. https://doi.org/10.1016/j.mce.2014.09.027

Rosales Nieto, C.A., Ferguson, M.B., Macleay, C.A., Briegel, J.R., Martin, G.B. and Thompson, A.N., 2013. Selection for superior growth advances the onset of puberty and increases reproductive performance in ewe lambs. Animal, 7: 990-997. https://doi.org/10.1017/S1751731113000074

Sanchez-Garrido, M.A. and Tena-Sempere, M., 2013. Metabolic control of puberty: roles of leptin and kisspeptins. Horm. Behav., 64: 187-194. https://doi.org/10.1016/j.yhbeh.2013.01.014

Sheffer-Babila, S., Sun, Y., Israel, D.D., Liu, S.M., Neal-Perry, G., and Chua, S.C., 2013. Agouti-related peptide plays a critical role in leptin’s effects on female puberty and reproduction. Am. J. Physiol. Endocrinol. Metabol., 305: E1512-20. http://doi.org. 10.1152/ajpendo.00241.2013

Smith, J.T., Acohido, B.V., Clifton, D.K. and Steiner, R.A., 2006. KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. J. Neuroendocrinol., 18: 298-303. https://doi.org/10.1111/j.1365-2826.2006.01417.x

Takumi, K., Shimada, K., Iijima, N. and Ozawa, H., 2015. Maternal high-fat diet during lactation increases Kiss1 mRNA expression in the arcuate nucleus at weaning and advances puberty onset in female rats. Neurosci. Res., 100: 21-28. https://doi.org/10.1016/j.neures.2015.06.004

Topaloglu, A.K., Tello, J.A., Kotan, L.D., Ozbek, M.N., Yilmaz, M.B., Erdogan, S., Gurbuz, F., Temiz, F., Millar, R.P. and Yuksel, B., 2012. Inactivating KISS1 mutation and hypogonadotropic hypogonadism. New Engl. J. Med., 366: 629-635. https://doi.org/10.1056/NEJMoa1111184

Yun-Hee, L., Emilio, P.M. and James, G., 2014. Adipose tissue plasticity from WAT to BAT and in between. Biochim. biophys. Acta, 1842: 358-369. https://doi.org/10.1016/j.bbadis.2013.05.011

Zuure, W.A., Roberts, A.L., Quennell, J.H. and Anderson, G.M., 2013. Leptin signaling in GABA neurons, but not glutamate neurons, is required for reproductive function. J. Neurosci., 33: 17874-17883. https://doi.org/10.1523/JNEUROSCI.2278-13.2013

Zhang, X.B. and Spergel, D.J., 2012. Kisspeptin inhibits high-voltage activated Ca2+ channels in GnRH neurons via multiple Ca2+ influx and release pathways. Neuroendocrinology, 96: 68-80. https://doi.org/10.1159/000335985