Negative Association of HLA-DRB1*11 and HLA-DRB1*12 Alleles with Aeroallergy Patients Visiting Allergy Centre (NIH), Islamabad, Pakistan

Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3, Nadeem Afzal4 and Zaigham Abbas1,*

1Department of Microbiology and Molecular Genetics, University of the Punjab, Quaid-e-Azam Campus, Lahore, Pakistan

2Allergy Centre, National Institute of Health, Islamabad, Pakistan

3Institute of Biochemistry and Biotechnology, University of the Punjab, Quaid-e-Azam Campus, Lahore, Pakistan

4Department of Immunology, University of Health Sciences, Lahore, Pakistan

ABSTRACT

Aeroallergens include dust, pollens, cotton and threshing dust particles. Prevalence of different allergic diseases in Pakistan is about 66.1% and every year, almost 2.4 million people get vaccine for allergy from Allergy Centre, National Institute of Health (NIH), Islamabad. Human Leukocyte Antigens (HLA) genes are located on the short arm of the chromosome number 6 and position 21 and the allele frequency is associated with allergy. The study was conducted to investigate the relationship between the aero-allergens and the frequency of HLA-DRB1*11 and HLA-DRB1*12 allele in aeroallergen sensitized individuals. Blood samples of aeroallergen sensitized individuals were collected at the Allergy Centre, NIH, Islamabad. Then samples were analysed at the Department of Microbiology and Molecular Genetics, University of the Punjab, Lahore during the study period expanded from August 2014 to February 2015 for the presence of HLA-DRB1*11 and HLA-DRB1*12 allele using polymerase chain reaction (PCR). While total level of Immunoglobulin E (IgE) was measured by enzyme linked immunosorbent assay (ELISA) in all serum samples. This study indicated that the frequency of both alleles HLA-DRB1*11and HLA-DRB1*12 in aero allergy patients is less as compared to healthy controls. HLA-DRB1*11 demonstrated significant association with aeroallergens and could have a protective role for allergy while HLA-DRB1*12 did not show any association with aeroallergen sensitization.


Article Information

Received 11 September 2016

Revised 22 March 2017

Accepted 03 May 2017

Available online 10 August 2017

Authors’ Contribution

FA, SA and ZA designed the study. MH and AH executed the experimental work, analyzed the data and wrote the article. FA took the samples and patients’ history. SR statistically analyzed the data. NA and ZA supervised the study

Key words

Alleles, Asthma, Genetic linkage, Hypersensitivity, Immunoglobulin E.

DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.5.1563.1569

* Corresponding author: [email protected]

0030-9923/2017/0004-1563 $ 9.00/0

Copyright 2017 Zoological Society of Pakistan



INTRODUCTION

 

When the substances in the environment that are harmless to the majority of the people react with the immune system of the susceptible person, allergy occurs; these environmental substances are called allergens. Some of the examples of the allergens are pet danders, pollens, insect’s antigens, molds, food particles, house dust mite, etc. (Breiteneder and Chapman, 2014; Host et al., 2003; Price et al., 2006). The substances which are air born are called aeroallergens. Allergic rhinitis, bronchial asthma, urticaria, atopic eczema and allergic conjunctivitis are the main complications related to the aero-allergens (Yalcin et al., 2013; Renaudin et al., 2012; Greiner et al., 2011).

Allergic sensitization is the result of interaction between environmental allergens and genetic factors such as human leukocyte antigens (HLA) which present allergens for immune recognition and sensitization. HLA are the most polymorphic genes; this system of the genes and its alleles are responsible to display proteins on the cell surface for identification of allergens and regulation of immune system in human beings (Kindt et al., 2007). Its genes or gene products might be a risk factor or a protective factor for the allergy by common allergens (Agarwal, 2011; Ramasamy et al., 2011; Muro et al., 2013; Portelli et al., 2015).

Increased frequency of HLA DRB*12 and HLA-DRB1*03 has been reported in asthma patients in Pakistan and pediatric asthmatics of Indian population respectively (Javaid et al., 2014; Lama et al., 2014). DRB1*10, DQB1*05 and DQB1*602 reported as linked with rheumatoid arthritis (autoimmune disease) while DRB1*07-DQB1*02 and DRB1*11-DQB1*0301 play protective role (Muazzam et al., 2013). HLA-DQB1*0302 and HLA-DRB1*04 are interrelated with aspirin exacerbated respiratory disease (Esmaeilzadeh et al., 2015).

A number of HLA alleles have been investigated for its correlation among asthma, rhinitis, conjunctivitis and immunoglobulin E (IgE) levels with varying findings. Identification of particular allele responsible for allergy with particular association to risk factor might lead to prior allergy identification and preventive interventions. This study was conducted to evaluate the association of different aero-allergens and allergic complications like bronchial asthma, allergic rhinitis, allergic conjunctivitis, atopic eczema and allergic dermatitis, with two different alleles of HLA-DRB1, i.e. HLA-DRB1*11 and HLA-DRB1*12.

 

PATIENTS AND METHODS

 

It is a comparative case-control study that comprised of 110 aeroallergen sensitized patients and 40 healthy controls. Sample size was calculated by Fleiss (1981) formula for un-matched case control study, keeping the power of study equal to 80% and level of significance equal to 5% (Fleiss, 1981; Park et al., 2012). Calculated sample size was 110 per group but because of financial constrains control group was reduced to 40 individuals (power of study=50%). The study was conducted at the Department of Microbiology and Molecular Genetics, University of the Punjab, Lahore during the time period of August 2014 to February 2015 after getting the approval from Institutional Biosafety and Bioresource Committee. The Blood samples were collected from Allergy Centre, National Institute of Health (NIH), Islamabad after confirmation by skin prick test (SPT), standardized by the NIH Allergy Center, Islamabad. Samples positive to SPT with pollen, paper mulberry, house dust mite, thrashing dust particles and raw cotton, of age 14-60 years of either gender were taken as aero-allergic samples and samples with negative result to SPT and no sign and symptoms for allergic reaction were taken as healthy controls. History of the sampling person was also recorded. Samples with rheumatoid arthritis, diabetes, multiple sclerosis, cancer or any autoimmune disease were excluded from the study.

Serum was isolated from the blood samples and their total IgE level was estimated using BIOCHECK, Inc. Enzyme Immuno-sorbent assay for the Quantitative Detection of concentration IgE in serum samples of human (Biocheck, Inc, BC1035, US) according to the manufacturer’s instruction and OD was taken at 450 nm.

DNA isolation was done with FAVORGEN FavorPrep Blood Genomic DNA Extraction Mini Kit (Favorgen, FABGK-001, Taiwan) according to manufacturer’s instruction and was confirmed by gel electrophoresis (Sambrook and Russell, 2001).

HLA typing was performed for HLA-DRB1*11 and HLA-DRB1*12 alleles by using the technique SSP-PCR following the protocol of Olerup and Zetterquist (1992). Primers were synthesized by e-oligos. Primers for HLA-DRB1 were used as described by Olerup and Zetterquist (1992) and for internal control GAPDH, the primers used were described by Paulukat et al. (2001). PCR optimization was performed using touchdown PCR. Primers for HLA alleles and internal control GAPDH were used. The primer sequences are given as follows:

Primers for HLA-DRB1*11 (Olerup and Zetterquist, 1992)

Forward: 5’GTTTCTTGGAGTACTCTACGTC3’

Reverse: 5’CTGGCTGTTCCAGTACTCCT3’

Primers for HLA-DRB1*12 (Olerup and Zetterquist, 1992)

Forward: 5’AGTACTCTACGGGTGAGTGTT3’

Reverse: 5’CACTGTGAAGCTCTCCACAG3’

Primers for GAPDH (internal control) (Paulukat et al., 2001)

Forward: 5’ACCACAGTCCATGCCATCAC3’

Reverse: 5’TCCACCACCCTGTTGCTGTA3’

 

 

Data was analyzed using SPSS 20.0. Mean ± S.D was calculated for quantitative variables and Frequencies and percentages were calculated for qualitative variables. Data distribution was tested by Shapiro-Wilk Test and Kolmogorov-Smirnov test. For normal data distribution, Student t-test was applied and for non-normal data distribution Mann-Whitney test was applied. For statistical significance, p-value of ≤0.05 was considered as significant. Odds ratio was calculated and conventional confidence interval of 95% was used.

 

Table I.- Comparison of aeroallergen sensitized patients and Healthy controls (non-atopic) group for different parameters of the recruited persons.

Characteristics

Atopic (n=110)

Non atopic (n=40)

p-Values

Odd’s Ratio CI (95%)

Gender, n (%)
Male

107 (97.3%)

21 (52.5%)

p<0.0001

1.85 (1.37-2.49)

Female

3 (2.7%)

19 (47.5%)

 

χ2 Statistics

P = 0.32

P<0.0001

 

Age (years)
Mean (SD)

30.41 (10.70)

34.03 (13.27)

 

 

Median

29.00

30.50

 

 

Province, n (%)
AJK

6 (5.5%)

0 (0%)

p<0.0001

 

Baluchistan

1 (0.9%)

0 (0%)

 

 

Federal

19 (17.3%)

0 (0%)

 

 

KPK

26 (23.6%)

1 (2.5%)

 

 

Punjab

55 (50.0%)

39 (97.5%)

 

 

Sindh

3 (2.7)

0 (0%)

 

 

Number of positive SPT

 

Mean (SD)

3.78 (0.64)

0

p<0.0001

 

Median (range)

4.00 (2-5)

0

 

 

HLA-DRB1*11, n (%)

 

Positive

15(13.6%)

16 (40%)

p<0.0001

0.34 (0.18-0.62)

Negative

95 (86.4%)

24 (60%)

 

HLA-DRB1*12, n (%)

 

Positive

22 (20.0%)

11 (27.5%)

p=0.033

0.72 (0.38-1.36)

Negative

88 (80.0%)

29 (72.5%)

 

*CI, confidence interval; n, number; %, percentage; SD, standard deviation.

 

Results

 

The aero-allergic patients recruited for study have the mean age of 30.41±10.70 with median age of 29 years and healthy controls have the mean age of 34.03±13.27 with median age of 30.5 years (Table I). The concentration of IgE in blood serum of aeroallergen sensitized individuals was 559.20 IU/ml (8.9-1486 IU/ml), while the non-allergic controls have IgE levels at 150.95 IU/ml (2.4-890 IU/ml).

HLA typing for HLA-DRB1*11 and HLA-DRB1*12 alleles was performed by using SSP-PCR as shown in Figure 1. Out of 150 recruited candidates, 16(40%) healthy controls were positive for HLADRB1*11, and 15(13.6%) were positive among aeroallergen sensitized patients (Fig. 2). The results were statistically significant (p=0.05), which indicates a negative association between HLA-DRB1*11 allele with aero-allergy. However, odds of HLA-DRB1*11 positive samples were 66% lower than HLA-DRB1*11 negative individuals.

In case of HLA-DRB1*12, 11(27.5%) were positive among healthy controls and 22(20%) were positive among aeroallergen sensitized individuals. The results were statistically significant (p=0.03), which means there is a negative association between HLA-DRB1*12 allele with aero-allergy (Fig. 2). The odds of HLA-DRB1*12 positive samples was 28% lower than HLA-DRB1*12 negative individuals (Table I).

 

 

In this study, no significant association between HLA-DRB1*11 positive allele (p = 0.91) and HLA-DRB1*12 positive allele (p = 0.95) with different provinces of Pakistan was found (Table II). While, the prevalence of HLA-DRB1*11 and HLA-DRB1*12 alleles varied widely among population of different provinces of Pakistan but highest was reported in Punjab and KPK.

The relationship of family history of allergy with both HLA-DRB1*11 and HLA-DRB1*12 was determined. The outcomes relate a significant relationship between family history and HLADRB1*11 (p=0.05) but there is no significant association with HLA-DRB1*12 (p=0.15) (Table III).

Association of different allergic diseases with both alleles was investigated by t-test and the outcomes show that there is no significant association of both the HLA-DRB1*11 and HLA-DRB1*12alleles with the different atopic disorders (Table IV).

 

Table II.- Association of the HLA-DRB1*11 and HLA-DRB1*12 with patients residing in different provinces of Pakistan in the aeroallergen sensitized group.

Province

HLA-DRB1*11

HLA-DRB1*12

Positive

Negative

Positive

Negative

Total

15(13.6%)

95(86.4%)

22(20.0%)

88(80.0%)

AJK

1(6.7%)

5(5.3%)

1(4.5%)

5(5.7%)

Baluchistan

0(0.0%)

1(1.1%)

0(0.0%)

1(1.1%)

Federal

2(13.3%)

17(17.9%)

4(18.2%)

15(17.0%)

KPK

4(26.7%)

22(23.2%)

4(18.2%)

22(25.0%)

Punjab

7(46.7%)

48(50.5%)

12(54.5%)

43(48.9%)

Sindh

1(6.7%)

2(2.1%)

1(4.5%)

2(2.3%)

p-Values χ2 Statistics

p = 0.918

p = 0.954

 

Table III.- Association of the HLA-DRB1*11 and HLA-DRB1*12 with the cases with family history in the case group of the study.

Family History

HLA-DRB1*11

HLA-DRB1*12

Positive

Negative

Positive

Negative

Yes

11(73.3%)

42(44.2%)

14(63.6%)

39(44.3%)

No

4(26.7%)

53(55.8%)

8 (36.4%)

49(55.7%)

p-Values 2 Statistics)

p = 0.05

p = 0.15

Odd’s Ratio (95%CI)

3.47 (1.03-11.68)

2.19 (0.83-5.77)

 

DISCUSSION

 

Mid-ages are more prone to aeroallergen sensitization as compared to children and old aged persons as revealed by the results of present study. Govaere et al. (2007) stated that median age of 30 years is most suitable for sampling of allergy patients. The allergy prevalence remains different for the two genders before the age of 8 years, after which, the atopic behavior does not differ significantly. However, Niemeijer and de Monchy (1992) reveals that skin reactivity to histamines give constant results in the age group between 20 to 75 years.

In this study, the IgE levels were higher in aeroallergic individuals compared to non-aero allergic samples. According to Wahn (2014), serum IgE level is raised in the case of allergy thus supporting the results of present study.

 

Table IV.- Association of the HLA-DRB1*11 and HLA-DRB1*12 with the atopic diseases in the aeroallergen sensitized patients.

Diseases n

HLA-DRB1*11

HLA-DRB1*12

Pos (15)

Neg (95)

Pos (22)

Neg (88)

p-Values t statistics

P-Values t statistics

Seasonal allergic rhinitis

25

0.35

0.25

Allergic rhinitis 44

0.26

0.38

Allergic conjunctivitis

17

0.60

0.79

Bronchial asthma 21

0.13

0.90

Urticaria 4

0.42

0.80

Eczema 1

0.69

0.61

Dermatitis 13

0.84

0.77

Sinusitis 4

0.50

0.80

n, total number of patients positive to disease.

 

Negative association of HLA-DRB1*11was found in aeroallergen sensitized individuals of the present study. According to an Iranian study, high frequency of HLA-DRB1*11 allele is associated with raised IgE level in patients with asthma (Movahedi et al., 2008). Lara-Marquez et al. (1999) reported an association of HLA-DRB1*11 allele with house dust mite atopic patients in Venezuelan population, while Slovak population not showed any association with HLA-DRB1 gene with having highest frequency of HLADRB1*11 to 16.1% (Lara-Marquez et al., 1999; Dzurilla et al., 2013). This difference in the frequency of HLADRB1*11 indicates presence of different HLA haplotypes in population of different regions which could be directly associated with allergen. So, allergen susceptibility might be affected by different geographic regions, climate, and patient’s lifestyle.

The results of this study exhibited lack of association of HLA-DRB1*12 in aeroallergen sensitized individuals of Pakistan. There is a huge disparity in the reported results regarding association of HLA-DRB1*12 with allergy in different populations. According to Movahedi et al. (2008) there is a strong association of HLA-DRB1*12 with atopic individuals in Iranian population. A study showed association of HLA-DRB1*12 with patients of chronic urticaria with high gene frequency in Chinese population (Chen et al., 2005). However, no association of HLA-DRB1*12 was reported in asthma patients in the Venezuelan population and sensitization to pollen allergens like birch pollen (Juhlin et al., 1969; Sparholt et al., 1994). This drastic difference in association might be due to difference in allergen susceptibility of different populations. HLA -DRB1*12 allele might function to produce its effects in respiratory tract to cause asthma in Iranian population, while in Venezuelan population; it might not produce significant products to cause asthma due to difference in allergen. Pollen allergen might not cause the change in the product of HLA-DRB1*12 to cause allergy in Slovak community. While in Chinese population, allergens might affect HLA-DRB1*12 allele to significantly produce active mediators to cause urticaria. The reason could be difference in epitope of allergen or its susceptibility in different regions.

NIH is situated in Islamabad and it is in close vicinity to residents of Punjab and Khyber Pakhtunkhawa (KPK). Sindh and Baluchistan regions are very far away from the NIH locality. In this study, the association was analyzed between alleles HLA-DRB1*11 and HLA-DRB1*12 with aero-allergic patients belonging to different provinces of Pakistan. Frequency of HLA-DRB1*11 is different in different provinces of Pakistan and is highest in Punjab and KPK region. The reason for this high frequency is the higher prevalence of aeroallergens in Punjab and KPK province (Juhlin et al., 1969). Frequency of HLA-DRB1*12 was also variable with the highest frequency found in Punjab that might be due to tropical forests in Punjab and high prevalence of pollen allergens (Ahmad et al., 2011). Therefore, no significant association between HLA-DRB1*11 positive allele (p = 0.91) and HLA-DRB1*12 positive allele (p = 0.95) with different provinces of Pakistan was found in this study.

The present study described a positive association of HLA-DRB1*11 with family history of the patients with aero-allergy while negative association was observed in the case of allele HLA-DRB1*12. Wang et al. (2014) reported that there is a significant association of HLA-DRB1*11 but no significant association of HLA-DRB1*12 with family history. There was no significant association observed among both alleles to different allergic diseases in the present study. Our results are consistent with a study that reported no significant association of HLA-DRB1*11 and HLA-DRB1*12 with allergic rhinitis (Ahmad et al., 2011). Zicari et al. (2014) also reported a lack of association between allergic conjunctivitis and HLA polymorphism. Similarly, no significant association of these two alleles with house dust mite allergen and their lack of influence in causing dermatitis and eczema are reported somewhere. Movahedi et al. (2008) also demonstrates no significant association between asthma and HLA-DRB1*12 and HLA-DRB1*11 alleles. While Chen et al. (2005) reported positive association of chronic urticaria and HLA-DRB1*12.

The main limitation of the study was the inclusion of only 2 alleles for determining their relationship with the wide range of aero-allergen sensitizations. Therefore, we propose the study of some additional alleles in order to better understand the genetic associations of such genes with the various types of allergies and to make it clearer for the betterment in disease diagnosis and treatment.

 

Conclusion

 

HLA-DRB1*11 allele has a relationship with aero-allergens. The frequency of gene is quite low but there is a significant association between the two, so, HLA-DRB1*11 might play a protective role in the development of the allergy by different aero-allergens. On the other hand, no significant association between HLA-DRB1*12 and aero-allergens was found. So HLA-DRB1*12 allele is neither a significant risk factor nor a protective character in causing allergy. But both alleles confer susceptibility to the rise of blood serum IgE of the allergic subjects.

 

Acknowledgement

 

We acknowledge University of the Punjab, Lahore for providing financial support for this research study.

 

Statement of conflict of interest

Authors declare that they do not have any conflict of interest regarding this study.

 

References

 

Agarwal, R., 2011. Severe asthma with fungal sensitization. Curr. Allergy Asthma Rep., 11: 403-413. https://doi.org/10.1007/s11882-011-0217-4

Ahmad, F., Yousaf, F. and Asif, S., 2011. Prevalence of allergic disease and related allergens in Pakistan in 2007. J. Postgraduate Med. Inst., 25: 14-23

Breiteneder, H. and Chapman, M.D., 2014. Allergen nomenclature, allergens and allergen immunotherapy: Subcutaneous, sublingual and oral (eds. R.F. Lockey and D.K. Ledfor), 5th edition. CRC Press, Taylor and Francis Group, Boca Raton, Florida, USA, pp. 37-49.

Chen, C.C., Granger, C.V., Peimer, C.A., Moy, O.J. and Wald, S., 2005. Manual ability measure (MAM-16): A preliminary report on a new patient-centred and task-oriented outcome measure of hand function. J. Hand Surg. Am., 30: 207-216. https://doi.org/10.1016/j.jhsb.2004.12.005

Dzurilla, M., Vrlik, M., Homolova, M. and Buc, M., 2013. No association between bronchial asthma and HLA-DRB1, -DQB1 alleles in the Slovak population. Bratisl. Lek. Listy, 114: 93-95. https://doi.org/10.4149/bll_2013_021

Esmaeilzadeh, H., Nabavi, M., Amirzargar, A.A., Aryan, Z., Arshi, S., Bemanian, M.H., Fallahpour, M., Mortazavi, N. and Rezaei, N., 2015. HLA-DRB and HLA-DQ genetic variability in patients with aspirin-exacerbated respiratory disease. Am. J. Rhinol. Allergy, 29: e63-69. https://doi.org/10.2500/ajra.2015.29.4154

Fleiss, J.L., 1981. Statistical methods for rates and proportions, 2nd edition. John Wiley & Sons, New York, USA.

Govaere, E., van Gysel, D., Massa, G., Verhamme, K.M., Doli, E. and de Baets, F., 2007. The influence of age and gender on sensitization to aero-allergens. Pediatr. Allergy Immunol., 18: 671-678. https://doi.org/10.1111/j.1399-3038.2007.00570.x

Greiner, A.N., Hellings, P.W., Rotiroti, G. and Scadding, G.K., 2011. Allergic rhinitis. Lancet, 378: 2112-2222. https://doi.org/10.1016/S0140-6736(11)60130-X

Host, A., Andrae, S., Charkin, S., Diaz-Vázquez, C., Dreborg, S., Eigenmann, P.A., Friedrichs, F., Grinsted, P., Lack, G., Meylan, G., Miglioranzi, P., Muraro, A., Nieto, A., Niggemann, B., Pascual, C., Pouech, M.G., Rancé, F., Rietschel, E. and Wickman, M., 2003. Allergy testing in children: why, who, when and how? Allergy, 58: 559-569. https://doi.org/10.1034/j.1398-9995.2003.00238.x

Javaid, K., Afzal, N. and Adhami, S.U.Z., 2014. Increased frequency of HLA-DRB1* 12 in asthma patients visiting a Teaching Hospital Lahore, Pakistan. Immunology, 143:173-173.

Juhlin, L., Johansson, S.G.O., Bennich, H., Högman, C. and Thyresson, N., 1969. Immunoglobulin E in dermatoses: levels in atopic dermatitis and urticaria. Arch. Dermatol., 100: 12-16. https://doi.org/10.1001/archderm.1969.01610250018004

Kindt, T.J., Goldsby, R.A., Osborne, B.A. and Kuby, J., 2007. Kuby immunology. W.H. Freeman, New York.

Lama, M., Chatterjee, M. and Chaudhuri, T.K., 2014. A study of the association of childhood asthma with HLA alleles in the population of Siliguri, West Bengal, India. Tissue Antigens, 84: 316-320. https://doi.org/10.1111/tan.12403

Lara-Marquez, M.L., Yunis, J.J., Layrisse, Z., Ortega, F., Carvallo-Gil, E., Montagnani, S., Makhatadze, N.J., Pocino, M., Granja, C. and Yunis, E., 1999. Immunogenetics of atopic asthma: association of DRB1*1101 DQA1*0501 DQB1*0301 haplotype with Dermatophagoides spp.-sensitive asthma in a sample of the Venezuelan population. Clin. exp. Allergy, 29: 60-71. https://doi.org/10.1046/j.1365-2222.1999.00461.x

Movahedi, M., Moin, M., Gharagozlou, M., Aghamohammadi, A., Dianat, S., Moradi, B., Nicknam, M.H., Nikbin, B. and Amirzargar, A., 2008. Association of HLA class II alleles with childhood asthma and Total IgE levels. Iran J. Allergy Asthma Immunol., 7: 215-220.

Muazzam, A.G., Mansoor, A., Ali, L., Siddiqi, S., Hameed, A., Ajmal, M. and Mazhar, K., 2013. Association of HLA-DRB1 and-DQB1alleles and haplotypes with rheumatoid arthritis in a Pakistani population. Arthritis Res. Ther., 15: R95. https://doi.org/10.1186/ar4275

Muro, M., Mondejar-López, P., Moya-Quiles, M.R., Salgado, G., Pastor-Vivero, M.D., Lopez-Hernandez, R., Boix, F., Campillo, J.A., Minguela, A. and Garcia-Alonso, A., 2013. HLA*DRB1 and HLA–DQB1 genes on susceptibility to and protection from allergic bronchopulmonary aspergillosis in patients with cystic fibrosis. Microbiol. Immunol., 57: 193-197. https://doi.org/10.1111/1348-0421.12020

Niemeijer, N.R. and de Monchy, J.G., 1992. Age-dependency of sensitization to aero-allergens in asthmatics. Allergy, 47: 431-435. https://doi.org/10.1111/j.1398-9995.1992.tb02084.x

Olerup, O. and Zetterquist, H., 1992. HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: An alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens, 39: 225-235. https://doi.org/10.1111/j.1399-0039.1992.tb01940.x

Park, H., Ahn, K., Park, M.H. and Lee, S.I., 2012. The HLA-DRB1 polymorphism is associated with atopic dermatitis, but not egg allergy in Korean children. Allergy Asthma Immunol. Res., 4: 143-149. https://doi.org/10.4168/aair.2012.4.3.143

Paulukat, J., Bosmann, M., Nold, M., Garkisch, S., Kampfer, H., Frank, S., Raedle, J., Zeuzem, S., Pfeilschifter, J. and Muhl, H., 2001. Expression and release of IL-18 binding protein in response to IFN-γ. J. Immunol., 167: 7038. https://doi.org/10.4049/jimmunol.167.12.7038

Portelli, M., Hodge, E. and Sayers, I., 2015. Genetic risk factors for the development of allergic disease identified by genome-wide association. Clin. exp. Allergy, 45: 21-31. https://doi.org/10.1111/cea.12327

Price, D., Bond, C., Bouchard, J., Costa, R., Keenan, J., Levy, M.L., Orru, M., Ryan, D., Walker, S. and Watson, M., 2006. International Primary Care Respiratory Group (IPCRG) guidelines: management of allergic rhinitis. Prim. Care Respir. J., 15: 58-70. https://doi.org/10.1016/j.pcrj.2005.11.002

Ramasamy, A., Curjuric, I., Coin, L.J., Kumar, A., McArdle, W.L., Imboden, M., Leynaert, B., Kogevinas, M., Schmid-Grendelmeier, P. and Pekkanen, J., 2011. A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. J. Allergy Clin. Immunol., 128: 996-1005. https://doi.org/10.1016/j.jaci.2011.08.030

Renaudin, J., Jacquenet, S., Metz-Favre, C., Baudouin, E., Engel, F., de Blay, F. and Moneret-Vautrin, D., 2012. Interest of specific IgE measurement for Galactose-alpha-1, 3-galactose in unexplained recurrent Urticaria with Angioedema, predominantly Nocturnal: About 6 Cases. J. Allergy Clin. Immunol., 129: AB177. https://doi.org/10.1016/j.jaci.2011.12.226

Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press.

Sparholt, S.H., Georgsen, J., Madsen, H.O., Svendsen, U.G. and Schou, C., 1994. Association between HLA-DRB3*0101 and immunoglobulin-E responsiveness to Bet v I. Hum. Immunol., 39: 76-78. https://doi.org/10.1016/0198-8859(94)90104-X

Wahn, U., 2014. History of allergy (eds. K.C. Bergmann and J. Ring): Book review. Pediatr. Allergy Immunol., 25: i. https://doi.org/10.1111/pai.12292

Wang, M., Zhang, L. and Liu, X., 2014. Interaction between HLA-DRB1 gene polymorphism and environmental risk factors in the development of gestational diabetes mellitus. Zhonghua Fu Chan Ke Za Zhi, 49: 270-275.

Yalcin, A.D., Basaran, S., Bisgin, A., Polat, H.H. and Gorczynski, R.M., 2013. Pollen aero allergens and the climate in mediterranean region and allergen sensitivity in allergic rhinoconjunctivitis and allergic asthma patients. Med. Sci. Monit., 19: 102-110. https://doi.org/10.12659/MSM.883762

Yang, W., Wei, B., Chen, M. and Bu, H., 2015. Evaluation of immunohistochemistry HER2 results interpretation in invasive micropapillary carcinoma of the breast. Zhonghua Bing Li Xue Za Zhi, 44: 48-52.

Zicari, A.M., Mora, B., Lollobrigida, V., Occasi, F., Cesoni Marcelli, A., Megiorni, F., Pizzuti, A., Nebbioso, M. and Duse, M., 2014. Immunogenetic investigation in vernal keratoconjunctivitis. Pediatr. Allergy Immunol., 25: 508-510. https://doi.org/10.1111/pai.12231