Molecular Cloning and Expression of Taste Receptor Gene T2R1 of Obscure Puffer, Takifugu fasciatus
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and
Kui Chen2,*
1Key Open Laboratory for Genetic Breeding of Aquatic Animals and Aquaculture Biology, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, No. 9 Shanshui East Road, Wuxi 214081, China
2School of Life Sciences, Soochow University, Suzhou 215123, China
ABSTRACT
Obscure puffer, Takifugu fasciatus is a unique species of China which is distributed in the estuary of the Yangtze River, and belongs to the same genus with Red fin puffer T. rubripes which has been used as one of human genome model animal since mid-1990s. In this experiment, we cloned a pair of DNA fragment sequence including complete ORF (921bp) of taste receptor candidate gene T2R1 of T. fasciatus and studied the differential expression spectrum of tissues in combination with bioinformatics analysis so as to understand the possible functions in response to chemical sensation behavior of taste receptors. The receptors when compared with T. rubripes, there was 99.2% identity in two kinds ORF sequences, with only 7 bases different, and there were 5 amino acids different between speculated fusion proteins. Under bioinformatics analysis, the T2R1 gene without introns was consistent with the structural domains characteristics of this family genes. The translation protein of T2R1 gene displayed with corresponding signal loci and functional domains of this gene family, and the result showed that the taste receptor translated by T2R1 gene belongs to G protein-coupled receptor super-family. T. fasciatus taste receptor T2R1 in various tissues appeared differentially expressed. The results showed T2R1 were expressed in gill, spleen, heart, lips, skin and tongue tissue, suggesting that it is not only act as taste receptors, but also play other possible functions. Furthermore, the cloning and expression analysis of T2R1 provide theoretical basis to further study function of T2R1 for T. fasciatus.
Article Information
Received 19 October 2016
Revised 20 December 2017
Accepted 24 February 2017
Available online 30 August 2017
Authors’ Contribution
YH, BL and KC conceived and designed the research. YH, SM and WJ conducted the experiment. YH, QZ, TX and BL analyzed the data. YH and BL wrote the paper. BL and KC revised the paper.
Key words
Takifugu fasciatus, Taste receptor gene, Differentially expressed.
DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.5.1683.1691
* Corresponding author: [email protected];
0030-9923/2017/0005-1683 $ 9.00/0
Copyright 2017 Zoological Society of Pakistan
Introduction
There are many research reports about the genus Takifugu. So far, the classification of this genus is commonly focused on the morphological, anatomical characteristics, cytogenetics and biochemical genetics research, but there are not many molecular genetic studies (Miyaki et al., 1995). Red fin puffer, T. rubripes has become one of model animal species for human genome DNA sequence research since mid-1990s (Elger, 1996). Therefore, the international studies afterward mainly focused on T. rubripes (Clark et al., 2001). There is one unique species of the genus Takifugu in China, it was named obscure puffer T. fasciatus, which is mainly distributed in the Yangtze River drainage and at the estuary of the Yangtze River (McClland, 1844). However, T. fasciatus is currently one of the species which is near extinction in the Yangtze River since there is a high demand for it as food for human consumption and as raw material for the pharmaceutical industry.
Taste receptor family No.2 mainly introduces a bitter taste (Conte et al., 2002; Scott, 2004; Go, 2006). Many members of the T2R family have a short amino terminal domain, the cytoplasmic inner loop and the adjacent transmembrane segments are very conservative, estimated to be a protein interaction site. However, the extracellular domain has great variability, estimated to be ligand binding site (Andres-Barquin and Conte, 2004).
As T2R was identified late, the relevant research data is less than T1R. No introns were found in the T2R of the fish that had been obtained; this is the same as mammals. In fish, only 1~2 genes of T2R are identified, far less than the mammalian species (22 in Human beings, 33 in Mouse) (Conte et al., 2003). Ishimaru et al. (2005) recently isolated a novel T2R gene zf997-5 from several zebra fish (Danio rerio) like T2R gene. Similarly, in terms of vertebrate hormone receptors, there was only one objective gene found in zebra fish, far less than 137 of the mouse, but only two of the primate genome (Rodriguez et al., 2002; Pfister and Rodriguez, 2005). This indicates that the receptor expression in the chemical sensory system is very different from different species. Fish and mammals may only have a simplified T2R receptor system, it is also possible that other members of the T2R family have not yet been discovered, which needs further investigation.
Taste receptor gene is an important gene for chemical sensing behavior researching in animals. Many studies were conducted on the mechanism and distribution of taste receptors in mammals and other higher vertebrates (Adler et al., 2000; Chandrashekar et al., 2000; Shi and Zhang, 2007; Upadhyaya et al., 2010; Singh et al., 2011; Dai et al., 2011), but little is reported in fish and other lower vertebrates (Marui and Caprio, 1982; Ogawa and Caprio, 1999; Yasuoka et al., 2004; Oike et al., 2007; Aihara et al., 2008; Yasuoka and Abe, 2009). For example, Gao et al. (2017) reported that T1Rs was expressed at higher levels than T2Rs, and T1Rs showed the highest expression in barbell, followed by that in the gill, and then in the skin, while very low or no expression in the intestine and liver in channel catfish. In another study, T1R and T2R genes were expressed in taste bud cells in lips, gill rakers, and pharynx of zebra fish (Ishimaru et al., 2005). The current research investigates the existence of this gene and its expression distribution of expression profile in T. fasciatus, which will acquire the molecular information of this gene, and contribute to the basis for intensive study of test behavior in fish species.
First of all, according to the T2R1 sequence of the taste receptor related genes on GenBank, we obtained the research results and the gene sequence of fish taste receptor gene of several D. rerio, T. rubripes and Oryzias latipes. Specific primers were designed by the sequence of these genes, which was used to clone the taste receptor candidate gene of T. fasciatus. Furthermore, we conducted the taste receptor gene expression analysis of related differences in tissues, and bioinformatics analysis to explore the evolution of taste receptor gene family and the relationship between the species evolution and possible functional role.
Materials and Methods
Experimental animals
All experiments were approved by the Institutional Animal Care and Use Committee of the Ministry of Freshwater Fisheries Research Center of the Chinese Academy of Fishery Sciences and were undertaken in accordance with the national legislation for fish welfare established by the Ministry of Science and Technology of the People’s Republic of China. Experimental T. fasciatus were provided by the National Puffer Stock Farm Jiangsu Zhongyang Group Co., Nantong, Jiangsu. The fish (50 in total) were reared in a thermostat aquarium for domestication, being fed with commercial compound diet for T. fasciatus. The ambient conditions for rearing were 25°C and feeding one time every day. The sample tissues of gill, spleen, heart, lips, skin and tongue were collected from 6 fish.
RNA extraction
Total RNA was extracted from the lips and other tissues using RNAiso Plus (Takara, Dalian, China) according to the manufacturer’s protocol (Rio et al., 2010). Briefly, after 100 μg tissue samples were ground and pulverized, 1000 μ l of RNAiso Plus was added with repetitive pipetting until the tissues were completely lysed. Next, 0.2 volumes of chloroform was added, and the mixture was left at room temperature for 5 min. and then centrifuged at 12,000 g for 5 min. The supernatant was removed, and an equal volume of anhydrous isopropanol was added to precipitate the RNA. The absorptions at 260 nm (A260) and at 280 nm (A280) were measured with a spectrophotometer, and the A260/A280 ratio was used to assess RNA quality before the samples were stored at –80°C. RNA samples were treated by RQ1 RNase-Free DNase prior to RT-PCR (Dalian Takara Co., Ltd.) to avoid genomic DNA amplification.
Table I.- Sequence of PCR primer.
|
PCR |
Primer |
Sequences(5’ to 3’) |
|
Partial cDNA PCR |
T2R1 F1 |
ATGCTTGAATCAGATGATTTG |
|
T2R1R1 |
CTACTCCCCTTCTGCATTAAT |
|
|
5’RACE PCR |
T2R1 F2 |
GAGTCCTCGCCAACCTTT |
|
T2R1R2 |
GACAAGCCCGAGAAGAGC |
|
|
3’RACE PCR |
T2R1 F3 |
AACTGTGGCTGTCATTATTT |
|
T2R1R3 |
CAAGTGTTTGTTGGAGCAG |
|
|
Quantitative PCR |
T2R1 F1 |
ATGCTTGAATCAGATGATTTG |
|
T2R1R2 |
CTACTCCCCTTCTGCATTAAT |
|
|
β–Actin3 |
F1 |
CCCCATCGAACACGGAATCG |
|
R1 |
CGCTCGGCAGTGGTAGTGAA |
Cloning the complete cDNA sequence of T2R1
The T2R1 primers were designed based on the sequences of the taste receptor gene T2R1 of D. rerio (Danio rerio, T2R1a, AB200903; T2R1b, AB200904) (Lalitha, 2000). Samples (1μg) of total RNA from lips and other tissues were retrotranscribed using a cDNA synthesis kit (TakaraBio Inc., Dalian, China) with oligo (dT18) primer. PCR used 2 μ l of synthesized cDNA as a template.
All reactions contained 25 μ l of 200 nM T2R1 F1 and R1 primers (Table I), 200 μ M of each dNTP, 2 mM MgCl2 and 1.2 U of rTaq DNA polymerase (TakaraBio Inc.). The amplification protocol was as follows: predenaturation at 95°C for 30 s, 30 cycles of denaturationat 95°C for 10 s, annealing at 57°C for 30 s and a final elongation step at 72°C for 45 s. All PCR products were electrophoresed in 1.5% (w/v) agarose gel stained with ethidium bromide to estimate the molecular mass of theamplicons. The target band of predicted size was gel-purified using a Gel Extraction kit (Takara Bio Inc.), cloned into the pMD-18-T vector (Takara Bio Inc.) and sequenced by Biosun Biotech (Shanghai, China). All experiments were performed in triplicate.
The 5’and 3’ends of the T2R1 cDNA were obtained according to the manufacturer’s protocol for the RACE kit (Takara). The other primers (Table I) were designed for the RACE reaction. The PCR products were subjected to electrophoresis in a 1.5% (w/v) agarose gel and were purified using a Gel Purification kit (Takara). The purified product was recovered, cloned into the pMD-18-T vector and then sequenced by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China).
T2R1 expression patterns in different tissues
Fluorescent quantitative real-time (RT) PCR (qRT-PCR) was used to analyze the T2R1 expression level. Specific primers (Table I) were designed according to the conserved regions of the T2R1 mRNA sequences from T. fasciatus in GenBank (EU272034.1) to detect its expression level. The β-actin gene was selected as the internal control gene, and the length of the fragment was about 200 bp. All primers were synthesized by Shanghai Biocolor, Bio Science and Technology Company (Shanghai, China). PCR products were 150- to 250-bp long.
RT-PCR used a 7500 RT-PCR system (Applied Biosystems, USA). RT-PCR reaction solution consisted of 10.0 μL of SYBRpremix Ex TaqTM (2×), 1.6 μL of primer (10 μM), 2.0 μL of RT reaction mix (cDNAsolution), 0.4μL ROX reference dye or dye II (50×) and 6.0 μL of dH2O. The thermocycling conditions for the target genes were as follows: initiated with a denaturation step at 50 °C for 2 min, 95 °C for 3 min; followed by forty cycles at 95 °C for 15s, 60 °C for 60s, respectively. Melting curve analysis was performed at 95 °C for 15 s and 60 °C for 60 s over a range of 60-95 °C to verify that a single PCR product was generated. The florescent flux was then recorded and the reaction continued at 95 °C for 30 s, 60 °C for 15 s. We measured the dissolution rate between 65 and 92 °C. Each increase of 0.2 °C was maintained for 1 s and the fluorescent flux was recorded. The standard curve and amplification efficiency of T2R1 and β-actin for RT-PCR were below: T2R1: Y=-0.319x+9.89, R2=0.996; β-actin: Y=-0.324x+9.657, R2=0.990. The relative expression levels of genes were calculated using the 2−ΔΔCT method (Livak and Schmittgen, 2001).
Bioinformatics analysis
By using the BLAST (Altschul et al., 1997) identity search tools, which NCBI provides and FASTA identity & similarity search tools, which EBI provides; and compare validation by using BLAST in the dbEST and dbWGS database; analyze the structure of nucleic acid and protein sequences by using DNAstar (Burland, 2000) and DNATools (Curran nad Tevedibrink, 2013); predict molecular weight and isoelectric point by using the tool kit in EXPASY site (http://prosite.expasy.org/prosite.html); predict the structure of gene exons and introns by using Sim4 procedure; predict structure domain by using SMART (http://smart.embl-heidelberg.de/) software; predict the secondary structure of protein by using SOPMA and nnpredict software, which EXPASY site offers; conduct signal peptide analysis of proteins by using the neural network analysis of SignalP (http://www.cbs.dtu.dk/services/SignalP/); analyze and forecast protein transmembrane region by using online tools TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) and TMHMM (http://www.cbs.dtu.dk/services/TMHMM/); perform their subcellular localization with online tools PSORTb (http://www.psort.org/psortb/); analyze the functional sites of protein sequence by using ScanProsite (Castro et al., 2006) and PROSCAN software (Chambers et al., 2008).
Statistical analyses
We used SPSS (version 11.5) software followed by Turkey’s-b test to determine the differences. Diverse little letters above histogram bars show significant differences (P<0.05) among different tissues in Turkey’s-b test All the results were expressed as means ±standard deviations (Ẍ±SD).
Results
The cloned taste receptor gene T2R1
By cloning and sequencing, we obtained the candidate taste receptor T2R1 gene of T. fasciatus with the full length of 921 bp (Fig. 1) and an open reading frame, encoding 306 amino acids, to the end of the terminator for the gene. The ratio of A+T was 46.91% and G+C, 53.09% (NCBI accession number: EU272034).
Differential expression of T2R1 in different tissues
T2R1 expression was determined in different tissues from T. fasciatus, including the gill, spleen, heart, lips, skin and tongue. The T2R1 gene is expressed in all 6 tissues (Fig. 2) but at different levels. The expression levels were lower in the tongues of T. fasciatus, whereas the expression levels were higher in the skins and lips of T. fasciatus than those of gill, spleen, heart.
Bioinformatics analysis of T2R1
The identity of sequences of T2R1 between T. fasciatus and T. rubripes reached 99.2%, with only 7 bases different, while the speculated fusion protein had 5 amino acids differentwhen compared with corresponding sequence of D. rerio, their identity with T. rubripes was consistent. However, when they were compared with the identity to corresponding families of other mammals, it was 80% to 90% homologous with T2R39, T2R56 and T2R60 fragments of cow, Bos Taurus and 91% homologous with T2R43 fragment of dog, Canis familiaris. It was 88% homologous with T2R124 fragment of horse, Equus caballus and 80% homologous with T2R4 fragments of primates such as human being. The homologous part of the gene was found in the area near 270-320 bp of T2R1 (Figs. 3, 4).
T2R1 by the cloned expansion of pre-mRNA transcripts obtained a complete body, the length of which was 921 bp, encoding 306 amino acids, the isoelectric point 8.533, and molecular size of 34.025 KD. By using online prediction tools SMART, which the Expasy site provides, the analysis showed that the amino acid sequence includes 7 transmembrane domains, which are consistent with the characteristics of G protein-coupled receptor family. Based on this analysis, in addition to 7 transmembrane domains, extra-territorial, from the 4-266 amino acid residues may be a HTTM (Horizontally Transferred Transmembrane Domain) region; the 9-168 amino acid residues be acid phosphatase protein family function domain; the 85-285 amino acid residues be a GTPase activated TBC domain; the 105-290 amino acid residues be structural domain similar to TRAM receptor (Fig. 5).
Note: transmembrane region 1. 10-32bp; 2. 39- 61bp; 3. 81-103bp; 4. 124- 146bp; 5. 179- 201bp; 6. 222- 244bp; 7. 259- 278bp.
By using SignalP neural network analysis method, we conducted signal peptide analysis of the T2R1 protein. The results showed that the signal peptide was in 1-20 amino acids of the protein, with the scores of 0.98, and the split site was between the 22 and 23 amino acid residues (Fig. 6).
It could be predicted by TMpred online tool that there were 7 transmembrane helixes, which were from inside to outside and 7 transmembrane helixes, which were also from outside to inside. This strongly proved that the protein belonged to the 7 transmembrane receptor’s family (Fig. 7). In the meantime, we used TMHMM to verify it, and the result showed that peptides from the 7-26 amino acid region were the transmembrane helixes, which were from inside to outside. This was consistent with the former predicted result.
PSORTb online tools were used to localize the gene in the subcellular level. The results showed that the protein was localized on the membrane, with the score as high as 10. Functional site analysis by software PROSCAN showed that the protein contained 2 N-glycosylation sites. This means the protein was a kind of glycoprotein. The protein sequence contained 4 protein kinase C phosphorylation sites, 3 casein kinase, phosphorylation sites, 3 N-myristoyl sites and 1 amidation site too. It showed the protein was probably related to the regulation of cell signal transduction.
Discussion
Evolution of taste receptor gene T2R1
Studies related to taste receptor of fish are in its infancy stages. As a result, the data we collected was obtained from phylogenetic analysis in the database such as Genebank, the closest sequence we could search was other member’s of the taste receptor family of mammals (Go, 2006).
Compared with the known sequences of T. rubripes and Brachydanio rerio, the identity of homologous fragment of T2R1 from homologous cloning could reach more than 98%. Therefore, it could be speculated that the identity of taste receptors in the same genus was higher, but there is instability of the sequences among different fish species.
From inter-specific comparisons, the identity of T2R1 between the obscure puffer fish and other species were lower. There was an area near 270-320 bp, the identity of which was more than 80% compared with multiple taste receptor genes of No. 2 family of mammals, so it could be speculated that there was a conserved region of taste receptor gene of No. 2 family.
The success of taste receptor gene cloning of T. fasciatus was mainly based on the similarity and structure of the gene sequence. In regards to the research of function, regulations of the gene could be all round proved by RNA interference, gene knockout or transgenic method. The real characteristics of the expression of the gene could be known by immuno-histological chemical reaction, fluorescent quantitative PCR and in-situ hybridization. The direction of future research should be focused on the relationship between the regulation processes and the actual behavioral response.
Differential expression of T2R1 in different tissues
It could be known by analyzing the differential expression in several tissues of T. fasciatus that T2R1 could be expressed in gill, spleen, heart, lips, skin and tongue. Recent research shows that, T2Rs is expressed in the human lung and can relax bronchial smooth muscle by Ca2+ signaling pathway (An et al., 2012). At the same time, we found that the Gene Expression Omnibus (GEO) analysis was based on GenBank, GDS3834 / 5828 / TAS2R1 data show that T2R1 has more or less expression in a variety of normal tissues. Our results confirmed that the expression of T2R1 in multiple tissues of T. fasciatus, it is suggested that it is not only as a taste receptor, but also plays a role in other aspects.
The experiment is just a qualitative study of the expression of taste receptors, which does not express quantitative analysis. Further, detailed studies should be conducted with the interval design, with different gradient concentrations of chemical substances to stimulate, using Real Time-PCR or fluorescence in situ hybridization and other techniques so as to quantify the expression of the taste receptor gene in tissues. The use of the RNAi or genetically modified and other technologies is also essential in order to confirm its function. In addition to research focused on their functions, in the future, research work is needed in the regulation of gene networks.
Gene structure and the type of the protein of T2R1
It should be known by bioinformatics analysis of the speculated protein of T2R1 that the protein had the same characteristics as the taste receptor gene family such as having 7 transmembrane helix structural domain; that the protein was localized on the membrane of the cells; that it had the obvious structure of signal peptide, horizontally transferred transmembrane domain (HTTM), TBC domain which could activate GTPase, and that it had the similar structure of TRAM receptor. All these from the structure proved that T2R1 had the functions of membrane transferring, receptor and GTPase activation. From functional site analysis, the results showed that the protein contained several phosphorylation sites and glycosylation sites, which indicated that the protein may be related to the regulation of cell signal transduction, and which meant it was related to chemical sensory conduction too. The characteristics of the protein were matched with the receptor proteins of other kinds of eukaryotes (Upadhyaya et al., 2010, 2014; Singh et al., 2011, 2014). This discovery made the experiment more meaningful.
The structure and potential function of the gene were speculated by bioinformatics analysis, and it has confirmed the probability of the taste gene, which lay a good foundation for the further study about molecular expression and regulation of the taste gene. It could be speculated from the sites that taste receptor gene was highly conserved in the fish, so the results of family number 1 and 2 of T. fasciatus had a high reference value to the research of taste receptor gene of other kinds of fish. The paper revealed the function sites of taste receptor gene of T. fasciatus, which laid the foundation for further research related to the sensory signal transduction of chemical substances, and the reaction mechanism of taste cells to the special chemical substances. It is important for the development of the new attractant so as to provide target gene for the molecular controlling. It also demonstrates there is a need to promote the production of T. fasciatus for the application of science and technology.
Acknowledgements
This study was supported by the Technology Support Program of Jiangsu Province (Project No. BE2008319). We will like to thank Li Kangmin for giving his advice and editing this manuscript.
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Andres-Barquin, P.J. and Conte, C., 2004. Molecular basis of bitter taste: The T2R family of G protein- coupled receptors. Cell Biochem. Biophy., 41: 99-112. https://doi.org/10.1385/CBB:41:1:099
Adler, E., Hoon, M.A., Mueller, K.L., Chandrashekar, J., Ryba, N.J. and Zuker, C.S., 2000. A novel family of mammalian taste receptors. Cell, 100: 693-702. https://doi.org/10.1016/S0092-8674(00)80705-9
Aihara, Y., Yasuoka, A., Iwamoto, S., Yoshida, Y., Misaka, T. and Abe, K., 2008. Construction of a taste-blind medaka fish and quantitative assay of its preference–aversion behavior. Genes Brain Behav., 7: 924-932. https://doi.org/10.1111/j.1601-183X.2008.00433.x
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucl. Acids Res., 25: 3389-3402. https://doi.org/10.1093/nar/25.17.3389
An, S.S., Wang, W.C., Koziol-White, C.J., Ahn, K., Lee, D.Y., Kurten, R.C., Panettieri, Jr. R.A. and Liggett, S.B., 2012. TAS2R activation promotes airway smooth muscle relaxation despite β (2)-adrenergic receptor tachyphylaxis. Am. J. Physiol. Lung Cell Mol. Physiol., 303: 304-311. https://doi.org/10.1152/ajplung.00126.2012
Burland, T.G., 2000. DNASTAR’s Lasergene sequence analysis software. Methods mol. Biol., 132: 71- 91.
Clark, M.S., Smith, S.F. and Elgar, G., 2001. Use of the Japanese pufferfish (Fugu rubripes) in comparative genomics. Mar. Biotechnol., 3(Suppl. 1): 130-140. https://doi.org/10.1007/s10126-001-0034-1
Conte, C., Ebeling, M., Marcuz, A., Nef, P. and Andres-Barquin, P.J., 2002. Identification and characterization of human taste receptor genes belonging to the TAS2R family. Cytogenet. Genome Res., 98: 45-53. https://doi.org/10.1159/000068546
Conte, C., Ebeling, M., Marcuz, A., Nef, P. and Andres-Barquin, P.J., 2003. Evolutionary relationships of the Tas2r receptor gene families in mouse and human. Physiol. Genom., 14: 73-82. https://doi.org/10.1152/physiolgenomics.00060.2003
Chandrashekar, J., Mueller, K.L., Hoon, M.A., Adler, E., Feng, L., Guo, W., Zuker, C.S. and Ryba, N.J., 2000. T2Rs function as bitter taste receptors. Cell, 100: 703-711. https://doi.org/10.1016/S0092-8674(00)80706-0
Curran, J.M. and Tvedebrink, T., 2013. DNAtools: Tools for empirical testing of DNA match probabilities. R package.
Castro, E.D., Sigrist, C.J.A., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E., Bairoch, A. and Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucl. Acids Res., 34: 362-365. https://doi.org/10.1093/nar/gkl124
Chambers, S.K., Schover, L., Halford, K., Clutton, S., Ferguson, M., Gordon, L., Gardiner, R.A., Occhipinti, S. and Dunn, J., 2008. ProsCan for Couples: Randomised controlled trial of a couples-based sexuality intervention for men with localised prostate cancer who receive radical prostatectomy. BMC Cancer, 8: 1-8. https://doi.org/10.1186/1471-2407-8-207
Dai, W., You, Z., Zhou, H., Zhang, J. and Hu, Y., 2011. Structure-function relationships of the human bitter taste receptor hTAS2R1: insights from molecular modeling studies. J. Recept. Signal Transduct. Res., 31: 229-240. https://doi.org/10.3109/10799893.2011.578141
Elger, G., 1996. Quality not quantity: the pufferfish genome. Hum. Mol. Genet., 5: 1437-1442. https://doi.org/10.1093/hmg/5.Supplement_1.1437
McClelland, J., 1844. Description of a collection of fishes made at Chusan and Ningpo in China, Dr. G.R. Playfair. J. Nat. Hist. Calcutta, 4: 390-413.
Marui, T. and Caprio, J., 1982. Electrophysiological evidence for the topographical arrangement of taste and tactile neurons in the facial lobe of the channel catfish. Brain Res., 231: 185-190. https://doi.org/10.1016/0006-8993(82)90017-8
Gao, Y., Liu, S., Yao J., Zhou, T., Li, N., Dunham, R. and Liu, Z., 2017. Taste receptors and gustatory associated G proteins in channel catfish, Ictalurus punctatus. Comp. Biochem. Physiol. D, 21: 1-9.
Go, Y., 2006. Lineage-Specific expansions and contractions of the bitter taste receptor gene repertoire in vertebrates. Mol. Biol. Evolut., 23: 964-972. https://doi.org/10.1093/molbev/msj106
Ishimaru, Y., Okada, S., Naito, H., Nagai, T., Yasuoka, A., Matsumoto, I. and Abe, K., 2005. Two families of candidate taste receptors in fishes. Mechan. Develop., 122: 1310-1321. https://doi.org/10.1016/j.mod.2005.07.005
Lalitha, S., 2000. Primer premier 5. Biotech. Softw. Internet Rep., 1: 270-272. https://doi.org/10.1089/152791600459894
Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2- ∆∆CT method. Methods, 25: 402-408. https://doi.org/10.1006/meth.2001.1262
Miyaki, K., Tableeta, O. and Kayano, H., 1995. Karyotypes in six species of pufferfishes genus Takifugu. Fish. Sci., 61: 594-598.
Ogawa, K. and Caprio, J., 1999. Responses to binary mixtures of amino acids in the facial taste system of the channel catfish. J. Neurophysiol., 82: 564-569.
Oike, H., Nagai, T., Furuyama, A., Okada, S., Aihara, Y., Ishimaru, Y., Marui, T., Matsumoto, I., Misaka, T. and Abe, K., 2007. Characterization of ligands for fish taste receptors. J. Neurosci., 27: 5584-5592. https://doi.org/10.1523/JNEUROSCI.0651-07.2007
Pfister, P. and Rodriguez, I., 2005. Olfactory expression of a single and highly variable V1r pheromone receptor-like gene in fish species. Proc. natl. Acad. Sci., 102: 5489-5494. https://doi.org/10.1073/pnas.0402581102
Rodriguez, I., Del, P.K., Rothman, A., Ishii, T. and Mombaerts, P., 2002. Multiple new and isolated families within the mouse superfamily of V1r vomeronasal receptors. Nat. Neurosci., 5: 134-140. https://doi.org/10.1038/nn795
Rio, D.C., Jr, A.M., Hannon, G.J. and Nilsen, W.T., 2010. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb. Protoc., 2010: https://doi.org/10.1101/pdb.prot5439
Scott, K., 2004. The sweet and the bitter of mammalian taste. Curr. Opin. Neurobiol., 14: 423-427. https://doi.org/10.1016/j.conb.2004.06.003
Shi, P. and Zhang, J., 2007. Comparative genomic analysis identifies an evolutionary shift of vomeronasal receptor gene repertoires in the vertebrate transition from water to land. Genome Res., 17: 166-174. https://doi.org/10.1101/gr.6040007
Singh, N., Pydi, S.P., Upadhyaya, J. and and Chelikani. P., 2011. Structural basis of activation of bitter taste receptor T2R1 and comparison with Class A G-protein-coupled receptors (GPCRs). J. biol. Chem., 286: 36032-36041. https://doi.org/10.1074/jbc.M111.246983
Singh, N., Chakraborty, R., Bhullar, R.P. and Chelikani. P., 2014. Differential expression of bitter taste receptors in non-cancerous breast epithelial and breast cancer cells. Biochem. biophys. Res. Commun., 446: 499-503. https://doi.org/10.1016/j.bbrc.2014.02.140
Upadhyaya, J., Pydi, S.P., Singh, N., Alukob, R.E. and Chelikani, P., 2010. Bitter taste receptor T2R1 is activated by dipeptides and tripeptides. Biochem. biophys. Res. Commun., 398: 331-335. https://doi.org/10.1016/j.bbrc.2010.06.097
Upadhyaya, J.D., Singh, N., Sikarwar, A.S., Chakraborty, R., Pydi, S.P., Bhullar, R. P., Dakshinamurti, S. and Chelikani, P., 2014. Dextromethorphan mediated bitter taste receptor activation in the pulmonary circuit causes vasoconstriction. PLoS One, 9: e110373-e110373. https://doi.org/10.1371/journal.pone.0110373
Yasuoka, A., Aihara, Y., Matsumoto, I. and Abe, K., 2004. Phospholipase C-beta 2 as a mammalian taste signaling marker is expressed in the multiple gustatory tissues of medaka fish, Oryzias latipes. Mech. Develop., 121: 985-989. https://doi.org/10.1016/j.mod.2004.03.009
Yasuoka, A. and Abe, K., 2009. Gustation in fish: search for prototype of taste perception. Results Probl. Cell Differ., 47: 239-255. https://doi.org/10.1007/400_2008_6