Prevalence and Potential Risk Factors for Escherichia coli Isolated from Tibetan Piglets with White Score Diarrhea

Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

1Key Laboratory of Clinical Veterinary Medicine in Tibet, XiZang Agriculture and Animal Husbandry College, Linzhi 860000 Tibet, People’s Republic of China

2College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, People’s Republic of China

3University College of Veterinary and Animal Sciences, Islamia University of Bahawalpur, Bahawalpur 63100, Pakistan

Hailong Dong and Hui Zhang contributed equally in this article.

 

ABSTRACT

This study was undertaken to determine the prevalence and pathogenic potential of Escherichia coli (E. coli) isolated from piglets having white score diarrhea as a result of outbreak occurred in Qinghai Tibetan Plateau in 2015. A total of 81 E.coli were isolated from 83 fecal samples. The organisms were inoculated on MacConkey agar and EMB agar and identified via biochemical tests. Polymerase chain reaction was used to detect representative virulence factors or genes, including E.coli adherence factor (K88, CS31A, afaE-8), toxins (estA, estB, Stxl, Stx2, EAST1), pathogenicity island (eaeA, irp2, ETT2) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%), CS31A (41.98%), estB (19.75%), eaeA (14.81%), estA (12.35%) and K88 (1.23%), while others were negative. The result showed that the main serotypes of E. coli were O8, O64, O138, O157, O139 and O141, accounting for 60 (74.04%) of all strains, while mouse subcutaneous-infection model revealed that 45(55.56%) of the isolates were “killers”, 20 (24.69%) were pathopoiesia but not lead to die and 16 (19.75%) of the isolates were non virulent. This study reported the occurrence of pathogenic E. coli isolated from Tibetan piglets with white score diarrhea which highlights the threat of pathogenic E.coli in free ranging Tibetan piglets, as the local herdsmen can directly suffer a great economic loss.


Article Information

Received 07 April 2017

Revised 12 June 2017

Accepted 07 July 2017

Available online 19 December 2017

Authors’ Contribution

HLD, HZ and KL conceived and designed the experiments. MUR, MK and FN contributed reagents, materials and analysis tools. HZ, YW, ZC, JL and QXW wrote the manuscript.

Key words

Escherichia coli (E. coli), Pathogenic, Virulence associated genes, O-antigen serotype, Tibetan piglets.

DOI: https://dx.doi.org/10.17582/journal.pjz/2018.50.1.57.63

* Corresponding authors: [email protected];

[email protected]

0030-9923/2018/0001-0057 $ 9.00/0

Copyright 2018 Zoological Society of Pakistan



Introduction

 

Escherichia coli (E. coli) is a commensal bacterium and opportunistic pathogen that is commonly found in the intestinal tracts of animals and humans (Li et al., 2014). However, some E. coli have acquired virulence genes rendering them pathogenic and can cause a variety of diseases in animals (Kaper et al., 2004). The major clinical manifestation of E. coli is severe diarrhea, dehydration, or sepsis (Gibbs et al., 2004), and also remained prevalent for a long-term in Tibetan pigs, with the main clinical symptoms as stunted growth or death, especially for piglets the harm was bigger.

According to biological characteristics, mechanism of action and pathogenicity, E.coli can be divided into seven groups, enteroinvasive E. coli (EIEC), enterohemorrhagic E. coli (EHEC), enteropathogenic E. coli (EPEC), Shiga toxin-producing E.coli (STEC), enteroaggregative E. coli (EAEC), enterotoxigenic E. coli (ETEC) and diffusely adherent E. coli (DAEC) (Gyles, 1992; Kaper et al., 2004). In addition, it has been proposed that EAST1 gene-positive E. coli might be associated with diarrhea in human (Zhou et al., 2002) and enterotoxigenic E. coli (ETEC) is an important cause of diarrhoea during the pre-weaning and weaning period (Ojeniyi et al., 1994; Nagy and Fekete, 1999). E.coli have many virulence factors, including adhesin, enterotoxin, shiga toxigenic and pathogenicity island which is widely distributed among diarrheic pigs (Zhang et al., 2007; Contrepois et al., 1989). Contrepois adhesin is the surface of some macromolecular structure components in mostly bacteria, mainly fimbriae adhesin and afimbrial adhesion, and basis of biological engraftment which is the precondition of bacteria infection usually. The major virulence genes of adhesin are afa/drab, iha, and sfa/focCD etc. (Er et al., 2015). Through change the absorption and secretion of intestinal cells, enterotoxin also damage the dynamic balance of intestine, and helps the fluids and electrolytes flow into enteric cavity that cause disease with watery diarrhea (Zhang et al., 2007), while the associated virulence factors contains estA, estB, and EAST1 etc. Shiga toxin is a kind of highly pathogenic toxin that mainly consists of stx1, stx2. Moreover, virulence Island are the virulence genes when bacterium was evolved for adaptation to the environment change, and it is closely related to the pathogenicity of E. coli (Cray and Moon, 1995; Agin and Wolf, 1997), the major genes contains eaeA, irp2 and ETT2. However, outer membrane protein can help the bacteria escape the body’s immune defenses, and at the same time, it can improve the E. coli adsorption host cells, like ompA.

The antigen of E. coli has a complex structure, and has the regional difference and diversity; somatic antigen (O) is the major antigen and until now 173 kinds of antigens are identified in E. coli, most of them are not pathogenic serotypes normally, and only a handful of serotypes are pathogenic for livestock and poultry (Ciosek, 1970). The serotypes of E. coli are more and have a large variability which makes it much difficult for the effective prevention and control of E. coli diseases. The weak immunity of body or if bacteria invade the parenteral tissues can cause severe diarrhea, sepsis, even cause death. It can cause the yellow scour of newborn piglets, white score diarrhea and edema diseases, it has a higher morbidity and mortality, which is a kind of important zoonoses.

Tibetan pig is relatively an ancient original indigenous breed, a rare plateau type pig in the world and is the only high altitude pasture pig breed in China (Zhang et al., 2017a, b; Li et al., 2017). With high proteins and rich amino acids, the Tibetan pig meat is an important source of income for Tibetans (Zhang et al., 2017a). Clinically we often find the Tibetan piglets with white score diarrhea, some piglets even died which made the harm more serious. The previous study showed that virulence genes were more frequent in isolates from cases of diarrhea than in isolates from healthy animals (Hariharan et al., 2004). However, there is lack of information on the prevalence of virulence factors of porcine E. coli. Therefore, the present study was undertaken for the first time to study the virulence potential of E. coli isolated from Tibetan piglets with white score diarrhea, and will have an emphasis for the public concern.

 

Materials and methods

Sample collection, isolation and identification

The present study was carried out in Nyingchi Prefecture, in southeastern Tibet that has an average height of 3100 meters, the largest continuous high elevation ecosystem. A total of 83 fresh fecal samples with white score diarrhea were collected from local farmer’s piglets from July to October, 2015. After collection, all fecal samples were stored at 4°C. These samples were transported on ice to Huazhong Agricultural University for further experiment. All samples were enriched in nutrient broth, cross-inoculated in MacConkey medium, and single pink colonies were picked and purified on MacConkey medium (Hangzhou Microbial reagent Co. Ltd., Wuhan China), Pink colour colonies were taken and inoculated on Eosin methelene blue agar (EMB) (Hangzhou Microbial reagent Co. Ltd., Wuhan China) for further validation, blue-black with a metallic green sheen colonies were regarded as an E. coli and identified through several biochemical tests (Urease production, Catalase test, Motility, Voges proskauer, Indole production, Carbohydrate fermentation tests, Methyl red and Citrate utilization) as given in Table I. For species identification 16S rDNA sequencing (Using universal primers) was performed as suggested by Edwardsand Ewing (1972) and Wang et al. (2003).

 

Table I.- Biochemical tests used for E. coli identification.

Tests

Results

Tests

Results

Urease production

-

Indole production

+

Catalase test

-

Carbohydrate fermentation tests

+

Motility

+

Methyl red

+

Voges proskauer

-

Citrate utilization

-

 

Screening for virulence factors and genes

The E. coli chromosomal DNA was extracted using boiling method (Zhang et al., 2015). Based on previous reference (Osawa et al., 2006), primers shown in Table II were designed and synthesized by Wuhan Qingke Biotechnology Co. Ltd., Wuhan, China. The PCR was performed in applied thermal cycler (Applied Biosystem) using PCR kits according to the manufactures instructions (Zhang et al., 2017c).

The PCR reaction was performed in a 25µL mixture containing 13µL of 2× TaqPCR master mix, 1µL of each primer, 8µL of ddH2O and 2µL of sample. The reaction condition were applied with suitable modification (shown in Table III) as previously described by Edwards and Ewing (1972).

 

Table II.- Characteristics of primer pairs specific for virulence factor gene in this study.

Primer Sequence (5'-3') Size(bp)
K88 F: GATGAAAAAGACTCTGATTGCA

841

R: GATTGCTACGTTC AGCGGAGCG
CS31A F: GGGCGCTCTCTCCTTCAAC

402

R: CGCCCTAATTGCTGGCGAC
afaE-8 F: CTAACTTGCCATGCTGTGACAGTA

302

R: TTATCCCCTGCGTAGTTGTGAATC
estA F: TCCGTGAAACAACATGACGG

244

R: ATAACATCCAGCACAGGCAG
estB F: GCCTATGCATCTACACAATC

278

R: TGAGAAATGGACAATGTCCG
Stxl F: ATTCGCTGAATGTCATTCGCT

664

R: ACGCTTCCC AG AATTGCATTA
Stx2 F: GAATGAAGAAGATGTTTATAGCGG

281

R: GGTTATGCCTCAGTCATTATTAA
EAST1 F: ATGCCATCAACACAGTATATC

117

R: TCAGGTCGCGAGTGACGG
eaeA F: AAGCGACTGAGGTCACT

384

R: ACGCTGCTCACTAGATGT
irp2 F: AAGGATTCGCTGTIACCGGAC

287

R: TCGTCGGGCAGCGTTTCTTCT
ETT2 F: CTTCTTCCTAACGAAACATCATTAC

913

R: TGACATATCAACTTTCTCTTACGC
ompA F: AGCTATCGCGATTGCAGTG

919

R: GGTGTTGCCAGTAACCGG

 

Escherichia coli serotyping antisera against ‘O’ antigens

Slide agglutination test: The antigen (E. coli, 0.025 ml) and polyvalent serum (0.025ml) were mixed together on glass plate, and observed for 2 min to determine the result. At the same time, the antigen (E. coli, 0.025 ml) and 0.5% phenol saline were also mix together as a negative control, with no agglutination after 2 min. Positive: if more than 50% of antigen agglutinates; negative: no agglutination.

 

Table III.- The positive of the virulence gene.

Gene

n

No. positive

Prevalence % (95% CI)

K88

81

1

1.23 (0-6.7)

CS31A

81

34

41.98 (31.1-53.5)

afaE-8

81

0

0

estA

81

10

12.35 (6.1-21.5)

estB

81

16

19.75 (11.7-30.1)

Stx1

81

0

0

Stx2

81

0

0

EAST1

81

38

46.91 (35.7-58.3)

eaeA

81

12

14.81 (7.9-24.4)

irp2

81

44

54.32 (42.9-65.4)

ETT2

81

56

69.14 (57.9-78.9)

ompA

81

73

90.12 (81.5-95.6)

 

Mouse lethality assay

To assess the lethality of the E. coli isolates, a mouse subcutaneous-infection model was used. This model included 81 group, every group includes three treatments (standard strain C83907: killed all mice by 7 days postchallenge; negative control: no mice was killed by 7 days postchallenge; E.coli: under test), all mice were injected standardized bacterial inoculum (109 cfu/mL log-phase bacteria in 0.2 mL Ringer solution) subcutaneously, in the abdomen. In this model, lethality is a clear-cut parameter; when the sample and the positive control was killer, meanwhile the negative control was not killer, it is classified as killer (high virulence); the positive control was killer, the sample was pathopoiesia but not lead to die and the negative control was not killer, it is classified as moderate virulence; the positive control was killer but the sample and the negative control was not killer, it was established as non-killers (avirulence) (Picard et al., 1999), otherwise invalidation.

 

 

Results

Isolation, culturing and identification of E.coli

A total of 81 isolates were identified from 83 fresh fecal samples with white score diarrhea and the isolation rate of E. coli was 97.59%.

Virulence associated factor

In this study, 1(1.23%) and 34(41.98%) isolates were positive for E. coli adherence factor K88 and CS31A gene, while afaE-8 was negative; meanwhile 10(12.35%), 16(19.75%) and 38(46.91%) isolates were positive for toxins estA, estB and EAST1 genes, respectively, while Stxl and Stx2 were test negative; 12(14.81%), 44(54.32%) and 56(69.14%) isolates were positive for pathogenicity island eaeA, irp2 and ETT2 genes, respectively; while 73 (90.12%) isolates were positive for outer membrane protein ompA genes (Fig. 1).

The detection also showed that the distribution of toxin and adhesion factor is variable in 81 strains of E. coli, some strains having at least two adhesion factor or two virulence genes. But there were some E. coli that did not detect any adhesion factor or any virulence genes.

Serotyping antisera against ‘O’ antigens

The test showed that the main sero-types of O8, O64, O138, O157, O139 and O141 were 15(18.52%), 12(14.81%), 10(12.35%), 9(11.11%), 7(8.64%) and 7(8.64%), respectively, accounting for 60(74.07%) of all strains. The positive of O115, O161, O125, O9, O145 and O45 were very low which account for 4(4.94%), 3(3.70%), 3(3.70%), 1(1.23%), 1(1.23%) and 1(1.23%), respectively. The 8(9.88%) strains sero-types were not sure (Fig. 2).

Mouse lethality assay

Mouse subcutaneous–infection model revealed that 45(55.56%) of the isolates were “killers”, 20(24.69%) were pathopoiesia but not lead to die and 16(19.75%) of the mouse do not have any symptom, and all the 45 killer isolates were positive for virulence genes.

 

 

Discussion

 

Infectious diseases have been serious threat for animal health and productivity in developing countries (Elhaig et al., 2016; Qayyum et al., 2016; Wen et al., 2016; Yilmaz et al., 2016). E. coli is the most common commensal bacterial etiologic agent of colibacillosis. The virulence genes pathogenic E. coli mainly include adhesin, enterotoxin, shiga toxin and virulence island; at first, the fimbriae of adhesin will adhere to intestinal epithelial cells and then secrete one or more than one kind of enterotoxin to make the electrolyte balance changed or injure the intra-intestinal blood vessels to cause disease or recessive infection (Imberechts et al., 1992).

This study showed that the virulence genes were ETT2, irp2 and eaeA in E. coli which were isolated from Tibetan piglets with white score diarrhea. Among these virulence genes, Osawa et al. (2006) had proved that ETT2 is one of the important virulence genes which cause diarrhea, it not only has close relation with ETEC/STEC, but also widely exist in other pathogenic E. coli; in addition, eaeA can adhere to the intestinal epithelial cell, causing diarrhea and only detection of irp2 gene level can be used as an indicator of the possible pathogenic capability of E. coli. Irp2 is the iron regulatory gene which only express in pathogenic E. coli, the level of irp2 gene can be used as an indicator of the pathogenic capability of E. coli. CS31A is the fimbriae protein in E. coli which can also adhere to the intestinal epithelial cells, playing a big role in the pathogenic process. ompA makes permeability for outer membrane and maintain the stability of outer membrane structure. The highest prevalence of ompA is in complete agreement with the findings of Ashraf et al. (2014) in humans and chickens. In aggrement to our results another researcher Hariharan et al. (2004), who found the same prevalence of E. coli virulence associated genes in piglets with diarrhea and suggested the presence of association between virulence genes and cases of diarrhea.

Some serotype are also related to the pathogenicity in E. coli, such as O101, O147, O139, O157, O141 and O149, etc. (Garabal et al., 1996; Ojeniyi et al., 1994). Now immunization is the main way to prevent the E. coli disease, due to more serotype, complexity of antigen and the high variability characteristics in E. coli, moreover, serotype exist certain differences in different areas, it brings much difficulties to the prevention and control of the E. coli diseases.

The prevention and control of E. coli diarrhea except testing the distribution of the main virulence factors, survey superiority serotype in order to choose appropriate vaccine is also indispensable in the region. The study showed that the advantage of serotype in Tibetan piglets with white score diarrhea were O8, O64, O138, O157, O139 and O141 which was same with most parts of China (Sun et al., 2004). However, some research showed the different results (Li et al., 2000), the probable reason may be that these serotypes are relatively popular in Tibet or the number of samples tested were small which can’t represent the entire area on serum type characteristics in Tibetan pigs, and need further research.

Tibetan pig is widely known for its tolerance to disease and strong adaptability to the harsh Tibetan environment of low oxygen levels and changeable temperatures (Li et al., 2005). But this research has showed that there are still many piglets with the E. coli disease, the main reasons might be that management does not reach the designated position, weak consciousness of prevention and controling disease in local farmers and herdsmen or the high altitude and large temperature difference between day and night, which can easily drop the immunity level of piglets, causing the occurrence of E. coli disease. In addition, the soil and water contaminated by the feces in the environment is the important reason that lead to the diarrhea; moreover, nutritional factors, sanitary conditions and environmental factors can also lead to this condition. In this region free grazing and feeding systems are adopted therefore, more liquidity among pigs thus increases the spreading opportunity for E. coli diseases (Johanna et al., 2014).

It is suggested that, so herein we suggest some measures should be taken prevent and control the E. coli infection. Initially, it is important to improve the management of swine breeding to decrease spread of disease from direct contact between healthy and diarrhea pigs. Furthermore, regular disinfection is necessary to use for piggery and isolation of infected pigs correspondingly during outbreak of disease. Lastly, authorities should set a strict policy for the prevention and control of disease to spread from one place to another.

 

Acknowledgment

 

This study was supported by Key Science Fund of Science and Technology Agency of Tibet Autonomous Region, Twelfth Five-Year National Science and Technology Support Project (Grant No. 2012BAD3B03).

 

Statement of conflict of interest

Authors have declared no conflict of interest.

 

References

 

Agin, T.S. and Wolf, M.K., 1997. Identification of a family of intimins common to Escherichia coli causing attaching-effacing lesions in rabbits, humans, and swine, Infect. Immun., 65: 320-326.

Ashraf, A., Abd, E.T., Ahmed, M.A.A., Samir, A.E.A.A., Fatma, E.H.I. and Emad, E.M.E.A., 2014. Detection of some virulence genes of avian pathogenic E. coli by polymerase chain reaction. Benha. Vet. Med. J., 26: 159-176.

Ciosek, D., 1970. Antigen properties of extracts obtained from e.coli serotypes pathogenic for poultry. Bull. Vet. Inst. Pulawy, 13: 1-8.

Contrepois, M., Fairbrother, J.M. and Kaura, Y.K., 1989. Prevalence of CS31A and F165 surface antigens in Escherichia coli isolates from animals in France, Canada and India. FEMS Microbiol. Lett., 50: 319-323. https://doi.org/10.1111/j.1574-6968.1989.tb03132.x

Cray, W.J. and Moon, H.W., 1995. Experimental infection of calves and adult cattle with Escherichia coli 0157:H7. Appl. environ. Microbiol., 61: 1586-1590.

Edwards, P.R. and Ewing, W.H., 1972. Identification of Enterobacteriaceae. Emerg. Infect. Dis., 12: 154-159.

Elhaig, M.M., Selim, A., Mahmoud, M.M. and El-Gayar, E.K., 2016. Molecular confirmation of Trypanosoma evansi and Babesia bigemina in cattle from Lower Egypt. Pak. Vet. J., 36: 409-414.

Er, D.K., Dundar, D., Uzuner, H., and Osmani, A., 2015. Relationship between phylogenetic groups, antibiotic resistance and patient characteristics in terms of adhesin genes in cystitis and pyelonephritis isolates of Escherichia coli. Microb. Pathog., 89: 188-194. https://doi.org/10.1016/j.micpath.2015.10.014

Garabal, J.I., Gonzalez, E.A., Vazquez, F., Blanco, J., Blanco, M. and Blanco, J.E., 1996. Serogroups of E. coli isolated from piglets in Spain. Vet. Microbiol., 48: 113-123. https://doi.org/10.1016/0378-1135(95)00150-6

Gibbs, P.S., Petermann, S.R. and Wooley, R.E., 2004. Comparison of several challenge models for studies in avian colibacillosis. Avian Dis., 48: 751-758. https://doi.org/10.1637/7176-030404R

Gyles, C.L., 1992. Escherichia coli cytotoxins and enterotoxins. Can. J. Microbiol., 38: 734-746. https://doi.org/10.1139/m92-120

Hariharan, H., Coles, M., Poole, D. and Page, R., 2004. Antibiotic resistance among enterotoxigenic Escherichia coli from piglets and calves with diarrhea. Can.Vet. J., 45: 605-606.

Imberechts, H., De, G.H. and Lintermans, P., 1992. The pathogenesis of edema disease in pigs. Vet. Microbiol., 31: 221-223. https://doi.org/10.1016/0378-1135(92)90080-D

Johanna, H., Katja, H., Cornelia, F., Christiane, V.M., Maria, H., Bettina, S., Anika, F., Uwe, R., Roswitha, M. and Lothar, K., 2014. Prevalence and potential risk factors for the occurrence of cefotaxime resistant Escherichia coli in German fattening pig farms-A cross-sectional study. Prev. Vet. Med., 116: 129-137. https://doi.org/10.1016/j.prevetmed.2014.06.014

Kaper, J.B., Nataro, J.P. and Mobley, H.L., 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol., 2: 123–140. https://doi.org/10.1038/nrmicro818

Li, H., Gao, R., Wu, M., Wang, L.H. and Fu, M.L., 2005. Molecular cloning and expression of IL2 cDNA from the Tibet pig. Vet. Res. Commun., 29: 395-405. https://doi.org/10.1007/s11259-005-9141-1

Li, P., Wu, D.F., Liu, K.Y., Suolang, S.Z., He, T., Liu, X., Wu, C.M., Wang, Y. and Lin, D.G., 2014. Investigation of antimicrobial resistance in Escherichia coli and enterococci isolated from Tibetan pigs. PLoS One, 9: e95623. https://doi.org/10.1371/journal.pone.0095623

Li, R.R., Li, K., Wang, X.Q., Luo, H.Q., Qiu, G., Zhang, H., Lan, Y.F. and Li, J.K., 2017. Seroprevalence of Toxoplasma gondii infection in Tibetan pigs in Nyingchi, Tibet, China. Pak. J. Zool., 49: 383-385.

Li, S.L., Tao, Y. and Wang, H.Y., 2000. Serotypes of pathogenic E. coli in the large-scale pig farm. Southw. China J. agric. Sci., 13: 74-75.

Nagy, B. and Fekete, P.Z., 1999. Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet. Res., 30: 259-284.

Ojeniyi, B., Ahrens, P. and Meyling, A., 1994. Detection of fimbrial and toxin genes in Escherichia coli and their prevalence in piglets with diarrhoea. The application of colony hybridization assay, polymerase chain reaction and phenotypic assays. J. Vet. Med., 41: 49-59. https://doi.org/10.1111/j.1439-0450.1994.tb00205.x

Osawa, K., Shibata, M. and Nishiyama, Y., 2006. Identification of the ETT2 locus in human diarrheagenic Escherichia coli by multiplex PCR. J. Infect. Chemother., 12: 157-159. https://doi.org/10.1007/s10156-006-0435-1

Picard, B., Garcia, J.S., Gouriou, S., Duriez, P., Brahimi, N., Bingen, E., Elion, J. and Denamur, E., 1999. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect. Immun., 67: 546-53.

Qayyum, A., Khan, J.A., Hussain, R., Avais, M., Ahmad, N., and Khan, M.S., 2016. Investigation of milk and blood serum biochemical profile as an indicator of sub-clinical mastitis in Cholistani cattle. Pak. Vet. J., 36: 275-279.

Sun, G.L., Sun, G., Li, S.H., Wei, P., Guo, Z.L. and Yang, B., 2004. Epidemiology of serotypes of colibacillosis in the large scale pig farm in Heilongjiang Province. Heilongjiang Anim. Sci. Vet. Med., 32: 90-91.

Wang, X., Heazlewood, S.P., Krause, D.O. and Florin, T.H.J., 2003. Molecular characterization of the microbial species that colonize human ileal and colonic mucosa by using 16s rDNA sequence analysis. J. Appl. Microbiol., 95: 508-520. https://doi.org/10.1046/j.1365-2672.2003.02005.x

Wen, X.B., Jiang, H.T., Zhang, Y.L., Lang, X.Y., Liu, J. and Ni, H.B., 2016. Rapid and sensitive diagnosis of cattle anaplasmosis by loop-mediated isothermal amplification (LAMP). Pak. Vet. J., 36: 174-178.

Yilmaz, R., Cangul, I.T., Onat, K., Akkoc, A., Ozyigit, M.O. and Akdesir, E., 2016. Histopathological, immune-histochemical and bacteriological characterization of Mycoplasma bovis pneumonia in cattle. Pak. Vet. J., 36: 316-321.

Zhang, H., Rehman, M.U., Li, K., Luo, H., Lan, Y., Nabi, F., Shahzad, M., Huang, S., Liu, X., Mehmood, K., Iqbal, M.K. and Li, J., 2017a. Antimicrobial resistance of Escherichia coli isolated from Tibetan piglets suffering from white score diarrhea. Pak. Vet. J., 37: 43-46.

Zhang, H., Luo, H., Rehman, M.U., Nabi, F., Li, K., Lan, Y., Huang, S., Zhang, L., Mehmood, K., Shahzad, M. and Li, J., 2017b. Evidence of JEV in Culex tritaeniorhynchus and pigs from high altitude regions of Tibet, China. J. Vector Borne Dis., 54: 69-73.

Zhang, H., Wang, Y.J., Li, K., Mujeeb, U.R., Fazul, N., Gui, R., Lan, Y.F. and Luo, H.Q., 2017c. Sero-prevalence and pathological examination of lymphoid leukosis virus subgroup a in chickens in Anhui province, China. Pak. J. Zool., 49: 1033-1037.

Zhang, W., Zhao, M. and Ruesch, L., 2007. Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US. Vet. Microbiol., 123: 145-152. https://doi.org/10.1016/j.vetmic.2007.02.018

Zhang, Y.X., Han, X.G., Zuo, S.K., Gong, J.S., Han, Y., Fan, G.B., Wang, S.H., Tian, M.X., Ding, C., Qi, K.Z. and Yu, S.Q., 2015. Distribution of lipopolysaccharide core type in avian pathogenic Escherichia coli and its correlation with virulence gene. Microbiol. China, 42: 1619-1625.

Zhou, Z., Ogasawara, J., Nishikawa, Y., Seto, Y., Helander, A., Hase, A., Iritani, N., Nakamura, H., Arikawa, K., Kai, A., Kamata, Y., Hoshi, H. and Haruki, K., 2002. An outbreak of gastroenteritis in Osaka, Japan due to Escherichia coli serogroup O166:H15 that had a coding gene for enteroaggregative E. coli heat-stable enterotoxin 1 (EAST1). Epidemiol. Infect., 128: 363-371. https://doi.org/10.1017/S0950268802006994