The Predicted Target Genes of miR-122/449a Validation and Effects on Sertoli Cells Proliferation
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
1Jilin Academy of Agricultural Sciences, Xixinghua Road 186, Gongzhuling 136100, China
2Agricultural College, Guangdong Ocean University, Zhanjiang 524088, China
ABSTRACT
MiRNAs are known as small, non-coding and single stranded RNAs which can regulate cell proliferation, differentiation, apoptosis, and involve in the development of sperm. Meanwhile, DUSP4, PDK4 and FKBP1B were also found to participate in testis development and spermatogenesis. In this study, online software and luciferase reporter gene system were used to predict and verify the target relationship between miR-122 and DUSP4/PDK4, miR-449a and FKBP1B. Thereafter, comparison analysis was done on miR-122, miR-449a, DUSP4, PDK4 and FKBP1B mRNA expression levels in different bull testes tissues (1-day, 12-months-old and 24-months-old). In addition, genes mRNA and protein levels were detected after bull testicular Sertoli cells were transfected with miR-122 and miR-449a. Meanwhile, DUSP4, PDK4 and FKBP1B overexpression experiments were conducted. Eventually, MTT assay was performed to observe the cells proliferation. The results showed that miR-122 and miR-449a were highly-expressed in testis tissues (p<0.01). The expression levels of miR-122 and miR-449a in the 24-month-old testes were higher than those in the neonatal and 12-month-old groups during the testicular maturation process, however, PDK4, DUSP4 and FKBP1B expression levels were decreased (p<0.01). Furthermore, the luciferase in miR-122/449a co-transfected with pmiR-RB-REPORT-DUSP4-WT or pmiR-RB-REPORT-PDK4/FKBP1B-WT group was significantly lower than pmiR-RB-REPORT-DUSP4-mut or PDK4/FKBP1B-mut and negative control groups. Meanwhile, PDK4, DUSP4 and FKBP1B expression levels were down-regulated due to miR-122 and miR-449a overexpression (p<0.01). Moreover, cells proliferation ability was activated after DUSP4, PDK4 and FKBP1B overexpression (p<0.01). Finally, MTT assay results demonstrated that miR-122 or miR-449a could promote bull testicular Sertoli cells proliferation. Collectively, these data suggested that miR-122/PDK4/DUSP4 and miR-449a/FKBP1B pathways could play a vital role in bull testis development.
Article Information
Received 05 May 2017
Revised 14 August 2017
Accepted 27 September 2017
Available online 12 January 2018
Authors’ Contribution
ZZ and YZ designed the study. LQ and GZ executed the experimental work and wrote the article. CZ and JW analyzed the data.
Key words
MiR-122, MiR-449a, Target genes, Sertoli cells, Cell proliferation.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.1.273.281
* Corresponding authors: [email protected];
0030-9923/2018/0001-0273 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introduction
Sertoli cells (SCs) play a vital role in spermatogenesis by providing support and nutrition for spermatogonia cells. During spermatogenesis, lactate is the preferred substrate of spermatocytes and spermatids. Lactate production from glucose in SCs is an important point for the control of spermatogenesis (Rato et al., 2012). SCs also secrete proteins and cytokines, which participate in the control of sperm movement from the testis to the epididymis and in the control of the pH of the seminiferous fluid (Oliveira et al., 2009). Furthermore, adjacent SCs form the blood-testis barrier, which inhibits the entry of molecules exceeding 1000 Da into the seminiferous tubule. This barrier also prevents autoimmunity and maintains a stable microenvironment for germ cell differentiation (Smith and Braun, 2012). The data show that SCs have the support, protection and nutrition effects on the germ cells, which is closely related to spermatogenesis.
MicroRNAs play a regulatory role in a variety of biological processes, such as breast development, milk secretion (Liao et al., 2010; Na et al., 2015), diabetic nephropathy development (Chen et al., 2014), lipid metabolism (Peng et al., 2016), testicular development and spermatogenesis (Zhang et al., 2015). Recently, researchers have found that miRNAs were widely involved in the regulation of male animal reproductive performance. The mitoferrin in the testes of Batcorder dorsalis could be regulated by miR-8-3p (Tariq et al., 2016). Down-regulation of miR-320a/ 383-sponge-like long non-coding RNA NLC1-C (narcolepsy candidate-region 1 genes) was associated with male infertility and was confirmed to promote testicular embryonic carcinoma cell proliferation (Lu et al., 2015). In addition, miR-122 and miR-449a are two important factors in the development of sperm. PTEN, PI3K/AKT and STAT signaling pathways were found to be involved in bull sperm cells apoptosis and this process was affected by miR-122 dysregulation (Capra et al., 2017). Meanwhile, miR-449a, miR-34c-5p and miR-122 could be used as biomarkers of germ cell maturation (Abu-Halima et al., 2014; Munoz et al., 2015), and miR-449a/b/c were essential for normal spermatogenesis and male fertility (Yuan et al., 2015). Furthermore, the deletion of miR-34bc and miR-449 might led to a mice sterility (Comazzetto et al., 2014).
DUSP4 was an early response gene (Hirsch and Stork, 1997; Robinson et al., 2001; Amit et al., 2007) and its overexpression caused an inhibition of GC cell viability, invasive potential and proliferation (Mazumdar et al., 2016; Zhang et al., 2016). Meanwhile, PDK4 was confirmed to participate in lactate production of SCs and this process was associated with spermatogenesis and male fertility (Regueira et al., 2015). In addition, FKBP1B, a member of the peptidyl-prolyl isomerase family, was widely expressed in many types of cells and FKBP1B function inhibition could cause a Ca2+ dysregulation (Gant et al., 2014). However, substantial amounts of Ca2+ were required during testicular development and spermatogenesis. In summary, DUSP4, PDK4 and FKBP1B might participate in bovine testis development and spermatogenesis.
In this study, comparative analysis of miR-122 and miR-449a expression levels in different tissues was conducted. Thereafter, differentially expressed miR-122, miR-449a, DUSP4, PDK4 and FKBP1B were detected in 1-day, 12-months-old and 24-months-old bull testes tissues. Meanwhile, the target relationship were verified and the effects of miR-122 or miR-449a on bull testicular SCs proliferation were examined. It should be helpful for further studies of the role of miR-122, miR-449a and the target genes in the regulation of bull testis development and spermatogenesis.
Materials and methods
Experimental samples and cell line
A total of 9 testicular tissues (3 for 1-day, 3 for 12-months-old and 3 for 24-months-old) were collected from the Agricultural Science Academy of Jilin Province cattle farm. All experimental protocols were approved by Animal Ethics Committee of Agricultural Science Academy of Jilin Province. The bull testis cell line was purchased from the Gaining biology company (Shanghai, China).
RNA extraction and quality analysis
Total RNA was extracted from the collected tissues using trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. The RNA concentration and integrity were detected using the agarose gel electrophoresis and spectrophotometer (Thermo Fisher Scientific, Waltham, America).
QPCR analysis of miRNAs and target genes
Total RNA was extracted from the collected testis tissues using trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. Then the cDNA was synthesized by reverse transcription Kits (Takara, Dalian, China) according to the instruction. Primers of miRNAs and target genes were designed for qPCR according to the genes sequence (Table I). The 20μL qPCR reaction mixture including cDNA (2μL), SYBR Green I (Takara, Dalian, China) (10μL), PCR-F-Primer (0.5μL), PCR-R-Primer (0.5μL) and RNase-free H2O (7µL). The reaction was performed with following procedure: 95°C for 30s; 40 cycles of 95°C for 5s and 60°C for 30s. The expression results of miRNAs and genes were detected by Eppendorf AG-5341 fluorescence quantitative instrument and the data were analyzed using SPSS 22.0 software through 2-ΔΔCT method according to the following formula:
ΔΔCt=
[Ct(positive)-Ct(reference)]-[Ct(control)-Ct(reference)]
Here, 2-ΔΔCt refers to the relative expression ratio.
Table I.- The primer sequence of Real-time PCR.
| Primer name | Primer sequence (5′–3′) |
| miR-122 |
RT: GTCGTATCCAGTGCAGGGTCCGA GGTGCACTGGATACGACCAAACAC |
| F: TGCGGTGGAGTGTGACAATGGT | |
| R: CAGTGCAGGGTCCGAGGT | |
| miR-449a |
RT: GTCGTATCCAGTGCAGGGTCCGA GGTGCACTGGATACGACACCAGCT |
|
F: TGCGGTGGCAGTGTATTGTTAG |
|
| R: CAGTGCAGGGTCCGAGGT | |
| U6 | RT: CGCTTCACGAATTTGCGTGTCATD |
| F: GCTTCGGCAGCACATATACTAAAAT | |
| R: CAGTGCAGGGTCCGAGGT | |
| PDK4 | F: TGTTCCATCTCACCTTCACCAT |
| R: ACACCACCTCCTCTGTCTGA | |
| DUSP4 | F: TATTCCGCCGTCATCGTCTA |
| R: AGAACCTCTCATAGCCACCTT | |
| FKBP1B | F: ACAGGAAGTCATCAAGGGTT |
| R: 5GAGCAGCTCCACGTCAAA | |
| GAPDH | F: GTTTGTGATGGGCGTGAAC |
| R: ATGGACCTGGGTCATGAGT |
RT, reverse transcription; F, forward; R, reverse.
Western blot analyzes
Total protein was extracted using RIPA buffer (Boster, Wuhan, China) following the manufacturer’s instructions. Protein concentration was determined using the BCA Protein Assay Kit (Boster, Wuhan, China). Total protein (35 µg per sample) was resolved by SDS-PAGE and transferred onto PVDF membrane (Bio-Red Laboratories Inc., USA). Immunoblotting was conducted using the following primary antibodies with the suggested dilutions from the manufacturer: anti-DUSP4 (Abcam, USA); anti-PDK4 (Abcam, USA); anti-FKBP1B (Abcam, USA); anti-β-actin (Abcam, USA). The antibodies were diluted with 5% BSA (Albumin from bovine serum) and the suggested dilutions were 1:2000. The immunoblots were developed using an ECL Advanced Western Blotting Detection Kit (Invitrogen, USA).
Cell culture and transfection
Bull testicular SCs were purchased from the Gaining biology company. MiR-122 mimics/inhibitor, miR-449a mimics/inhibitor, pmiR-RB-REPORT-DUSP4/PDK4/FKBP1B-WT, pmiR-RB-REPORT-DUSP4/PDK4/FKBP1B-mut and miR-shNC were synthesized by Guangzhou Ribo-Bio company. PBI-CMV3-DUSP4, PBI-CMV3-PDK4, PBI-CMV3-FKBP1B and PBI-CMV3-Si plasmids were synthesized by GENEWIZ in China. 24 h before transfection, the SCs were plated at a concentration of approximately 1×106/well into six-well culture plates with DMEM/F12 (GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; PAA, Pasching, Austria) and 1% Penicillin-Streptomycin. The DMEM/F12 medium was replaced by Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) when the cell fusion level reached more than 80%. For luciferase activity detection, 250 µL Opti-MEM serum-free medium (GIBCO, Grand Island, NY, USA) was mixed with 6 µL lipofectamineTM2000 (Invitrogen, USA), 1.8 µg mimics and 1.8µg recombinant plasmid pmiR-RB-REPORT-genes-mut vector or pmiR-RB-REPORT-genes-WT vector, and the transfection mixture was added to each well containing the cells in Opti-MEM serum-free medium after incubation at room temperature for 30 min. The medium was changed to regular cell culture medium after 3-5 h. 24 h after transfection, luciferase activities were detected by multimode reader (PerkinElmer, USA). RNA and protein were extracted. To validate the miR-122 or miR-449a effects on target gene and SCs, 250 µL Opti-MEM serum-free medium was mixed with 6µL lipofectamineTM2000 and 1.8µg mimics, inhibitor or miR-shNC. To investigate the effects of the target genes on SCs, 1.8µg PBI-CMV3-DUSP4, PBI-CMV3-PDK4, PBI-CMV3-FKBP1B and PBI-CMV3-Si plasmids were respectively transfected into cells using LipofectamineTM2000 according to the manufacturer’s instructions.
Bioinformatics analysis and dual luciferase reporter gene system validation
Four bioinformatics software (microRNA.org, miRDB, miRGen, TargetScan) were used to predict the target genes of miR-122 and miR-449a. The luciferase reporter gene system was used to validate the relationship between miR-122, miR-449a and their target genes according to the instructions. The fold change and P-values were calculated and the differential expression was considered true when |log2Ratio| ≥ 1 and P-value ≤ 0.05.
Cell proliferation assay
Bull testicular SCs were respectively transfected with miR-12 mimics/inhibitor, miR-449a mimics/inhibitor and miR-shNC. Then the cells (3×104 cells/well) were cultured in 96-well plates for 72 h. Cell proliferation was examined using an MTT assay according to the manufacturer’s instructions (Sigma, Germany) at 0, 12, 24, 36, 48 and 72 h after transfection. The absorbance was recorded at 450 nm using a microplate spectrophotometer (ACTGene, USA).
Statistical analysis
The data were analyzed using one-way analysis of variance (ANOVA) and independent-samples T test of SPSS 22.0 software. The means and standard deviation were calculated and p<0.05 was considered as a significant difference.
Results
MiR-122 and miR-449a binding sites existed in 3’UTR of target genes
The target genes of the miR-122 and miR-449a were predicted by bioinformatics software (microRNA.org, miRDB, miRGen, TargetScan) based on the matching score of miR-122 and miR-449a seed sequence combined with target sites in genes 3’UTR region. Among all the potential genes, PDK4, DUSP4 and FKBP1B were selected for further verification (Fig. 1A).
Luciferase activities in the group co-transfected with miR-122 and wild-type DUSP4/PDK4 vectors were significantly lower than the group co-transfected with miR-122+mut/Si vector (p<0.01). Meanwhile, the similar expression profile was also observed between miR-449a and FKBP1B (p<0.01) (Fig. 1B). The results above indicated that there was a target relationship between miR-122 with PDK4/DUSP4, and FKBP1B was target gene of miR-449a.
Differential expression of miR-122/449a and target genes in diversities developmental stages of testes tissues
Results showed that miR-122 and miR-449a expression levels were higher in 24-months-old bull testis (p<0.01, Fig. 2A). The mRNA levels result of PDK4, DUSP4 and FKBP1B genes in testicular tissues showed that the expressions of PDK4, DUSP4 and FKBP1B gene in neonatal group were significantly higher than 24-months-old group (p<0.01, Fig. 2B). These results revealed that miR-122 and miR-449a might, respectively, inhibit the mRNA expressions of PDK4/DUSP4 and FKBP1B gene.
MiR-122 and miR-449a efficiently suppressed DUSP4/PDK4 and FKBP1B, respectively
As shown in Figure 3, the following conclusions could be drawn: the expressions of DUSP4/PDK4 and FKBP1B mRNA and protein were inhibited due to a high expression of miR-122/449a (p<0.01), whereas DUSP4/PDK4 and FKBP1B levels were increased when miR-122/449a was suppressed (p<0.01). The results further demonstrated that DUSP4/PDK4 and FKBP1B were the targets of miR-122 and miR-449a.
The SCs proliferation was inhibited by DUSP4, PDK4 or FKBP1B
As shown in Figure 4A and B, DUSP4, PDK4 or FKBP1B has been successfully transfected into SCs. Compared with the control group (PBI-CMV3-Si), DUSP4, PDK4 or FKBP1B was significantly higher in recombinant plasmid transfection group (p<0.01). And higher expression of DUSP4, PDK4 or FKBP1B could attenuate cell proliferation (p<0.01, Fig. 4C).
The SCs proliferation was promoted via miR-122/PDK4/DUSP4 and miR-449a/FKBP1B pathways
Bull testicular SCs were transfected with miR-122 mimics/inhibitor, miR-449a mimics/inhibitor and miR-shNC. MTT assay was performed to observe the cells proliferation. The cell proliferation ability increased in cells that transfected miR-122 mimics/miR-449a mimics. The results demonstrated that miR-122 or miR-449a could promote bull testicular cells proliferation (Fig. 5).
Discussion
MiRNAs have been demonstrated to be involved in reproduction process (Eisenberg et al., 2015; Xie et al., 2016). Previous studies have shown that miR-122 was preferentially expressed in male late-stage germ-cells (Yu et al., 2005) and miR-449 families were enriched in testis and localized to spermatocytes and spermatids (Bao et al., 2012). In this study, miR-122 was found to target PDK4 and DUSP4. The PDK4 protein located in mitochondria and inhibiting the catalyzing function of pyruvate dehydrogenase (PDH) (Grassian et al., 2011). In testicular tissue, the testis-specific pyruvate dehydrogenase complex, PDH2, has been proved to participate in sperm cells cytopoiesis and PDK4 low activity ensured the energy supplement (Korotchkina et al., 2006). Meanwhile, PDK families could disrupt the spindle morphology or promote meiotic maturation (Hou et al., 2015). The DUSP4 protein was essential in the process of endoderm generating spermatogonium or oogonium (Brown et al., 2008). In sperm cells, DUSP4 protein was mainly found in the tail of spermatozoa (Gonzalez-Fernandez et al., 2009). On the other hand, there was a target relationship between miR-449a and FKBP1B. However, the protein function was still unclear. In addition, the immunophilins FKBP family was known to be involved in meiosis, calcium homeostasis, clathrin-coated vesicles, and membrane fusions (Raudsepp et al., 2012). Several members of FKBP families such as FKBP23 mRNA was expressed strongly in mouse testis (Nakamura et al., 1998), FKBP38 accumulation phenomenon was detected in Cashmere goat testis (Zheng et al., 2012) and FKBP-like proteins were specific expressed in human testis (Sunnotel et al., 2010). These evidences indicated that FKBP family played important roles in testis development. In our results, The SCs was inhibited by DUSP4, PDK4 or FKBP1B overexpression. Indicating that DUSP4, PDK4 or FKBP1B could involve in spermatogenesis.
The comparison analysis was done on miR-122, miR-449a, DUSP4, PDK4 and FKBP1B expression levels in 1-day, 12-months-old and 24-months-old bull testes tissues. The results showed that the expression levels of miR-122 and miR-449a in the 24-month-old testes were higher than those in the neonatal and 12-month-old groups during the testicular maturation process, however, PDK4, DUSP4 and FKBP1B expression levels were decreased (p<0.01). The target relationship was verified in tissues level. These findings suggested that miR-122, miR-449a, PDK4, DUSP4 and FKBP1B might be involved in testicular development and spermatogenesis.
The effects of miR-122 and miR-449a on bull testicular SCs were further detected. The results showed that PDK4/DUSP4 and FKBP1B expression levels were down-regulated respectively by miR-122 and miR-449a in bull testicular SCs and the cell proliferation was promoted by miR-122 and miR-449a. Therefore, we speculate that miR-122/PDK4/DUSP4 and miR-449a/FKBP1B pathways may play a significant role in bull reproductive performance.
Conclusions
In conclusion, meanwhile, PDK4 and DUSP4 were the target genes of miR-122, FKBP1B was the target gene of miR-449a. The bull testicular SCs proliferation could be promoted via miR-122/PDK4/DUSP4 and miR-449a/FKBP1B pathways. Therefore, we consider that miR-122/PDK4/DUSP4 and miR-449a/FKBP1B pathways may play a vital role in bull reproductive performance.
Acknowledgments
This study was supported by a grant from the National High-Tech Research and Development Program of China (863 Program, 2013AA102505-2) and the Natural Science Foundation of Jilin Province (20160204006N Y).
Statement of conflict of interest
The authors declare that there is no conflict of interest existed.
References
Abu-Halima, M., Hammadeh, M., Backes, C., Fischer, U., Leidinger, P., Lubbad, A.M., Keller, A. and Meese, E., 2014. Panel of five micrornas as potential biomarkers for the diagnosis and assessment of male infertility. Fertil. Steril., 102: 989-997. https://doi.org/10.1016/j.fertnstert.2014.07.001
Amit, I., Citri, A., Shay, T., Lu, Y., Katz, M., Zhang, F., Tarcic, G., Siwak, D., Lahad, J., Jacob-Hirsch, J., Amariglio, N., Vaisman, N., Segal, E., Rechavi, G., Alon, U., Mills, G.B., Domany, E. and Yarden, Y., 2007. A module of negative feedback regulators defines growth factor signaling. Nat. Genet., 39: 503-512. https://doi.org/10.1038/ng1987
Bao, J., Li, D., Wang, L., Wu, J., Hu, Y., Wang, Z., Chen, Y., Cao, X., Jiang, C., Yan, W. and Xu, C., 2012. Microrna-449 and microrna-34b/c function redundantly in murine testes by targeting e2f transcription factor-retinoblastoma protein (e2f-prb) pathway. J. biol. Chem., 287: 21686-21698. https://doi.org/10.1074/jbc.M111.328054
Brown, J.L., Snir, M., Noushmehr, H., Kirby, M., Hong, S.K., Elkahloun, A.G. and Feldman, B., 2008. Transcriptional profiling of endogenous germ layer precursor cells identifies dusp4 as an essential gene in zebrafish endoderm specification. Proc. natl. Acad. Sci. U.S.A., 105: 12337-12342. https://doi.org/10.1073/pnas.0805589105
Capra, E., Turri, F., Lazzari, B., Cremonesi, P., Gliozzi, T.M., Fojadelli, I., Stella, A. and Pizzi, F., 2017. Small RNA sequencing of cryopreserved semen from single bull revealed altered mirnas and pirnas expression between high- and low-motile sperm populations. BMC Genom., 18: 14. https://doi.org/10.1186/s12864-016-3394-7
Chen, H.Y., Zhong, X., Huang, X.R., Meng, X.M., You, Y., Chung, A.C. and Lan, H.Y., 2014. Microrna-29b inhibits diabetic nephropathy in db/db mice. Mol. Ther., 22: 842-853. https://doi.org/10.1038/mt.2013.235
Comazzetto, S., di Giacomo, M., Rasmussen, K.D., Much, C., Azzi, C., Perlas, E., Morgan, M. and O’Carroll, D., 2014. Oligoasthenoteratozoospermia and infertility in mice deficient for mir-34b/c and mir-449 loci. PLoS Genet., 10: e1004597. https://doi.org/10.1371/journal.pgen.1004597
Eisenberg, I., Kotaja, N., Goldman-Wohl, D. and Imbar, T., 2015. MicroRNA in human reproduction. Adv. Exp. Med. Biol., 888: 353-387. https://doi.org/10.1007/978-3-319-22671-2_18
Gant, J.C., Blalock, E.M., Chen, K.C., Kadish, I., Porter, N.M., Norris, C.M., Thibault, O. and Landfield, P.W., 2014. Fk506-binding protein 1b/12.6: A key to aging-related hippocampal ca2+ dysregulation? Europ. J. Pharmacol., 739: 74-82. https://doi.org/10.1016/j.ejphar.2013.10.070
Gonzalez-Fernandez, L., Ortega-Ferrusola, C., Macias-Garcia, B., Salido, G.M., Pena, F.J. and Tapia, J.A., 2009. Identification of protein tyrosine phosphatases and dual-specificity phosphatases in mammalian spermatozoa and their role in sperm motility and protein tyrosine phosphorylation. Biol. Reprod., 80: 1239-1252. https://doi.org/10.1095/biolreprod.108.073486
Grassian, A.R., Metallo, C.M., Coloff, J.L., Stephanopoulos, G. and Brugge, J.S., 2011. Erk regulation of pyruvate dehydrogenase flux through pdk4 modulates cell proliferation. Genes Dev., 25: 1716-1733. https://doi.org/10.1101/gad.16771811
Hirsch, D.D. and Stork, P.J., 1997. Mitogen-activated protein kinase phosphatases inactivate stress-activated protein kinase pathways in vivo. J. biol. Chem., 272: 4568-4575. https://doi.org/10.1074/jbc.272.7.4568
Hou, X., Zhang, L., Han, L., Ge, J., Ma, R., Zhang, X., Moley, K., Sched, T. and Wang, Q., 2015. Differing roles of pyruvate dehydrogenase kinases during mouse oocyte maturation. J. Cell Sci., 128: 2319-2329. https://doi.org/10.1242/jcs.167049
Korotchkina, L.G., Sidhu, S. and Patel, M.S., 2006. Characterization of testis-specific isoenzyme of human pyruvate dehydrogenase. J. biol. Chem., 281: 9688-9696. https://doi.org/10.1074/jbc.M511481200
Liao, Y., Du, X. and Lonnerdal, B., 2010. Mir-214 regulates lactoferrin expression and pro-apoptotic function in mammary epithelial cells. J. Nutr., 140: 1552-1556. https://doi.org/10.3945/jn.110.124289
Lu, M., Tian, H., Cao, Y.X., He, X., Chen, L., Song, X., Ping, P., Huang, H. and Sun, F., 2015. Downregulation of mir-320a/383-sponge-like long non-coding RNA nlc1-c (narcolepsy candidate-region 1 genes) is associated with male infertility and promotes testicular embryonal carcinoma cell proliferation. Cell Death Dis., 6: e1960. https://doi.org/10.1038/cddis.2015.267
Mazumdar, A., Poage, G.M., Shepherd, J., Tsimelzon, A., Hartman, Z.C., Den Hollander, P., Hill, J., Zhang, Y., Chang, J., Hilsenbeck, S.G., Fuqua, S., Kent Osborne, C., Mills, G.B. and Brown, P.H., 2016. Analysis of phosphatases in er-negative breast cancers identifies dusp4 as a critical regulator of growth and invasion. Breast Cancer Res. Treat., 158: 441-454. https://doi.org/10.1007/s10549-016-3892-y
Munoz, X., Mata, A., Bassas, L. and Larriba, S., 2015. Altered mirna signature of developing germ-cells in infertile patients relates to the severity of spermatogenic failure and persists in spermatozoa. Scient. Rep., 5: 17991. https://doi.org/10.1038/srep17991
Na, R.S., Sun, W., Sun, X.W., Qiu, X.Y., Chen, L.P. and Huang, Y.F., 2015. Expressional analysis of immune-related mirnas in breast milk. Genet. Mol. Res., 14: 11371-11376. https://doi.org/10.4238/2015.September.25.4
Nakamura, T., Yabe, D., Kanazawa, N., Tashiro, K., Sasayama, S. and Honjo, T., 1998. Molecular cloning, characterization, and chromosomal localization of fkbp23, a novel fk506-binding protein with ca2+-binding ability. Genomics, 54: 89-98. https://doi.org/10.1006/geno.1998.5571
Oliveira, P.F., Sousa, M., Barros, A., Moura, T. and Rebelo da Costa, A., 2009. Intracellular ph regulation in human sertoli cells: Role of membrane transporters. Reproduction, 137: 353-359. https://doi.org/10.1530/REP-08-0363
Peng, X.P., Huang, L. and Liu, Z.H., 2016. Mirna-133a attenuates lipid accumulation via tr4-cd36 pathway in macrophages. Biochimie, 127: 79-85. https://doi.org/10.1016/j.biochi.2016.04.012
Rato, L., Alves, M.G., Socorro, S., Duarte, A.I., Cavaco, J.E. and Oliveira, P.F., 2012. Metabolic regulation is important for spermatogenesis. Nat. Rev. Urol., 9: 330-338. https://doi.org/10.1038/nrurol.2012.77
Raudsepp, T., McCue, M.E., Das, P.J., Dobson, L., Vishnoi, M., Fritz, K.L., Schaefer, R., Rendahl, A.K., Derr, J.N., Love, C.C., Varner, D.D. and Chowdhary, B.P., 2012. Genome-wide association study implicates testis-sperm specific fkbp6 as a susceptibility locus for impaired acrosome reaction in stallions. PLoS Genet., 8: e1003139. https://doi.org/10.1371/journal.pgen.1003139
Regueira, M., Artagaveytia, S.L., Galardo, M.N., Pellizzari, E.H., Cigorraga, S.B., Meroni, S.B. and Riera, M.F., 2015. Novel molecular mechanisms involved in hormonal regulation of lactate production in sertoli cells. Reproduction, 150: 311-321. https://doi.org/10.1530/REP-15-0093
Robinson, C.J., Sloss, C.M. and Plevin, R., 2001. Inactivation of jnk activity by mitogen-activated protein kinase phosphatase-2 in eahy926 endothelial cells is dependent upon agonist-specific jnk translocation to the nucleus. Cell Signal, 13: 29-41. https://doi.org/10.1016/S0898-6568(00)00121-2
Smith, B.E. and Braun, R.E., 2012. Germ cell migration across sertoli cell tight junctions. Science, 338: 798-802. https://doi.org/10.1126/science.1219969
Sunnotel, O., Hiripi, L., Lagan, K., McDaid, J.R., de Leon, J.M., Miyagawa, Y., Crowe, H., Kaluskar, S., Ward, M., Scullion, C., Campbell, A., Downes, C.S., Hirst, D., Barton, D., Mocanu, E., Tsujimura, A., Cox, M.B., Robson, T. and Walsh, C.P., 2010. Alterations in the steroid hormone receptor co-chaperone fkbpl are associated with male infertility: A case-control study. Reprod. Biol. Endocrinol., 8: 22. https://doi.org/10.1186/1477-7827-8-22
Tariq, K., Metzendorf, C., Peng, W., Sohail, S. and Zhang, H., 2016. Mir-8-3p regulates mitoferrin in the testes of bactrocera dorsalis to ensure normal spermatogenesis. Scient. Rep., 6: 22565. https://doi.org/10.1038/srep22565
Xie, R., Lin, X., Du, T., Xu, K., Shen, H., Wei, F., Hao, W., Lin, T., Lin, X., Qin, Y., Wang, H., Chen, L., Yang, S., Yang, J., Rong, X., Yao, K., Xiao, D., Jia, J. and Sun, Y., 2016. Targeted disruption of mir-17-92 impairs mouse spermatogenesis by activating mtor signaling pathway. Medicine (Baltimore), 95: e2713. https://doi.org/10.1097/MD.0000000000002713
Yu, Z., Raabe, T. and Hecht, N.B., 2005. MicroRNA mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (tnp2) messenger RNA (mRNA) by mRNA cleavage. Biol. Reprod., 73: 427-433. https://doi.org/10.1095/biolreprod.105.040998
Yuan, S., Tang, C., Zhang, Y., Wu, J., Bao, J., Zheng, H., Xu, C. and Yan, W., 2015. Mir-34b/c and mir-449a/b/c are required for spermatogenesis, but not for the first cleavage division in mice. Biol. Open, 4: 212-223. https://doi.org/10.1242/bio.201410959
Zhang, R., Wang, G., Zhang, P.F., Zhang, J., Huang, Y.X., Lu, Y.M., Da, W., Sun, Q. and Zhu, J.S., 2016. Sanguinarine inhibits growth and invasion of gastric cancer cells via regulation of the dusp4/erk pathway. J. cell. mol. Med., 21: 1117-1127. https://doi.org/10.1111/jcmm.13043
Zhang, X., Li, C., Liu, X., Lu, C., Bai, C., Zhao, Z. and Sun, B., 2015. Differential expression of mir-499 and validation of predicted target genes in the testicular tissue of swine at different developmental stages. DNA Cell Biol., 34: 464-469. https://doi.org/10.1089/dna.2014.2728
Zheng, X., Hao, X.Y., Chen, Y.H., Zhang, X., Yang, J.F., Wang, Z.G. and Liu, D.J., 2012. Molecular characterization and tissue-specific expression of a novel fkbp38 gene in the cashmere goat (Capra hircus). Asian-Australas. J. Anim. Sci., 25: 758-763. https://doi.org/10.5713/ajas.2011.11398