Canine Coronavirus (CCoV), a Neglected Pathogen: Molecular Diversity of S, M, N and 3b Genes
Iracema Nunes de Barros1,2, Luciane Dubina Pinto3, Rosely Bianca dos Santos Kuroda1, Sheila Oliveira de Souza Silva1, Leonardo José Richtzenhain1,2, Cláudio Wageck Canal3 and Paulo Eduardo Brandão1,2*
1Department of Preventive Veterinary Medicine and Animal Health, School of Veterinary Medicine, University of São Paulo, Brazil; 2Coronavirus Research Group, Brazil ; 3Laboratory of Virology, School of Veterinary Medicine, University of Rio Grande do Sul, Brazil.
Abstract |Gastroenteritis is a common infection in young dogs and is caused chiefly by canine coronavirus (CCoV) and canine parvovirus (CPV). While, CPV is considered the most important cause of diarrhea, studies have shown an increasing prevalence and importance of CCoV around the world. Fatal CCoV infections have been described, however, there is limited information on the molecular diversity of CCoV in many parts of the world. In this study, canine fecal samples from diverse States of Brazil were screened by PCRs for CCoV and positive samples were subjected to partial sequencing for the membrane (M), spike (S), nucleocapsid (N) and non-structural protein 3b genes. Out of the samples collected, 40.17% were positive for CCoV; 57.45% of CCoV-infected animals showed enteritis and most of these (76%) were younger than 3 months and unvaccinated. Distance genealogy using CCoV sequences from GenBank for M gene showed that eight strains were CCoV-II twenty-six were CCoV-I. These findings show some genetic features of CCoV in Brazil and may require future studies to elucidate full genome sequences of these isolates to better assess the disease transmission dynamics and future control strategies.
Editor | Muhammad Munir, The Pirbright Institute, UK.
Received | August 29, 2017; Accepted | October 12, 2017; Published | February 25, 2018
*Correspondence | Paulo Eduardo Brandão, Department of Preventive Veterinary Medicine and Animal Health, School of Veterinary Medicine, University of São Paulo, Av. Prof. Dr. Orlando Marques de Paiva, 87, CEP 05508 270 - Cidade Universitária São Paulo/SP Brazil; Email: [email protected]
DOI | http://dx.doi.org/10.17582/journal.hv/2017/5.1.1.6
Citation | Barros, I.N., L.D. Pinto, R.B.D.S. Kuroda, S.O.S. Silva, L.J. Richtzenhain, C.W. Canal and P.E. Brandao 2018. Canine coronavirus (CCOV), a neglected pathogen: molecular diversity of s, m, n and 3b genes. Hosts and Viruses, 5(1): 1-6.
Keywords: Canine coronavirus, enteritis, Diversity, Phylogeny
Introduction
Canine coronaviruses (CCoVs) (Nidovirales: Coronaviridae: Coronavirinae: Alphacoronavirus: Alphacoronavirus 1) are enveloped viruses with a positive-sense single-stranded RNA of 30kb. The genome consists of genes encoding the structural proteins spike (S), envelope (E), membrane (M) and nucleocapsid (N) and ORFs translated into non-structural proteins replicase polyprotein (ORF1), 3a, 3b, 3c, 7a and 7b (Decaro et al., 2015).
Two different genotypes of CCoV have been recognized, CCoV type-I, with a high identity with feline coronavirus (FCoV), and CCoV type-II, divided in two subtypes, CCoV-IIa and CCoV-IIb, the former being the pantropic type (Decaro et al., 2007; Decaro et al. 2009, Decaro 2010; Pratelli et al., 2001; Pratelli et al., 2002). The pantropic CCoV was also reported in Greece, Ireland, Japan, France, Belgium and Brazil (Ntafis et al., 2010; McEligott et al., 2011; Soma et al., 2011; Zicola et al., 2012; Pinto et al., 2014), demonstrating the widespread pattern of CCoV infection.
However, there are few studies on the frequency of CCoV in feces of dogs and little data on the molecular diversity of CCoV strains is available from any parts of the world, including Brazil. This study aimed to investigate the molecular diversity of CCoV strains based on the membrane (M), spike (S) and nucleocapsid (N) structural proteins and non-structural protein 3b amongst young dogs from Brazilian kennels.
Materials and Methods
Fecal samples and controls
A total of 117 fecal samples were collected from 2009 to 2014 from dogs with or without symptomatic enteritis, from different breeds, genders and ages, in five Brazilian States. This research is in accordance with ethical principles purposed by Bioethics Commission of the School of Veterinary Medicine and Animal Science of the University of São Paulo (protocol number # 2188/2011).
Previously characterized strain CCV 1-71 (ATCC VR 809) (104.03 TCID50/mL) was kindly provided by Biovet Laboratories, Brazil, and used as positive control for RT-PCR. As negative control, ultra-pure water treated with 0.1% diethylpyrocarbonate (DEPC water) was used.
cDNA synthesis
Fecal samples were prepared as 20% (v/v) suspensions in DEPC-treated water and clarified at 5,000 × g / 15 min at 4 ° C, taking the supernatant as a sample. Total RNA was extracted with TRIzol Reagent™ (Life Technologies) and cDNAs were synthesized with Random PrimersTM (Life Technologies) and M-MLV Reverse Transcriptase™ (Life Technologies) as per manufacturer’s instructions
Polymerase chain reaction
Partial amplification of S, 3b, M and N genes was carried out with 12.5 µL of GoTaq™ Green Master Mix (Promega), 2.5 µL of cDNA in separate reactions, and 0.5 µM of each respective primer (Table 1) in separate reactions for each gene to a final volume of 25μL.
DNA Sequencing
Amplicons of the M, S, N and 3b genes of CCoV were purified from agarose gels with GFXTM PCR DNA and GEL BAND Purification KitTM (GE Healthcare)
Table 1: Primers used for amplification and partial sequencing of the genes encoding the S, 3b, M and N proteins of canine coronavirus.
| Gene | Primers | Sequence (5´- 3´´) | References |
| M | CCV1 | TCCAGATATGTAATGTTCGG | |
| CCV2 | TCTGTTGAGTAATCACCAGCT | ||
|
S
|
EL1F | CAAGTTGACCGTCTTATTATTACTGGTAG | |
| EL1R | TCATATACGTACCATTATAGCTGAAGA | ||
| S5 | TGCATTTGTGTCTCAGACTT | ||
| S6 | CCAAGGCCATTTTACATAAG | ||
| N | CENP1 | CTCGTGGYCGGAAGAATAAT | |
| CENP2 | GCAACCCAGAMRACTCCATC | ||
| 3b | NSP3B-S | CTTGGTCTCTCTATTGTTGAAG | This study |
| NSP3B-A |
GCGTTGCGTTTAGAATGG |
and submitted to bi-directional DNA sequencing using BigDye 3.1TM (Applied Byosystems) and ABI-3500 Genetic AnalyzerTM (Applied Byosystems) as per manufacturer’s instructions.
The chromatograms obtained for each DNA strand sequences of each sample were subjected to Phred application online (http://asparagin.cenargen.embrapa.br/phph/ to evaluate the quality of the sequences). Only positions with scores higher than 20 (less than 1 % of error probability) were used and the chromatograms were also manually inspected with the program Finch TV © (©Geospiza) to search for interpretation errors and discrepancies between each sequenced DNA strand.
The CAP sequence assembly of each sequence was obtained with BioEdit version 7.2.5 and submitted to BLASTn (http://www.ncbi.nlm.nih.gov/BLAST).
Recombination analysis
For each gene, the occurrence of recombination events was assessed with the RDP method with Bonferroni correction and highest acceptable p-value of 0.05 using RDP 4 β36 (Martin et al., 2010).
Phylogenetic analyses
The final nucleotide and putative amino acids sequences M, S, N and 3b genes of CCoV were aligned with homologous sequences of Alphacoronavirus-1 retrieved from GenBank (accession numbers in Figures 1 and 2), using CLUSTAL/W application running in BioEdit v. 7.2.5.
The alignments were used to build Neighbor-Joining (NJ) nucleotide (with the Maximum Composite Likelihood model) and amino acids (with the Poisson model) trees with 1,000 bootstrap replicates using MEGA 6.0 (Tamura et al., 2013).
All sequences generated in this study were submitted in the GenBank under the accession numbers: KP322041 to KP322050 for S gene from CCoV-I; KP322051 to KP322053 for S gene from CCoV-II; KP322054 to KP322088 for M gene; KP322089 to KP322111 for N gene;
Though the 3b amplicon had an expected size of 200 bp, when the respective primers were excluded during sequence editing, sequences were below the minimum size for Genbank submission, but they are available upon request to the authors.
Results
CCoV frequency
Regarding CCoV, 40.17% (47/117) of the tested samples were positive for M gene, while 57.45% (27/47) of CCoV-positive animals showed enteritis. Most of positive animals were younger than 3 months (36/47). CCoV was detected in 54.69% (35/64) of unvaccinated animals, 33.33% (2/6) of those with complete vaccine schedule, 100% (8/8) in those with incomplete vaccine schedule, and in 5.1% (2/39) in those animals for with no vaccination data was available.
Phylogenetic analyses
Phylogenetic analysis for M gene showed that the strain of the positive control and eight strains from fecal samples were included in the same group of CCoV-II strains, and 26 other ones were included in CCoV-I group (Figure 1a).
The 3b gene tree (Figure 1b), shows that, except for the strain CCoV-II dog50 from this study, which clustered in the CCoV II cluster, one CCoV- II (CCoVII/dog 56) and all CCoV-I strains segregated in a cluster containing CCoVs type I and one FCoV serotype II (GenBank, accession numbers AY170345 (Elmo/02 strain), AY426984 (23/03 strain), and DF-2 R3i (JQ408980), respectively).
In the N gene tree (Figure 1c), though a lower resolution was found when compared to M trees, two CCoV-II strains from this study (CCoV-II/dog50 and CCoV-II/dog 56) clustered with one CCoV-II (GenBank GQ477367), with 95.8% to 97% nt and 95% to 96.2% aa identities. All CCoV-I strains of this study segregated in a unique cluster and showed 93.3% to 100% nt and 95% to 98.7% aa identities among them. For N gene, the identities among CCoV-I strains from this study and FIPV strain (NC_002306) were 80.8% - 83.7% for nt and 81.2% - 83.7% for aa.
In agreement to what was found for M gene trees, S gene phylogenetic analysis resulted in two major clusters, i.e., one for CCoV type I and another one for CCoV type II strains (Figure 2),
For S gene, the identity amongst CCoV-I strains from this study and FIPV strain (NC_002306) was 65.5% for nt and 67.3% for aa. All the CCoV-I strains from this study had 100% nt and aa identities with each other, 96.5% nt and 100% amino acid identity with CCoV-I Elmo/02 strain (AY170345), 99.3% nt and 98.9% with a CCoV-I Brazilian strain from another study (GenBank Accession number KF312719). Regarding CCoV-II, TGEV and FCoV-II from GenBank (Figure 2) the identities ranged from 64.5% to 66.5% for nt and 65.3% to 67.3% for aa for S.
On the CCoV-II S gene tree (Figure 2), CCoV-II/dog50 and CCoV-II/dog57 strains segregated in the same cluster with the Brazilian CCoV-IIa Cao4 strain (GenBank accession No. JX446572) also from Rio Grande do Sul State (Figure 2). The identity ranged from 97.8% to 98% for nt and 99% to 99.5% for aa, respectively, among them and this other Brazilian strain. Taking into account the other alphacoronaviruses included in the analysis, there was 92.8% to 94.3% nt and 92.9% to 99% aa identity amongst CCoV-II and FIPV, and TGEV). Comparing the CCoV-II strains from this study and the CCoV-I Elmo/02 strain (AY170345), nt identities were 61.8% - 62.1% and, for aa, 57.5%.
Recombination analysis
No signal of recombination for any of the four partial genes under analysis was found regarding the CCoV sequences included in the present study.
Discussion
In this study, nucleotide and amino acids diversity was assessed for all CCoV genes studied. Phylogenetic analysis for M gene showed that CCoV-I and CCoV-II segregated in different clusters. CCoV-I presented similar amino acid substitutions as a FIPV strain, what is in agreement with results reported by Pratelli et al. (2002).
However, for the S gene, same FIPV strain was closer to CCoV-II strains than CCoV-I, probably because M is highly conserved due to its role on virion assembly (Arndt et al., 2010), in opposition to the spike protein, a target for neutralizing antibodies (in which the variation of the amino acids between CCoV-I and CCoV-II can be up to 46% (Pratelli, 2006).
Difference between types I and II were clearly shown on the trees for S gene while, for N gene trees, CCoV-I and CCoV-II a lower resolution was found even when comparing to M analyses, probably because the N protein is associated with the nucleocapsid (Masters 2006) and thus of lower polymorphism. In relation to the tree for 3b gene, stable markers could be found to differentiate types I and II of CCoV.
The efficacy of the immunity provided by vaccines can be controversial with different types or subtypes of CCoV and major envelope proteins as the spike proteins are determinants of protection (Pratelli et al., 2004; Pratelli, 2007; Decaro et al., 2011). Thus, taking into account the relatively high diversity of nucleotides and amino acid among CCoV strains sequenced in this study and two CCoV vaccine strains, TN-449 (VR-2068 ATCC) and 1-71(VR-809 ATCC), one could speculate that a low cross-protection is in course among the Brazilian canine population regarding CCoV infection and disease.
As a conclusion, the nucleocapsid gene of CCoV is highly conserved among types I and type II clusters, with a lower tree resolution regarding trees based on the matrix and spike genes. Strains of types I and II show a low polymorphism for the 3b gene.
Acknowledgments
The authors are grateful to CNPq (Brazilian National Board for Scientific and Technological Development) grants# 301225/2013-3, 400604/2016-7 and 301225/2013-3 and FAPESP (São Paulo Research Foundation) grant# 2010/19399-2) and to Prof. Dr. Alessandra M. M. G Castro for valuable knowledge of primer design.
Authors Contribution
All the authors contributed equally.
Conflict of interest
The authors declare that there is no conflict of interests regarding the publication of this article.
References
Arndt, A.L., Larson, B.J., Hogue, B.G. 2010. A conserved domain in the Coronavirus Membrane protein tail is important for virus assembly. J. Virol. 84 (21): 11418-28. doi 10.1128/JVI.01131-10.
Decaro, N., Mari, V., Elia, G., Addie, D.D., Camero, M., Lucente, M. S., Martella, V., Buonavoglia, C. 2010. Recombinant canine coronaviruses in dogs, Europe. Emerg. Infect. Dis. 16 (1): 41-7. doi: 10.3201/eid1601.090726.
Decaro, N., Mari, V., Elia, G., Lanave, G., Dowgier, G., Colaianni, M. L., Martella,V., Buonavoglia, C. 2015. Full-length genome analysis of canine coronavirus type I. Virus Res. 210: 100-5. doi: 10.1016/j.virusres.2015.07.01.
Decaro, N., Mari V., Campolo, M., Lorusso, A., Camero, M., Elia, G., Martella, V., Cordioli, P., Enjuanes, L., Buonavoglia, C. 2009. Recombinant canine coronaviruses related to transmissible gastroenteritis virus of Swine are circulating in dogs. J. Virol. 83 (3): 1532-37.doi: 10.1128/JVI.01937-08.
Decaro, N., Mari, V., Sciarretta, R., Colao, V., Losurdo, M., Catella, C., Elia, G., Martella, V., Del Giudice, G., Buonavoglia, C. 2011. Immunogenicity and protective efficacy in dogs of an MF59TM-adjuvanted vaccine against recombinant canine/porcine coronavirus. Vaccine. 29 (11): 2018-23. doi: 10.1016/j.vaccine.2011.01.028.
Decaro, N., Martella, V., Elia, G., Campolo, M., Desario, C., Cirone, F., Tempesta, M., Buonavoglia, C. 2007. Molecular characterization of the virulent canine coronavirus CB/05 strain. Virus Res. 125 (1): 54-60. doi: 10.1016/j.virusres.2006.12.006.
Erles, K., Brownlie J. 2009. Sequence analysis of divergent canine coronavirus strains present in a UK dog population. Virus Res. 141(1): 21-5. doi: 10.1016/j.virusres.2008.12.009.
Martin, D. P., Murrell, B., Golden, M., Khoosal, A., Muhire, B. 2015. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. (1): vev003. eCollection 2015.doi: 10.1093/ve/vev003.
Masters PS. 2006. The molecular biology of coronaviruses. Adv. Virus Res. 66: 193-292. doi: 10.1016/S0065-3527(06)66005-3.
McElligott, S., Collins, P. J., Sleator, R. D., Martella, V., Decaro, N., Buonavoglia, C., O’shea, H. 2011. Detection and genetic characterization of canine parvoviruses and coronaviruses in southern Ireland. Archiv.Virol. 156 (3): 495-503. doi: 10.1007/s00705-010-0861-3.
Ntafis, V., Mari, V., Danika, S., Fragkiadaki, E., Buonavoglia, C. 2010. An outbreak of canine coronavirus in puppies in a Greek Kennel. J. Vet. Diagn. Invest. 22 (2): 320-3. doi: 10.1177/104063871002200231.
Pinto, L. D., Barros, I. N., Budaszewski, R. F., Weber, M. N., Mata, H., Antunes, J. R., Boabaid, F. M., Wouters, A. T., Driemeier, D., Brandão, P. E., Canal, C. W. 2014. Characterization of pantropic canine coronavirus from Brazil. Vet. J. 202 (3): 659-62. doi: 10.1016/j.tvjl.2014.09.006.
Pratelli, A. 2006. Genetic evolution of canine coronavirus and recent advances in prophylaxis. Vet. Res. 37 (2): 191-200. doi: 10.1051/vetres:2005053.
Pratelli, A. 2007. High-cell-passage canine coronavirus vaccine providing sterilising immunity. J. Small Anim. Pract. 48 (10): 574-8. doi: 10.1111/j.1748-5827.2007.00416.x.
Pratelli, A., Elia, G., Martella, V., Tinelli, A., Decaro, N., Marsilio, F., Buonavoglia, D., Tempesta, M., Buonavoglia, C. 2002. M gene evolution of canine coronavirus in naturally infected dogs.Vet. Rec. 151 (25): 758-61.
Pratelli, A., Martella, V., Elia, G., Decaro, N., Aliberti, A., Buonavoglia, D., Tempesta, M., Buonavoglia, C. 2001. Variation of the sequence in the gene encoding for transmembrane protein M of canine coronavirus (CCV). Molecul. Cell. Probes. 15 (4): 229-3.doi: 10.1006/mcpr.2001.0364.
Pratelli, A., Tempesta, M., Greco, G., Martella, V., Buonavoglia, C. 1999. Development of a nested PCR assay for the detection of canine coronavirus. J. Virol. Methods. 80 (1): 11-15.
Pratelli,A., Tinelli, A., Decaro, N., A, Martella ,V., Camero, M., Tempesta, M., Martini, M., Carmichael, L.E., Buonavoglia, C. 2004. Safety and efficacy of a modified-live canine coronavirus vaccine in dogs. Vet. Microbiol. 99 (1): 43-9. doi: 10.1016/j.vetmic.2003.07.009.
Soma, T., Ohinata, T., Ishii, H., Takahashi, T., Taharaguchi, S., Hara, M., 2011. Detection and genotyping of canine coronavirus RNA in diarrheic dogs in Japan. Res. Vet. Sci. 90 (2): 205-7. doi: 10.1016/j.rvsc.2010.05.027.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecul. Biol. Evol. 30 (12): 2725-9. doi: 10.1093/molbev/mst197.
Zicola, A., Jolly, S., Mathijs, E., Ziant, D., Decaro, N., Mari, V., Thiry, E., 2012. Fatal outbreaks in dogs associated with pantropic canine coronavirus in France and Belgium. J. Small Anim. Pract. 53 (5): 297-300.doi: 10.1111/j.1748-5827.2011.01178.x.