Single Nucleotide Polymorphism of Ovine Leptin and Insulin-Like Growth Factor 1 Gene in Kivircik Crossbred Ewes
Selçuk Kaplan1,* and Sertaç Atalay2
1Faculty of Veterinary Medicine, Department of Genetics, Namik Kemal University, Tekirdag 59100, Turkey
2Central Research Laboratory, Namik Kemal University, Tekirdag 59100, Turkey
ABSTRACT
Kivircik crossbred sheep in the Thrace region are commonly grown for meat production. The objective of the present study was to determine the polymorphism of insulin-like growth factor 1 (IGF1) and leptin (LEP) genes in Kivircik crossbred ewes. Therefore, IGF1/BfoI and Lep/BcnI polymorphisms were examined by polymerase chain reaction- restriction fragment length polymorphism method. The single nucleotide polymorphism (SNP) in the regulatory region of the IGF1 gene was detected by amplification of the 294 bp region using specific primers and cleavage with the BfoI enzyme. Allele frequencies of A and B were found with 0.915 and 0.085 respectively. The genotype frequencies of IGF1 gene were 0.85 (AA), 0.13 (AB) and 0.02 (BB). The SNP in the exon 3 of the LEP gene was detected by amplification of the 494 bp region using specific primers and cleavage with the BcnI enzyme. The estimated frequencies of three genotypes including GG, GA and AA at Lep/BcnI polymorphism were 0.90, 0.09 and 0.01 and they were 0.055 and 0.945 for A and G alleles, respectively. LEP and IGF1 gene showed polymorphic patterns in Kivircik crossbred sheep population. There was no deviation from Hardy-Weinberg equilibrium (P>0.05) relative to LEP and IGF1 genotypes.
Article Information
Received 07 November 2017
Revised 30 November 2017
Accepted 30 December 2017
Available online 06 April 2018
Authors’ Contribution
SK and SA designed the research. SA, SK conducted the experiment. SA analyzed the data. SA and SK wrote the paper. SK revised the paper.
Key words
Leptin, Insulin Like Growth Factor 1, Single nucleotide polymorphism, SNP.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.3.851.856
* Corresponding author: [email protected]
0030-9923/2018/0003-0851 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introductıon
Genetic variations that affecting the physiological pathways are of great interest because these are related with different production traits in farm animals. The development of molecular genetic techniques have accelerated the identification of variations associated with economically important traits. Moreover, molecular genetic studies can determine the genetic breeding potential by identifying genetic variants in different populations (Kök et al., 2017). Kivircik sheep breed constitutes almost fifty percent of the sheep population in Turkey. Compared to other native sheep breeds, Kivircik sheep have superior meat quality (Ekiz et al., 2009). Therefore, Kivircik sheep is especially known for the delicious taste of the meat (Özcan, 1970). Insulin-like growth factor 1 (IGF1) is a growth factor that plays important role in physiological and metabolic processes in vertebrates (De la Rosa Reyna et al., 2010). IGF1 has significant biological functions including increases the stimulating myogenesis, intake of glucose, prevents apoptosis, attend the activation of cell cycle genes, interrupts in the synthesis of DNA, protein, RNA, and in cell proliferation, enhance the synthesis of lipids and stimulating the production of progesterone in granular cells (Etherton, 2004). IGF1 gene consists of 5 exons located on chromosome 3 in the ovine genome. Although, the structure of the IGF1 gene differs between species, the 70 amino acid sequence of the expressed protein is the same in all vertebrates (Upton et al., 1998). SNPs in IGF1 gene have associated with daily live weight gain (Casas-Carrillo et al., 1997; De la Rosa Reyna et al., 2010), live weight (Zhang et al., 2008; Trukhachev et al., 2016), birth weight (Curi et al., 2005; Zhang et al., 2008) and carcass traits (Islam et al., 2009).
Previous studies have suggested that the IGF1 gene is significant marker gene for growth traits. He et al. (2012) were reported that the polymorphisms in the 5ˈ regulatory region of IGF1 gene have significant effect on growth traits. Scata et al. (2010) also detected two mutations in the 5ˈ regulatory region of ovine IGF1 gene (G855C and G857A) and one mutation (C271T) in exon 3. Allele T of C271T and haplotype G-T of G855C and C271CT had a positive effect on maintaining a constant yield level during lactation in dairy sheep. Trukachev et al. (2016) were reported that SNPs in 5’ regulatory region (5363.C>T), 5’UTR (5188.G>C, 5186.G>A) and the first intron (4088.G>A) associated with live weight. Chelongar et al. (2014) were shown that the SNP in intron 1 in IGF1 gene
Table I.- Primer’s sequences and product’s sizes.
| Gene region |
Primer sequence (5ᶦ-3ᶦ) |
Annealing temp. (°C) |
Product size (bp) |
References |
|
IGF1 5ᶦ regulatory region |
F: TGAGGGGAGCCAATTACAAAGC R: CCGGGCATGAAGACACACACAT |
55 |
294 |
|
|
Lep, Exon 3, 170.G>A |
F: TGTTGTCCCCTTCCTCCTG R: CCCACATAGGCTCTCTTCTGC |
63 |
463 |
associated with fat thickness (the tick rump). Nazari et al. (2016) were suggested that the SNP in exon 1 in the IGF1 gene could be used as a marker for birth weight.
LEP gene is involved in the control of several important physiological functions including regulation of hematopoiesis, energy expenditure, angiogenesis, wound healing, lipolysis, fetal growth and immune system function (Reicher et al., 2011). Nucleotide sequence variants in LEP gene have relation with circulating leptin concentration (Buchanan et al., 2007; Jonas et al., 2016), growth traits (Barzehkar et al., 2009; Hajihosseinlo et al., 2012) carcass and meat quality traits (Boucher et al., 2006; Barzehkar et al., 2009) and reproduction traits (Bakhtiar et al., 2017). The LEP gene is located on the chromosome 4 in the ovine genome that encodes a 167 amino acid leptin protein (Hashemi et al., 2011).
Table II.- Restrictions enzymes, restriction product size and genotyping.
| Gene |
PCR products size (bp) |
Restriction enzymes |
Restriction products size (bp) |
Genotyping |
| IGF1 |
294 |
BfoI (Bsp143II Isoschizomers) |
100, 194, 294 |
AB |
|
100,194 |
BB |
|||
|
294 |
AA |
|||
| LEP |
463 |
BcnI |
193, 270, 463 |
GA |
|
193, 270 |
GG |
|||
|
463 |
AA |
The LEP gene is commonly used for MAS studies because it is associated with many economically important traits. Polymorphisms identified in exon 3 of the sheep LEP gene were related to body weight (Hajihosseinlo et al., 2012). The SNP in the coding region of the sheep LEP gene was correlated with muscle growth (Boucher et al., 2006). Two SNPs in intron 2 of sheep LEP gene were related to fat-tail percentage and body and carcass weight (Barzehkar et al., 2009). LEP/BcnI polymorphism (170 G>A) in exon 3 of the sheep LEP gene has significant effect on feed conversion ratio and circulating leptin concentration (Jonas et al., 2016). This SNP (170 A>G) also was associated with reproduction traits in sheep (Bakhtiar et al., 2017).
The present study was designed to investigate SNPs in ovine IGF1 (C1511G, A1513G, 5’ regulatory region) and LEP (170 A>G, exon 3) genes in Kivircik crossbreed ewes.
Materials and Methods
Tissue samples
A total of 100 Kivircik crossbred (Kivircik x Merino) ewes tissue samples were collected after slaughtering and stored at -20 °C in a deep freezer as far as molecular genetic studies are performed.
DNA amplification and genotyping
PCR-RFLP method was used to determine for IGF1 (He et al., 2012) and LEP (Bakhtiar et al., 2017) gene polymorphism. The sequences of the primers and the size of the PCR product are given in Table I. Restriction enzymes, the size of restriction products and genotyping are shown in Table II.
All PCR applications were performed with the Phire Tissue Direct PCR Master Mix (ThermoFisher LSG-F170L) in accordance with the manufacturer’s instructions. The PCRs for both SNPs were carried out in volumes of 50 µl using; 25 µl Phire Tissue Direct PCR Master Mix, 0,3-0,5 mm tissue sample, 5 µM each primer, and the rest was ddH2O. The amplification was performed at 98°C for 5 min, followed by 40 cycles at 98°C for 5 sec, annealing for 5 sec, 72°C for 20 sec and a final extension of 72°C for 1 min on T100 Thermal Cycler (Biorad). Annealing temperatures are also shown in Table I.
A fragment of 294 bp in the 5’ regulatory region of the IGF1 gene and a fragment of 463 bp in the exon 3 of the LEP gene were amplified using the primers given in Table I. The PCR products were subjected to electrophoresis on 2 % agarose/ethidium bromide gel (Aga003R, Bioshop, Canada) in 1× TBE buffer (TBE-001, New Bioscience). Gels were visualized under UV light and documented in WGD30S Molecular Imager apparatus (Wisd).
For IGF1/BfoI genotyping, 10 μl of PCR product were digested with 2 μl (20 U) of Fast Digest BfoI (FD2148, ThermoFisher) restriction enzymes at 37°C for 5 min. For LEP.170.G>A genotyping; 10 μl of PCR product were digested with 2 μl (20 U) of BcnI (ER0061, ThermoFisher) restriction enzymes at 37°C for 3 h. The restriction fragments were subjected to electrophoresis on 2 % agarose/ethidium bromide gel in 1× TBE buffer. Gels were visualized under UV light and documented in WGD30S Molecular Imager apparatus (Fig. 1).
Statistical analysis
In this study, The Chi-square test whether genotype frequencies of LEP/BcnI and IGF1/BfoI polymorphism were in Hardy Weinberg equilibrium estimated by PopGene Version 1.32 (Yeh et al., 1997).
Results and dıscussıon
Genotypic distribution and allele frequencies of IGF1/BfoI polymorphism
Three genotypes were determined in IGF1/BfoI polymorphism in 5′ regulatory region in Kivircik crossbred ewes (Fig. 1A). The allele frequencies of the IGF1/BfoI polymorphism in 5′ regulatory region were calculated according to Hardy-Weinberg equilibrium (Table III). Allele frequencies of A and B were found with 0.915 and 0.085, respectively. The genotype frequencies of IGF1 gene were 0.85 (AA), 0.13 (AB) and 0.02 (BB). There was no deviation from Hardy-Weinberg equilibrium (P>0.05) relative to IGF1 genotypes.
5′ regulatory region is one of the polymorphic sites of IGF1 gene. He et al. (2012) determined two polymorphism named as (C1511G and A1513G) in 5′ regulatory region of IGF1 gene. They reported allele frequencies of A and B in Small Tail Han sheep (0.809-0.191), Hu sheep (0.638-0.362), Texel sheep (0.969-0.031) and Dorset sheep (1.000-0.000), respectively. Trukhachev et al. (2016) reported the allele frequencies of 5′ regulatory region of IGF1 gene as 0.87 (C) and 0.13 (T) in Russian Soviet Merino sheep breed. The allele frequencies for 5′ regulatory region of IGF1 gene for Small Tail Han sheep, Texel sheep and Russian Soviet Merino sheep breed are similar to our study. The other researchers have reported polymorphisms of IGF1 gene with different regions. Moradian et al. (2013) found the allele frequencies of IGF1 (Exon 1) as 0.73 (A) and 0.27 (G) in Makoei Sheep.
Niznikowski et al. (2014) carried out the study to identify the polymorphisms of IGF1 (Exon 3) in Polish Lowland Sheep. They reported that there was no polymorphisms of IGF1 (Exon 3) in Polish Lowland Sheep. Kazemi et al. (2011) studied the promoter region of IGF1 gene in Zel sheep population. The researchers determined the polymorphisms of IGF1 gene and showed the allele frequencies 0.71 (A) and 0.29 (B). In other study, polymorphisms of IGF1 (Exon 3) were identified in Pomeranian Coarsewool ewes. The allele frequencies of
Table III.- Allele and genotype frequences for IGF1/BfoI and LEP/BcnI polymorphism.
| n |
Genotypes |
Genotype frequencies |
Allel frequencies |
(χ²)1 |
||||||
|
AA |
AB |
BB |
AA |
AB |
BB |
A |
B |
3.000ns |
||
|
IGF1 |
|
|
|
|
|
|
|
|
|
|
| Observed | 100 |
85 |
13 |
2 |
0.85 |
0.13 |
0.12 |
0.9150 |
0.0850 |
|
| Expected | 100 |
83.6834 |
15.6332 |
0.6834 |
0.83 |
0.15 |
0.0068 |
|
|
|
|
LEP |
|
|
|
|
|
|
|
|
2.10ns |
|
| Observed | 100 |
90 |
9 |
1 |
0,90 |
0,09 |
0.01 |
0.9450 |
0.0550 |
|
| Expected | 100 |
89.2764 |
10.4472 |
0.2764 |
0.89 |
0.10 |
0.0027 |
|||
1 χ 20.05;1 ; 3,84 test of Hardy-Weingberg equlibrium; NS, not significant (P > 0.05).
0.205 (C) and 0.795 (T) were given in this study (Proskura and Szewczuk, 2014). Grochowska et al. (2017) investigated the polymorphism in 5′ flanking region of the IGF1 gene in in Coloured Polish Merino sheep. The allele frequencies of A and B were found 0.92 and 0.8, respectively.
Genotypic distribution and allele frequencies of LEP/BcnI polymorphism
The genotypes of GG, GA and AA were found in LEP/BcnI polymorphism of Exon 3, 170.G>A in Kivircik crossbreed sheep (Fig. IB). The allele frequencies of the LEP/BcnI polymorphism were calculated according to Hardy-Weinberg equilibrium (Table III). The estimated frequencies of three genotypes including GG, GA and AA at LEP/BcnI polymorphism were 0.90, 0.09 and 0.01 and they were 0.055 and 0.945 for A and G alleles, respectively. There was no deviation from Hardy-Weinberg equilibrium (P>0.05) relative to LEP genotypes. In this study, G allele of LEP/BcnI (exon 3) was found homozygous in Kivircik crossbreed sheep population. Similarly, LEP/BcnI polymorphism in crossbreed Awassi-Merino sheep were reported by Jonas et al. (2016) as 0.08 and 0.92 for A and G, respectively. Mahmoud et al. (2014) reported the A and G allele frequencies for Herri sheep breed as 0.086 and 0.914, respectively. In Sanjabi rams, the allele frequencies were reported as 0.76 (G) and 0.24 (A) (Bakhtiar et al., 2017). This results are in agreement with the current study.
The LEP has different polymorphic sites in sheep breeds. Cauveri et al. (2014) determined two polymorphism in the LEP Exon 3 (16973 G>A, 17476 C>T) in Nilagiri sheep. The allele frequencies were found as 0.87 (C) and 0.13 (T). The other study carried out in Malpura sheep. LEP (Exon 3) T387G locus was found polymorphic. G and T allele frequencies were given 0.82 and 0.18, respectively (Meena et al., 2017). Mahmoud et al. (2014) have also studied different polymorphic sites of LEP gene in Herri sheep breed. There were three non-synonymous polymorphic sites at positions 248 (CTG/CCG-transition), 286 (GTG/TTG-transversion) and 332 (CGG/CAG-transition) and two synonymous polymorphic sites at positions 213 (ACC/GCC transition) and 216 (CCA/CCG transition) determined in this study. The A and G allele frequencies for polymorphic sites at positions 213, 216, 248, 286 and 332 were (0.029-0.971), (0.029-0.971), (0.014-0.986), (0.286-0.714) and (0.114-0.886), respectively.
Conclusıons
The primary aim of this study to identify the polymorphisms of LEP and IGF1 genes in Kivircik crossbreed population. Therefore, the present study provided basic information to understand the genetic diversity of Kivircik crossbred sheep in terms of IGF1 and LEP genes. The genetic improvement of economically important traits can be developed through marker assisted selection. IGF1 and LEP genes are playing pivotal role in growth and metabolism. So, these genes are well known markers for economically important traits of livestock animals. In this study, the IGF1 and LEP genes have showed polymorphic pattern in Kivircik crossbred ewes and provided valuable informations about sheep breeding. Taken together, these informations not only can be used further selection programs in sheep breeding but also contributed to the literature and ongoing studies.
Acknowledgements
This study has been supported by the project numbered as NKUBAP.10.GA.17.117 accepted by Commission of Scientific Research Projects of Namık Kemal University in Turkey. We are thankfull to Lider Meat Ipsala company for providing tissue samples.
Statement of conflict of ınterest
The author(s) declare(s) that there is no conflict of interests regarding the publication of this article.
References
Bakhtiar, R., Abdolmohammadi, A., Hajarian, H., Nikousefat, Z. and Kalantar-Neyestanaki, D., 2017. Identification of g. 170G> A and g. 332G> A mutations in exon 3 of leptin gene (Bcnl and Cail) and their association with semen quality and testicular dimensions in Sanjabi rams. Anim. Reprod. Sci., 179: 49-56. https://doi.org/10.1016/j.anireprosci.2017.01.016
Barzehkar, R., Salehi, A. and Mahjoubi, F., 2009. Polymorphisms of the ovine leptin gene and its association with growth and carcass traits in three Iranian sheep breeds. Iranian J. Biotechnol., 7: 241-246.
Boucher, D., Palin, M., Castonguay, F., Gariépy, C. and Pothier, F., 2006. Detection of polymorphisms in the ovine leptin (LEP) gene: Association of a single nucleotide polymorphism with muscle growth and meat quality traits. Canadian J. Anim. Sci., 86: 31-36.
Buchanan, F., Van Kessel, A., Boisclair, Y., Block, H. and McKinnon, J., 2007. The leptin arg25cys affects performance, carcass traits and serum leptin concentrations in beef cattle. Canadian J. Anim. Sci., 87: 153-156. https://doi.org/10.4141/A06-077
Casas-Carrillo, E., Kirkpatrick, B., Prill-Adams, A., Price, S. and Clutter, A., 1997. Relationship of growth hormone and insulin-like growth factor-1 genotypes with growth and carcass traits in swine. Anim. Genet., 28: 88-93. https://doi.org/10.1111/j.1365-2052.1997.00086.x
Cauveri, D., Sivaselvam, S., Karthickeyan, S., Tirumurugaan, K. and Kumanan, K., 2014. Allelic polymorphism of exon 3 of leptin gene in Nilagiri sheep identified by sequencing and PCR-RFLP. Int. J. Sci. Environ. Technol., 3: 951-955.
Chelongar, R., Hajihosseinlo, A. and Ajdary, M., 2014. The effect of Igf-1 and Pit-1 genes polymorphisms on fat-tail measurements (fat-tail dimensions) in Makooei sheep. Adv. environ. Biol., 8: 862-868.
Curi, R.A., de Oliveira, H., Silveira, A.C. and Lopes, C., 2005. Association between IGF-I, IGF-IR and GHRH gene polymorphisms and growth and carcass traits in beef cattle. Livest. Prod. Sci., 94: 159-167. https://doi.org/10.1016/j.livprodsci.2004.10.009
De la Rosa Reyna, X., Montoya, H., Castrellón, V., Rincón, A., Bracamonte, M. and Vera, W., 2010. Polymorphisms in the IGF1 gene and their effect on growth traits in Mexican beef cattle. Genet. Mol. Res., 9: 875-883. https://doi.org/10.4238/vol9-2gmr745
Ekiz, B., Yilmaz, A., Ozcan, M., Kaptan, C., Hanoglu, H., Erdogan, I. and Yalcintan, H., 2009. Carcass measurements and meat quality of Turkish Merino, Ramlic, Kivircik, Chios and Imroz lambs raised under an intensive production system. Meat Sci., 82: 64-70. https://doi.org/10.1016/j.meatsci.2008.12.001
Etherton, T., 2004. Somatotropic function: the somatomedin hypothesis revisited. J. Anim. Sci., 82: E239-E244.
Grochowska, E., Borys, B., Janiszewski, P., Knapik, J. and Mroczkowski, S., 2017. Effect of the IGF-I gene polymorphism on growth, body size, carcass and meat quality traits in Coloured Polish Merino sheep. Arch. Tierzucht., 60: 161. https://doi.org/10.5194/aab-60-161-2017
Hajihosseinlo, A., Hashemi, A. and Sadeghi, S., 2012. Association between polymorphism in exon 3 of leptin gene and growth traits in the Makooei sheep of Iran. Livest. Res. Rural Develop., 24: 543-546.
Hashemi, A., Mardani, K., Farhadian, M., Ashrafi, I. and Ranjbari, M., 2011. Allelic polymorphism of Makoei sheep leptin gene identified by polymerase chain reaction and single strand conformation polymorphism. Afr. J. Biotechnol., 10: 17903-17906. https://doi.org/10.5897/AJB11.2480
He, J., Zhang, B., Chu, M., Wang, P., Feng, T., Cao, G., Di, R., Fang, L., Huang, D. and Tang, Q., 2012. Polymorphism of insulin-like growth factor 1 gene and its association with litter size in Small Tail Han sheep. Mol. Biol. Rep., 39: 9801-9807. https://doi.org/10.1007/s11033-012-1846-y
Islam, K., Vinsky, M., Crews, R., Okine, E., Moore, S., Crews, D. and Li, C., 2009. Association analyses of a SNP in the promoter of IGF1 with fat deposition and carcass merit traits in hybrid, Angus and Charolais beef cattle. Anim. Genet., 40: 766-769. https://doi.org/10.1111/j.1365-2052.2009.01912.x
Jonas, E., Martin, G., Celi, P., Li, L., Soattin, M., Thomson, P. and Raadsma, H., 2016. Association of polymorphisms in leptin and leptin receptor genes with circulating leptin concentrations, production and efficiency traits in sheep. Small Rumin. Res., 136: 78-86. https://doi.org/10.1016/j.smallrumres.2016.01.010
Kazemi, S.M., Amirinia, C., Emrani, H. and Gharahveysi, S., 2011. Study and ıdentification of ınsulin-like growth factor-I gene polymorphisms in Zel sheep population. Am. J. Anim. Vet. Sci., 6: 176-179. https://doi.org/10.3844/ajavsp.2011.176.179
Kök, S., Atalay, S., Eken, H.S. and Savaşçi, M., 2017. The genetic characterization of Turkish grey cattle with regard to UoG Cast, CAPN1 316 and CAPN1 4751 markers. Pakistan J. Zool., 49: 297-304. https://doi.org/10.17582/journal.pjz/2017.49.1.281.287
Mahmoud, A., Saleh, A., Abou-Tarboush, F., Shafey, T. and Abouheif, M., 2014. Nucleotide sequence polymorphism within exon 3 region of leptin and prolactin genes in Herri sheep. Res. J. Biotechnol., 9: 10.
Meena, A., Bhatt, R., Sahoo, A. and Kumar, S., 2017. Polymorphism of the exon 3 of leptin gene in Malpura sheep. Indian J. Anim. Res., 51: 469-473.
Moradian, C., Esmailnia, G. and Hajihosseinlo, A., 2013. Polymorphism of IGF-1 gene in Makoei Sheep using PCR-SSCP. Eur. J. exp. Biol., 3: 490-494.
Nazari, F., Noshary, A. and Hemati, B., 2016. Association between ınsulin–like growth factor I polymorphism and early growth traits in Iranian Zandi sheep, found polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). Iranian J. appl. Anim. Sci., 6: 665-669.
Niznikowski, R., Czub, G., Kaminski, J., Nieradko, M., Swiatek, M., Glowacz, K. and Slezak, M., 2014. Polymorphism of insulin-like growth factor (IGF-1) gene in Polish Lowland sheep from Podlaskie voivodship. Annls. Warsaw Univ. Life Sci. Anim. Sci., 53: 43-46.
Özcan, H., 1970. Heritability of birth weight in Kıvırcık lambs and effects of age and weight of dam, sex and birthtype of lambs on birth weight. Ankara Üniv. Vet. Fak. Derg., 2: 190-200.
Proskura, W.S. and Szewczuk, M., 2014. The polymorphism in the IGF1R gene is associated with body weight and average daily weight gain in Pomeranian Coarsewool ewes. Pak. Vet. J., 34: 514-517.
Reicher, S., Gertler, A., Seroussi, E., Shpilman, M. and Gootwine, E., 2011. Biochemical and in vitro biological significance of natural sequence variation in the ovine leptin gene. Gen. comp. Endocrinol., 173: 63-71.
Scatà, M.C., Catillo, G., Annicchiarico, G., De Matteis, G., Napolitano, F., Signorelli, F. and Moioli, B., 2010. Investigation on lactation persistency and IGF-I gene polymorphisms in dairy sheep. Small Rumin. Res., 89: 7-11. https://doi.org/10.1016/j.smallrumres.2009.10.014
Trukhachev, V., Skripkin, V., Kvochko, A., Kulichenko, A., Kovalev, D., Pisarenko, S., Volynkina, A., Selionova, M., Aybazov, M. and Shumaenko, S., 2016. Polymorphısms of the IGF1 gene in Russıan sheep breeds and their ınfluence on some meat productıon parameters. Slovenian Vet. Res., 53: 77-83.
Upton, Z., Yandell, C.A., Degger, B.G., Chan, S.J., Moriyama, S., Francis, G.L. and Ballard, F.J., 1998. Evolution of insulin-like growth factor-I (IGF-I) action: In vitro characterization of vertebrate IGF-I proteins. Comp. Biochem. Physiol. Part B: Biochem. mol. Biol., 121: 35-41.
Yeh, F., Yang, R. and Boyle, T., 1997. POPGENE Version 1.32. Ag. For Molecular Biology and Biotechnology Centre, University of Alberta and Center for International Forestry Research.
Zhang, C., Zhang, W., Luo, H., Yue, W., Gao, M. and Jia, Z., 2008. A new single nucleotide polymorphism in the IGF-I gene and its association with growth traits in the Nanjiang Huang goat. Asian-Australasian J. Anim. Sci., 21: 1073-1079. https://doi.org/10.5713/ajas.2008.70673