Association of Leptin Gene Polymorphism with Growth Rate in Lohi Sheep
Ali Haider Saleem1,*, Khalid Javed2, Masroor Ellahi Babar3, Tanveer Hussain3, Asad Ali2, Afzal Ali2, Nisar Ahmad2, Muhammad Zahid Farooq1 and Muhammad Dawood2
1Department of Animal Sciences, College of Veterinary and Animal Sciences, 12 KM Chiniot Road, Jhang 35200
2Department of Livestock Production, University of Veterinary and Animal Sciences, Lahore
3Department of Molecular Biology, Virtual University of Pakistan, Lahore
ABSTRACT
Leptin hormone, encoded by LEP gene, has significant importance in regulating various functions like growth, puberty, reproduction and milk production in both animals and humans. The sequence variations have been studied, reported and associated with many growth traits like weaning weight, six month body weight and nine-month body weight etc. in cattle, buffalo, goat and sheep worldwide. LEP gene polymorphism and associations have not been extensively reported in Lohi sheep of Pakistan, so this study aimed to find any variations in gene sequence and possible association with growth rate to explore meat potential of this breed. A total of 18 Lohi animals were selected from the flock. After the DNA extraction from blood samples, a 1486 bp fragment of exon three was amplified and sequenced. Sequence analysis revealed single nucleotide polymorphism (T>A at position 483) and a sheterozygous condition (T>W at position 483). Generalized linear model was used to minimize the environmental effects. The variation i.e. “W” type heterozygous condition showed a higher average daily weight gain. Sequence analysis of LEP gene confirmed the presence of genetic variability among Lohi animals; this variation might be associated with other economic traits for future breeding programs and marker assisted selection.
Article Information
Received 28 August 016
Revised 03 May 2017
Accepted 21 August 2017
Available online 20 April 2018
Authors’ Contribution
AHS and Asad A conducted the lab work. MZF assisted in data collection. KJ and MEB did the statistical analysis. TH and MA did the molecular analysis. Afzal A and NA helped in drafting of the manuscript.
Key words
Lohi sheep, DNA, Polymorphism, Exon, Leptin.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.3.1029.1033
* Corresponding author: [email protected]
0030-9923/2018/0003-1029 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introduction
In a developing country like Pakistan, small ruminants (sheep, goat) play an important role in sustainable livestock production. From the latest economic survey of Pakistan, it is evident that they have contributed 17.26% to the national meat production during 2016-17. The per capita consumption of meat in the country is 20.3 Kg and of mutton is 3.8 Kg, which is very low as compared to developed countries. Sheep is one of the important livestock assets in Pakistan having about 15.73% share (30.1 million) in total livestock population (191.3 million) of the country (Anonymous, 2017). Sheep farming adds up a great part to the agricultural economy particularly in the arid, semi-arid and hilly regions where crop production and dairy farming is not feasible. There are about 30 domesticated sheep breeds found in the country that produce meat, milk, and wool (Ali et al., 2011). It is assumed that there are certain sheep breeds which have a higher potential for mutton and wool production (Babar, 1994), therefore exploring their genetic potential might be helpful to fulfill the increasing meat demands in the country. Lohi is an important thin tail dual purpose sheep breed which is found in the central districts of province Punjab, Pakistan (GoP, 1996; Fiaz et al., 2017). According to Babar et al. (2004), body features of this breed make it favorable for mutton production.
It is evident that hormones are involved in many processes of the body like growth, development, and reproduction (Neave, 2008), leptin is one of them. It is encoded by LEP/ob gene, which is located on the 5th chromosome in ovine. Javanmard et al. (2008) described that it has three exons and two introns, but only exon two and exon three are translated into protein. Among the meat production traits, average daily weight gain is the most important trait of consideration. Globally, LEP gene polymorphism in sheep has been discussed by many scientists like Shojaei et al. (2011), Hajihosseinlo et al. (2012), Bahrami et al. (2013), Mahmoud et al. (2014), Qureshi et al. (2015), Meena et al. (2016) and Quirino et al. (2016). It can be said that the variations in the production performance of animals might be due to the effect of genetics, environment and/or due to the interactions of both. Many researchers worked on large ruminants i.e. cattle and buffalo and most of the work was on the association of leptin gene with carcass traits, though some literature regarding growth and milk production traits is also available (da Silva et al., 2012; Woronuk et al., 2012; Mancini et al., 2013). At present, inadequate information about LEP gene variants and their association with average daily weight gain is available in ovine population of Pakistan. Considering this deficiency present study is intended to find single nucleotide polymorphism (SNP) or variation in the LEP gene and its relationship with average daily weight gain in Lohi sheep.
Materials and methods
Animal resources and DNA extraction
Data regarding pedigree and body weights were collected from the flock of Lohi animals maintained at Small Ruminants Training and Research Center, University of Veterinary and Animal Sciences, Ravi Campus, Pattoki, Punjab, Pakistan. The animals were already vaccinated against fatal diseases and drenched anthelmintic against gastrointestinal parasites. They were fed green fodder, concentrates and ad lib water following the routine farm practices; and were housed in sheds according to weather conditions. Average daily weight gain (ADG) was calculated from birth to three months of age . After the statistical analysis (generalized linear model), a total of 18 animals were randomly selected from the flock for blood sampling. Genomic DNA was extracted from whole blood samples (5 ml each) using method used by Babar et al. (2014).
Table I.- Primers for exon three of ovine leptin gene used on Lohi sheep samples.
| Primer name | Sequence 5’-3’ |
Product size |
Temp.(°C) |
| Exon 3.1F | AGAAGTAAGGGTCCAGGAAG |
627 bp |
53.4 |
| Exon 3.1R | CTGAGAGGAGCAAGAGAGAA |
|
53.3 |
| Exon 3.2F |
CCTGGAAGCCTCCCTCTACT |
364 bp |
58.0 |
| Exon 3.2R | AGGGAGGAAGACTGCTGTGA |
|
57.9 |
| Exon 3.3F | CTGGGATTTTCACAGCAG |
438 bp |
51.0 |
| Exon 3.3R |
GGTCCTTCGAGATCCATT |
|
51.2 |
| Exon 3.4F | AGGGCTCTCAAGTTTGTTC |
533 bp |
54.4 |
| Exon 3.4R | GCATGCAAATCCCAAAG |
|
55.9 |
Primer designing and PCR amplification
Primers were designed by Primer3Plus software using Gene ID: 443534 available at NCBI gene database. A fragment of 1486bp covering entire exon three was amplified using 4 sets of primers (Table I). Touchdown PCR was carried out using Thermal Cycler (iCycler BioRad, USA) with initial denaturation at 94ºC for 5 min, followed by 35 cycles of denaturation at 94ºC for 45 sec, annealing 58-48ºC for 45 sec and extension at 72ºC for 45 sec. Final extension was given at 72ºC for 10 min and storage at 4ºC.
Sequencing analysis
The amplicons were purified using TIANquick Midi Purification Kit (Tiangen Biotech Beijing Co., Ltd.) and sent for Sanger’s sequencing to 1st BASE Laboratories, Singapore. Molecular analysis was carried out using Codoncode Aligner ver. 5.0.2 (García-Varela et al. 2016) and MEGA ver. 6.06 (Tamura et al. 2013). Peaks were read out, compared and variations were marked.
Age correction and elimination of environmental effects
Certain correction factors were calculated to minimize the environmental effects (Babar, 1994). The following model was used;
Yhijklm=µ+Zh+Si+Xj+Tk+Al+Gm+Ɛhijklm
Where, h, 1, 2 (number of years = 2); i, 1, 2 (number of seasons = 2); j, 1, 2 (sex of lamb born = 2); k, 1, 2 (number of birth type = 2); l, 1, 2, 3 (age groups of dam = 3); m, 1, 2, 3 (groups of individuals on the basis of SNP = 3); Yhijklm, ADG of nth lamb of mth genotype, jth sex, kth type of birth and lth age of dam and born during ith season in hth year; µ, overall population mean; Zh, effect of hth year; Si, effect of ith season; Xj, effect of jth sex of lamb born; Tk, effect of kth birth type; Al, effect of lth age group of dam; Gm, effect of mth genotype; Ɛhijklm, random error associated with ADG of nth lamb of jth sex, kth type of birth and lth age of dam, born during ith season in hth year and of mth genotype. It was additionally presumed that Ɛhijklm was generally and autonomously distributed with mean 0 and variance σ2.
Association study
Analysis of variance technique was used for the estimation of environmental effects. After the molecular analysis, the animals were divided into three groups on the basis of observed SNPs. Student-Newman-Test was used in General Linear Model (GLM) of SAS (9.1) to calculate statistical differences among means of different groups.
Results and discussion
Two years’ pedigree and performance data of ewes were used in the present study. Analysis of variance was performed by GLM of SAS ver. 9.1 software for the estimation of environmental effects. Statistical analysis revealed that birth weight, average daily weight gain, and coefficient of variation were 3.71±0.09 kg, 117.90±4.14 g and 24.22 and 28.02%, respectively on an average. Statistical analysis for the influence of environmental effects on corrected ADG showed significant association (P>0.01) of the type of birth, season of birth and sex of lamb with average daily weight gain as shown in Table II. The exon three of LEP gene in Lohi sheep was amplified using four sets of primers as shown in Table I. The sequence analysis revealed single nucleotide variant (A) and heterozygous peak (W) at position 483; where W represents overlapping of two peaks A and T (Fig. 1). On the basis of the type of SNP, Lohi individuals were divided into three groups. Association of SNP with average daily weight gain revealed statistically non-significant (P>0.05) association as represented in Table III. Animals having SNP “A” at 483 position showed a highest average daily weight gain of 172.73 ± 18.10g followed by 135.00 ± 18.19g with “W” type of SNP, while wild-type animals had the lowest average daily gain 115.60 ± 9.57g. This work is one of the initial studies on polymorphism in LEP gene in Lohi sheep of Pakistan. Single nucleotide polymorphisms (A and W) in exon three of LEP gene were observed in Lohi animals used in current study. For the association study, the animals were grouped on the basis of observed SNPs. Data of these groups were analyzed and the results obtained were compared to find out any association (Table III). Results exhibited statistically non-significant differences (P>0.05) among ADG of individuals having “T” and “A” type mutations. Comparatively higher average daily gain (172.73 ± 18.10g) was observed in individuals having heterozygous “W” type mutation followed by “A” (135.00 ± 18.19g) and “I” (115.60 ± 9.57g) type. On the basis of current analysis, the “W” type SNP can be considered as desirable for increased daily weight gain.
Table II.- Analysis of variance for evaluation of environmental effects.
| SOV |
DF |
SS |
MS |
F Ratio |
P Value |
| YOB |
1 |
534.09439 |
534.09439 |
0.49 |
0.4860NS |
| SOB |
1 |
35144.61052 |
35144.61052 |
32.21 |
<0.0001* |
| Sex |
1 |
14832.35958 |
14832.35958 |
13.60 |
0.0004* |
| TOB |
1 |
7971.88755 |
7971.88755 |
7.31 |
0.0082* |
| AOD |
2 |
930.91957 |
465.45979 |
0.43 |
0.6540NS |
| Error |
89 |
97098.5995 |
1090.9955 |
|
|
| Total |
95 |
156512.4711 |
|
|
|
*Highly significant (P<0.01), NS Non-significant (P>0.05); SOV, source of variation; DF, degree of freedom; SS, sum of squares; MS, mean squares; F ratio, Fisher ratio; P value, probability value; YOB, year of birth; SOB, season of birth; TOB, type of birth; AOD, age of dam.
Table III.- SNP and average daily gain in Lohi groups.
|
Group |
No. of animals |
SNP |
Site |
Mean (g) ± SE |
|
1 |
7 |
W |
483 |
172.73 ± 18.10 |
|
2 |
5 |
A |
483 |
135.00 ± 18.19 |
|
3 |
6 |
T/wild |
483 |
115.60 ± 9.57 |
SE, standard error.
Lambs born in spring might be heavier at birth than lambs born in autumn because of the convenience of good quality fodder for the ewes during late winter and spring than the summer season (Babar, 1994). Lambs born as single had enhanced prospects in their mothers’ uterus than twins or triplets. Male lambs usually halt somewhat longer in the uterus than female lambs, so heavier at birth (Babar, 1994). Many scientists found polymorphism in ovine leptin gene in their studies. Zhou et al. (2009) found four SNPs (C/T, G/A, G/A, G/T at positions 107, 271, 271 and 387, respectively) in exon three of leptin gene while working on Romney, Merino, Coopworth, Corriedale, Poll Dorset and Suffolk sheep breeds. Reicher et al. (2010) also found variations (A/G, A/C, AA/TC, G/A, G/T, and G/A at nucleotide no. 225, 228, 232-3, 312, 367 and 413, respectively) in exon three of leptin gene while working on Assaf breed. SNP patterns (L1, L2, L3) found in LEP gene in sheep were significantly associated with additive estimated breeding values for weight at 90 days i.e. weaning weight (Tahmoorespur et al., 2010). Shojaei et al. (2011) reported polymorphism and significant relationship with growth traits (SSCP patterns i.e. A/A, C/C, A/B, A/C, A/B/C, A/B/E, A/B/D/E, A/B/C/F, A/C/F and A/B/F) in exon three of leptin gene in Kermani sheep breed. An association between genotypes was found with weights at different ages of life in Makooei sheep (Hajihosseinlo et al., 2012). Jonas et al. (2016) reported the relationship of observed SNPs in leptin (LEP) and leptin receptor (LEPR) genes with production traits and circulating leptin concentration in Awassi-Merino crossbred population. Meena et al. (2016) reported three SNPs in exon three of LEP gene in Malpura sheep breed using PCR-RFLP technique. The T387G locus was found polymorphic while A316C and A271G loci were monomorphic. Quirino et al. (2016) investigated variations in exon three of leptin gene and their association with carcass traits in Brazilian sheep breeds i.e. Santa Inês (SI) and crossbreed (SI x Dorper). PCR-RFLP technique was used and among the three alleles of the gene, only one exhibited improved cold carcass weight. Three SNPs (G128T, C270T, and T166C) were observed by Wang et al. (2011) found novel SNPs (G128T, C270T, and T166C) in leptin receptor gene in goats, and associations between different genotypes and traits like prolificacy and birth weight of kids. Many haplotypes in exon two (DQ229928-30) and intron two (DQ229931-32) of LEP gene were reported by Singh et al. (2009) in different goat breeds. In cattle, Kulig and Kmieć (2009) found Sau3AI and A59V polymorphism while investigating the relationship of LEP gene polymorphism with some growth traits (body weight, average daily gain etc.). Results revealed that some A59V haplotypes had notable positive effects on body weight (at 210 d) and average daily gain (between 3-210 d). Tian et al. (2013) genotyped two SNPs (E2-169 T>C and E3-299 T>A) of LEP gene in steers and associated with the meat quality and carcass characters.
Conclusion
In summary, the molecular analysis of exon three of leptin gene of Lohi sheep showed polymorphism and trend of association with average daily weight gain. There is need to extend this work with more number of animals as well as on other sheep breeds to confirm the findings before declaring them as markers and using them for Marker Assisted Selection (MAS) in future breeding programs of Lohi.
Acknowledgments
The authors acknowledge the assistance from the staff of Small Ruminants Training and Research Center, University of Veterinary and Animal Sciences, Ravi campus, Pattoki during this study.
Statement of conflict of interest
The authors have no conflict of interest to declare.
References
Ali, A., Babar, M.E., Mahmood, S. and Imran, M., 2011. First report of GTG-banded nomenclature of Pakistani Lohi sheep (Ovis aries). Turk. J. Vet. Anim. Sci., 35: 213-217.
Anonymous, 2017. Economic survey of Pakistan 2016-17. Finance Division, Economic Adviser’s Wing, Islamabad, Pakistan. Available from: http://www.finance.gov.pk/survey/chapters_15/02_Agricultre.pdf
Babar, M.E., 1994. Genetic and phenotypic parameters of some performance characteristics of Lohi sheep. A PhD dissertation, University of Agriculture, Faisalabad, Punjab, Pakistan.
Babar, M.E., Ahmad, Z., Nadeem, A. and Yaqoob, M., 2004. Environmental factors affecting birth weight in Lohi sheep. Pak. Vet. J., 24: 05-08.
Babar, M.E., Hussain, T., Sadia, H., Nadeem, A., Kamran, M.Z. and Badshah, N., 2014. Mitochondrial cytochrome b gene based phylogeny of Lohi and Thalli sheep breeds of Pakistan. J. Anim. Pl. Sci., 24: 1260-1262.
Bahrami, A., Behzadi, S., Miraei-Ashtiani, S.R., Roh, S.G. and Katoh, K., 2013. Genetic polymorphisms and protein structures in growth hormone, growth hormone receptor, ghrelin, insulin-like growth factor 1 and leptin in Mehraban sheep. Gene, 527: 397-404. https://doi.org/10.1016/j.gene.2013.05.066
da Silva, R.C., Ferraz, J.B., Meirelles, F.V., Eler, J.P., Balieiro, J.C.C., Cucco, D.C., Mattos, E.C., Rezende, F.M. and Silva, S.L., 2012. Association of single nucleotide polymorphisms in the bovine leptin and leptin receptor genes with growth and ultrasound carcass traits in Nellore cattle. Genet. Mol. Res., 11: 3721-3728. https://doi.org/10.4238/2012.August.17.10
Fiaz, M., Munawar, K., Mushtaq, M., Ahmad, M., Chaudhry, M.A., Aslam, M., Ahmad, T. and Nasrullah, 2017. Evaluating varying calf milk replacers for optimum growth performance in Salt Range lambs. Pakistan J. Zool., 49: 1925-1928. http://dx.doi.org/10.17582/journal.pjz/2017.49.5.sc5
García-Varela, M., Sereno-Uribe, A.L., Pinacho-Pinacho, C.D., Domínguez-Domínguez, O. and Pérez-Ponce de León, G., 2016. Molecular and morphological characterization of Austrodiplostomum ostrowskiae Dronen (Digenea: Diplostomatidae), a parasite of cormorants in the Americas. J. Helminthol., 90: 174-185. https://doi.org/10.1017/S0022149X1500005X
GoP, 1996. Livestock census. Agricultural Census Organization, Statistics Division, Lahore, Government of Pakistan.
Hajihosseinlo, A., Hashemi, A. and Sadeghi, S., 2012. Association between polymorphism in exon 3 of leptin gene and growth traits in the Makooei sheep of Iran. Livest. Res. Rural Dev., 24: Article # 166. Available from: http://www.lrrd.org/lrrd24/9/haji24166.htm.
Javanmard, A., Mohammadabadi, M., Zarrigabayi, G., Gharahedaghi, A., Nassiry, M., Javadmansh, A. and Asadzadeh, N., 2008. Polymorphism within the intron region of the bovine leptin gene in Iranian Sarabi cattle (Iranian Bos taurus). Russ. J. Genet., 44: 495-497. https://doi.org/10.1134/S1022795408040169
Jonas, E., Martin, G.B., Celi, P., Li, L., Soattin, M., Thomson, P.C., Raadsma, H.W., 2016. Association of polymorphisms in leptin and leptin receptor genes with circulating leptin concentrations, production and efficiency traits in sheep. Small Rumin. Res., 136: 78-86. https://doi.org/10.1016/j.smallrumres.2016.01.010
Kulig, H. and Kmieć, M., 2009. Association between leptin gene polymorphisms and growth traits in Limousin cattle. Russ. J. Genet., 45: 738-741. https://doi.org/10.1134/S1022795409060131
Mahmoud, A., Saleh, A., Almealamah, N., Ayadi, M., Matar, A., Abou-Tarboush, F., Al-Jumaah, R. and Abouheif, M., 2014. Polymorphism of leptin gene and its association with milk traits in Najdi sheep. J. appl. Microbiol., 8: 2953-2959.
Mancini, G, Nicolazzi, E.L., Valentini, A., Chillemi, G., Marsan, P.A., Santus, E. and Pariset, L., 2013. Association between single nucleotide polymorphisms (SNPs) and milk production traits in Italian Brown cattle. Livest. Sci., 157: 93-99. https://doi.org/10.1016/j.livsci.2013.07.008
Meena, A.S., Sahoo, A. and Bhatt, R.S., 2016. Polymorphism of the exon 3 of leptin gene in Malpura sheep. Indian J. Anim. Res., https://doi.org/10.18805/ijar.v0i0f.3783.
Neave, N., 2008. Hormones and behaviour: A psychological approach. Cambridge University Press, UK.
Quirino, C.R., da Costa, R.L.D., Pacheco, A., de Fátima Madella-Oliveira, A., Beltrame, R.T., da Silva Azevedo, A., Junior, A.B. and Vega, W.H.O., 2016. Identification of polymorphisms in the myostatin and leptin genes of Santa Inês breed and crossbreed sheep and association with carcass traits. Biosci. J., 32: 699-704. https://doi.org/10.14393/BJ-v32n3a2016-30184
Qureshi, Z.I., Farid, A.H., Babar, M.E. and Hussain, T., 2015. Leptin gene polymorphism in Lohi, Kajli and Spili breeds of sheep. Pak. Vet. J., 35: 321-324.
Reicher, S., Gertler, A., Seroussi, E. and Gootwine, E., 2010. Polymorphism in the ovine leptin gene (oLEP) affects leptin-binding affinity and activity. In: Proceedings of 9th World Congress on Genetics Applied to Livestock Production. Leipzig, Germany.
Shojaei, M., Abadi, M.M., Fozi, M.A., Dayani, O., Khezri, A. and Akhondi, M., 2011. Association of growth trait and Leptin gene polymorphism in Kermani sheep. J. Cell Mol. Res., 2: 67-73.
Singh, S.K., Rout, P.K., Agarwal, R., Mandal, A., Singh, S.K., Shukla, S.N. and Roy, R., 2009. Characterization of exon 2 & intron 2 of leptin gene in Indian goats. Anim. Biotechnol., 20: 80-85. https://doi.org/10.1080/10495390902823885
Tahmoorespur, M., Taheri, A., Valeh, M.V., Saghi, D.A. and Ansari, M., 2010. Effect of Leptin and ghrelin gene polymorphisms on estimated breeding values of growth traits in Baluchi sheep. In: Proceedings of 14th AAAP Animal Science Congress August 23-17, 2010; National Pingtung University of Science and Technology, Taiwan. Available at: http://profdoc.um.ac.ir/paper-abstract-1018524.html.
Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30: 2725-2729. https://doi.org/10.1093/molbev/mst197
Tian, J., Zhao, Z., Zhang, L., Zhang, Q., Yu, Z., Li, J. and Yang, R., 2013. Association of the leptin gene E2-169T> C and E3-299T> A mutations with carcass and meat quality traits of the Chinese Simmental-cross steers. Gene, 518: 443-448. https://doi.org/10.1016/j.gene.2012.11.071
Wang, P.Q., Deng, L.M., Zhang, Y.B., Chu, M.X., Tan, Y., Fan, Q. and Liu, C.X., 2011. Identification of polymorphism on leptin receptor gene of goats in southwest China. Small Rumin. Res., 96: 120-125. https://doi.org/10.1016/j.smallrumres.2011.01.016
Woronuk, G.N., Marquess, F.L., James, S.T., Palmer, J., Berryere, T., Deobald, H., Howie, S. and Kononoff, P.J., 2012. Association of leptin genotypes with beef cattle characteristics. Anim. Genet., 43: 608-610. https://doi.org/10.1111/j.1365-2052.2012.02320.x
Zhou, H., Hickford, J.G. and Gong H., 2009. Identification of allelic polymorphism in the ovine leptin gene. Mol. Biotechnol., 41: 22-25. https://doi.org/10.1007/s12033-008-9090-3