Refolding of Misfolded Inclusion Bodies of Recombinant α-Amylase: Characterization of Cobalt Activated Thermostable α-Amylase from Geobacillus SBS-4S

Sabah Mansoor1, Muhammad Tayyab1,*, Amna Jawad1, Bushra Munir2, Sehrish Firyal1, Ali Raza Awan1, Naeem Rashid3 and Muhammad Wasim1

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Abdul Qadir Jillani Road, Lahore

2Institute of Industrial Biotechnology, Government College University, Lahore

3School of Biological Sciences, University of The Punjab, Quaid-e-Azam Campus, Lahore

ABSTRACT

The present study deals with the production, refolding and characterization of recombinant α-amylase (AMYSBS) from Geobacillus SBS-4S. AMYSBS exhibited a highest identity of 99.78% with Geobacillus thermoleovorance GTA. E.coli BL21-CodonPlus (DE3) cells were used as host for expression studies of AMYSBS. Recombinant AMYSBS produced as inclusion bodies was transmitted to soluble active form by denaturing the insoluble protein using 8M urea followed by refolding through gradual dialysis. The refolded enzyme exhibited optimum activity at 55 °C between pH 8-9. The effect of metal ions on the activity of AMYSBS showed that Co2+ remarkably enhanced the enzyme activity and 500µM was recorded as optimal Co2+ concentration for the maximal activity of AMYSBS. Presence of ionic (SDS) and nonionic (Tween-20, TritonX-100) detergents showed an enhancing effect on the activity of AMYSBS. Stability studies of AMYSBS exhibited that enzyme was quiet stable at 55 °C. Kinetic studies demonstrated the Km and Vmax values of 6.67mg/ml and 2500µmol min-1 mg-1, respectively when starch was utilized as substrate. To best of our knowledge this is the highest activity among the reported recombinant amylases from genus Geobacillus. Laboratory scale production of reducing sugars from cloth-starch makes AMYSBS a suitable candidate to be used in Textile industry.


Article Information

Received 28 September 2016

Revised 27 March 2017

Accepted 17 March 2018

Available online 25 April 2018

Authors’ Contribution

SM and AJ performed experimental work. MT planned and supervised the study and provided guidance for manuscript writeup. SF, ARA and NR facilitated for the conduction of experiments. BM and MW helped during manuscript writeup.

Key words

Geobacillus, SBS-4S, E.coli, Refolding, α-amylase, AMYSBS.

DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.3.1147.1155

* Corresponding author: [email protected]

0030-9923/2018/0003-1147 $ 9.00/0

Copyright 2018 Zoological Society of Pakistan



Introduction

 

Amylases are widely distributed hydrolytic enzymes involved in the cleavage of α 1-4 glycosidic linkage in starch and other related carbohydrates (Han et al., 2013). Starch is a tasteless polysaccharides produced by all green plants and its structure comprises of monomeric glucose units linked each other through α 1-4 glycosidic linkage (amylose) and α 1-6 glycosidic linkage (amylopectin) (Hemamalini and Dev, 2017). Microorganisms produce amylases to utilize the starch as carbon source in order to fulfil their energy requirement (Onodera et al., 2013). The amylases are required for various industries including the liquefaction and saccharification of starch granules, bakery, as desizing agent in textile and paper industry, brewerage, detergent and pharmaceutical industry and for the production of biofuel (Qi et al., 2012; Chang et al., 2013; Saburi et al., 2013; Basma et al., 2015).

On the basis of amino acid sequence, the amylases/glycosyl hydrolases (GH) can be classified into more than 100 families (http://www.cazy.org/) (Onodera et al., 2013). Starch hydrolyzing enzymes including endoamylase, exoamylase, debranching enzyme and transferase belong to three glycosyl hydrolases families GH13, GH70 and GH77. Most of α-amylases belong to family GH13. Crystal structures of amylases from this family demonstrated the presence of catalytic triad and one arginine residue which are conserved and liable for activity of these enzymes (Matsuura et al., 1984; Buisson et al., 1987). The catalytic site consists of an aspartate residue (catalytic nucleophile), a glutamate residue (general acid/base) and aspartate residue (transition state stabilizer) (Uitdehaag et al., 1999). The fourth conserved arginine is located two amino acids next to catalytic nucleophile (Gregor et al., 2001).

Previously the production of amylases have been reported from animals, plants and microorganisms (Pandey et al., 2000; Qi et al., 2012; Ozturk et al., 2013; Sing and Kayastha, 2014; Qin et al., 2014; Li et al., 2017). The microbial enzymes are preferred due to their ease and economic production (Pandey et al., 2000; Subash et al., 2017). Among α-amylase producing microorganisms, Bacillus sp. are the most extensively studied microbes due to the production of thermostable enzymes (Prakash and Jaiswal, 2010) while α-amylases from some other bacteria with special properties have been reported (Bai et al., 2012; Kumar and Khare, 2012; Li et al., 2017).

Geobacillus are gram positive, endospore forming bacteria, having ability to grow at higher temperatures ranging 37 to 75°C where most of other species fail to survive (Nazina et al., 2001). The enzymes produce by Geobacillus are thermostable having ability to show resistance against extremes of pH, chemical denaturants, organic solvents and detergents (Jorgensen et al., 1977). Geobacillus SBS-4S was isolated and characterized from hot spring present in Northern areas of Pakistan. This strain has ability to produce several industrially important enzymes (Tayyab et al., 2011a). Previously the production and characterization of lipase and carboxypeptidase (Tayyab et al., 2011a, b) from this strain have been reported. Current study deals with the characterization of recombinant α-amylase from this strain.

 

Materials and methods

 

Microbial culture of G. SBS-4S was utilized for the isolation of genomic DNA (Kronstad et al., 1983). Nanodrop (Thermo Scientific, Wilmington, USA) was utilized for the DNA quantification.

PCR amplification of AMYSBS gene

The gene was amplified using AMY-N (5’-CATATGG CGGAAAAAGAAGAACGGACGTGGC) and AMY-C (5’-CTATTCCGGCATCCGCTTCGCCCGTTTTT) as forward and reverse primers, respectively, using genomic DNA from G. SBS-4S as template. The bold sequence in forward primer was the unique restriction site of NdeI. Amylase gene sequence of Geobacillus kaustophillus was utilized for designing the primers, as this is the closest homologue of strain SBS-4S on the basis of 16S rRNA. The amplified PCR product was purified using DNA purification kit (GeneAll, Seoul, Korea).

Cloning of AMYSBS gene in pTZ57R/T

The purified PCR product was ligated in the pTZ57R/T using InsTAclone PCR Cloning Kit (Thermo Scientific, Life Sciences, USA) and this ligated material (pTZ-AMY) was utilized for the transformation of E. coli DH5 α competent cells and selection of positive clones was done on the basis of blue/white screening. Plasmid DNA from selected clones was isolated by alkaline lysis method (Sambrook and Russell, 2001). Restriction digestion using NdeI and HindIII endonucleases was performed to check the presence of insert in the recombinant plasmid (Sabir et al., 2017).

DNA sequencing and phylogenetic analysis

The positive clone after restriction analysis was utilized for DNA sequencing (Sanger et al., 1977). The DNA sequence was submitted in DNA Data Bank, Japan (Accession No. AB971162) and was used for homology and comparative analysis using NCBI BLAST and Clustal Omega Software (Altschul et al., 1990; Thompson et al., 1994). MEGA 4 software was utilized for the construction of phylogenetic tree (Tamura et al., 2007).

Expression studies of AMYSBS gene

The AMYSBS gene was transferred from pTZ-AMY to pET-21a already restricted with the same restriction endonucleases. The ligated vector (pET-AMY) was utilized for the transformation of DH5 α cells. The restriction analysis of pET-AMY was done to analyze the presence of insert in the vector. BL21-CodonPlus (DE3) was used as expression host after transformation using pET-AMY and these transformed cells were utilized for the production of recombinant amylase.

The overnight grown transformed BL21-CodonPlus (DE3) cells were diluted 100 times with fresh Lauria berteni Medium (1% Tryptone, 0.5% Yeast extract, 0.5% NaCl) and was incubated at 37°C till the OD at 660nm reached to 0.4. The cells were induced with 0.1mM Isopropyl-β-D-thiogalactopyranoside (IPTG) followed by incubation for another 4.5h at 37 °C. Cells were harvested by centrifugation (Z300K, Hermle, Germany) at 8,000 rpm for 15 min and re-suspended in 50mM Tris-HCl buffer (pH 8) and were lysed by sonication. The production of soluble or insoluble AMYSBS was examined by SDS-PAGE analysis (Laemmli, 1970). Expression of AMYSBS was also examined at low temperature, for this, the inoculated medium after induction with IPTG, was incubated overnight at 20°C.

Refolding and purification of AMYSBS

The insoluble AMYSBS produced in the form of inclusion bodies was denatured using 8M urea in Tris-HCl buffer (pH 8). The soluble (denatured) protein was separated from insoluble material by centrifugation and the soluble protein was transferred to dialysis tube and the urea was removed by fractional dialysis. The urea free protein sample was centrifuged and supernatant was utilized for the purification. Initially the sample was loaded on pre-equilibrated DEAE-Sephadex column and the unbound protein was removed by washing the column with 50mM Tris-HCl buffer (pH 8) and the elution was done with NaCl gradient. Molecular mass of AMYSBS was determined by Sephadex G-75 size exclusion column chromatography. The elution was done with 50mM Tris-HCl buffer (pH 8). Protein contents of fractions were determined by Bradford (1976) method and the purity was analyzed by SDS-PAGE.

Activity assay

Activity assay mixture (500 µl) was prepared by taking 200 µl of 50mM Tris-HCl buffer (pH 8), 200 µl of 1% starch dissolved in same buffer and 100 µl enzyme solution. The assay mixture was incubated at 55 °C for 30 min and the release of reducing sugars was estimated at 540 nm using Dinitrosalicylic acid (DNS) method (Shah et al., 2014). Standard curve was prepared for glucose and was utilized for the calculation of activity units. One unit of enzyme activity was defined as the amount of enzyme required to release 1 µmol of reducing sugar per min.

Effect of temperature and thermo-stability studies of AMYSBS

Effect of temperature on the activity of AMYSBS was examined at pH 8 using 50 mM Tris-HCl buffer by incubating the reaction mixture at various temperatures ranging 40-70 °C. Thermostability studies of AMYSBS was done at 55 and 60 °C. The enzyme was incubated at the selected temperature and enzyme fractions were withdrawn after regular intervals and were utilized for activity assay as described above.

Effect of pH, metal ions and detergents on the AMYSBS activity

Effect of pH on the AMYSBS activity was examined by measuring the production of reducing sugars at various pH ranging 4-11 using 50 mM of each of acetate buffer (4-5), phosphate buffer (5-7), Tris-HCl buffer (7-9) and glycine/NaOH (9-11) using 0.4% starch as substrate.

In order to examine the effect of metal ions, the activity assay was conducted in the presence of various metal cations (Ca2+, Mg2+, Co2+, Cu2+ and Zn2+) at a final concentration of 1mM. Chloride salts of metal ions were utilized during these studies. Effect of detergents was also examined on the activity of AMYSBS. The activity assay was done in the presence of (0.1%) ionic (SDS) and non-ionic (Tween-20, Tween-80 and Triton X-100) detergents.

Kinetic studies of AMYSBS

AMYSBS activity was recorded with the increasing concentrations of starch (2-10 mg/ml) and the data obtained was utilized for the estimation of kinetic parameters.

Suitability of AMYSBS for textile industries

A piece of cotton cloth (18×9 cm) was incubated at 60 °C with 10% starch for 15 min. The cloth was dried and cut into two equal pieces (9×9 cm). One piece was incubated with enzyme at 55 °C for 30 min in 50 mM Tris-HCl buffer and released reducing sugars was estimated as mentioned above. Second piece was used as negative control and was treated under the same above mentioned conditions except enzyme.

 

Results

Cloning of AMYSBS gene

PCR resulted in the amplification of approximate1.5 kb AMYSBS gene. The AMYSBS gene was ligated in pTZ57R/T. Restriction digestion with NdeI and HindIII resulted in the liberation of insert from the pTZ-AMY which confirmed cloning of AMYSBS gene in pTZ57R/T. The cloned fragment was sequenced. DNA sequence comparison of AMYSBS gene (AB971162) showed sequence similarity (identity) of 99.86% with G. thermoleovorans CCB-US3-UF5 (CP003125), 99.64% with Anoxybacillus amylolyticus (AB908318), 99.43% with Geobacillus sp. GXS1 (FJ481119), 94.11% with G. kaustophilus (BA000043) and 92.26% with Geobacillus sp. GHH01 (CP004008).

 

 

Phylogenetic analysis of AMYSBS

Phylogenetic analysis on the basis of amino acid sequence of AMYSBS with the reported amylases indicated that AMYSBS clustered with various members of genus Geobacillus in clade A (Fig. 1). Among the characterized members of Geobacillus, GTA amylase from G. thermoleovorance CCB-US3-UF5 was recorded to be the closest neighbor of AMYSBS as both the amylases shared a sequence identity of 99.79% on the basis of amino acid sequence. This analysis indicated that the GH family 13 (clade A, Fig. 1) and 77 (clade B, Fig. 1) has been evolved from a common ancestor whereas these two families share less homology with GH family 70 (clade C, Fig. 1).

Comparative analysis of AMYSBS

Comparative analysis of AMYSBS amino acid sequence with various members of Geobacillus showed sequence identity of 99.79% with G. thermoleovorans CCB_US3_UF5 (4E2O) and Geobacillus sp. MAS1 (WP023633941); 98.94% with Geobacillus sp. GXS1 (ACK58047); 98.09% with Geobacillus sp. WSUCF1 (WP020755052); 97.03% with G. kaustophilus (WP020279340) and 96.4% with G. sp. GHH01 (WP015374071). G. thermoleovorans was the only reported member from this genus with the fully characterized recombinant amylase (GTA) which belongs to GH family 13. Sequence comparison demonstrated the conserved amino acids for incorporation of Metal-I (Asn7, Asp9, Asn12 and Asp13) and Metal-II (Asn102, Glu136, Asp145 and His180) while three amino acids Asp176, Glu205 and Asp273 (AMYSBS numbering) were active site residues essential for the activity (Fig. 2).

Expression studies of AMYSBS gene

In-order to examine the expression studies, the AMYSBS gene was sub-cloned in pET-21a. The restriction digestion of pET-AMY using Nde1 and HindIII resulted in the liberation of 1.5 kb AMYSBS gene fragment. SDS-PAGE analysis of expressed protein indicated that almost 95% of the AMYSBS was produced in the form of inclusion bodies (lane 3, Fig. 3) and 5% as soluble protein (lane 4, Fig. 3). Same pattern of production was reported for recombinant lipase from this strain (Tayyab et al., 2011a). The production of AMYSBS was also examined at low temperature (20 °C) but the decrease in temperature could not produce the AMYSBS in active form. It was difficult to purify the AMYSBS from soluble fraction due to its low quantity (lane 4, Fig. 3). The refolding of the AMYSBS resulted in conversion of inactive inclusion bodies to properly folded active protein. The purified protein (lane 5, Fig. 3) after column chromatography was utilized for the characterization of AMYSBS.

 

 

Effect of temperature and pH on AMYSBS activity

Effect of temperature on the AMYSBS activity (Fig. 4A) demonstrated that the activity was increased with the increase in temperature from 40 to 55°C whereas further increase in temperature beyond 55°C resulted in the decreased enzyme activity. The optimal temperature for the activity was recorded as 55°C. Thermostability studies showed that the protein remained stable at 55°C even after half an hour whereas more than 50% residual activity was recorded after 15 min when the protein was incubated at 60°C (data not shown). When the activity was examined at various pH (Fig. 4B), it was observed that increase in pH from 4 to 8 resulted in the increased AMYSBS activity with the optimal activity between pH 8 to 9 in 50 mM Tris HCl buffer, whereas a decline in the activity was recorded at pH above 9.

 

 

Effect of metal ions and detergents on the AMYSBS activity

No significant effect on the AMYSBS activity was recorded in the presence of 1 mM Cu2+ or Zn2+, whereas slight enhancing effect on the activity was observed when enzyme assay was done in the presence of Ca2+ or Mg2+ at same concentration. A 3.4 folds enhancement in the activity was recorded in the presence of 1 mM Co2+ (Table I) which demonstrated that AMYSBS requires Co2+ as cofactor and 500 µM Co2+ was recorded as the concentration for the optimal AMYSBS activity. Presence of ionic and non-ionic detergents showed an enhancing effect on AMYSBS activity. Tween 80 and SDS showed a respective increase of 4.3 and 4 times in enzyme activity when used at a final concentration of 0.1% (Table I). AMYSBS activity was slightly enhanced in the presence of Triton X-100.

 

Table I.- Effect of metal ions and detergents on AMYSBS activity.

Divalent cation or detergent

Relative activity

None

100

Metala

1mM

 

Zn2+

115

 

Cu2+

105

 

Mg2+

169

 

Ca2+

138

 

Co2+

346

Detergent

0.1%

  Triton X-100

195

  Tween 20

133

  Tween 80

435

  SDS

408

aMetal chlorides were used in the essay.

 

Kinetic studies of AMYSBS

A linear increase in activity was observed when the concentration of starch was increased from 2 to 10 mg/ml. The data was utilized for plotting the Line-Weaver Burk Plot (Fig. 5). The kinetic parameters km and Vmax were recorded as 6.67mg/ml and 2500µmol min-1 mg-1 respectively. Suitability of AMYSBS for textile industry was examined at laboratory scale. The incubation of AMYSBS with starch containing cloth resulted in the release of 634 µmoles of reducing sugars as compared to control at 55°C.

 

Discussion

 

Aim of the study was to clone and characterize the amylase from locally isolated Geobacillus SBS-4S as amylases have vital importance and are required by various industries. On the basis of 16SrRNA gene sequence, G. kaustophilus was reported to be the closest homologue of Geobacillus SBS-4S (Tayyab et al., 2011a) whereas the amylase from this strain (present study) showed maximum identity with G. thermoleovorans while the lipase from this microbe was found more closer to Geobacillus stearothermophilus (Tayyab et al., 2011a).

AMYSBS showed maximal production of 2500 µmol min-1 mg-1 that is quiet higher as compared to naturally produced 500 µmol min-1 mg-1 by G. thermoleovorans (Maheswar and Satyanarayana, 2007) or 222 µmol min-1 mg-1 by Geobacillus sp. IIPTN (Dheeran et al., 2010) or 330 µmol min-1 mg-1 by G. thermoleovorans subsp. (Ilaria et al., 2011). Whereas a higher level of production was recorded in some bacilli, that could produce 4,133 U mg-1 by Bacillus subtilis AX20 (Najafi et al., 2005) or 3,239 U mg-1 by Alicyclobacillus acidocaldarius (Satheesh et al., 2010).

 

 

Previous reports demonstrated that Ca2+ act as cofactor and involved in the stabilization of amylases from G. Stearothermophilus, G. thermoleovorans, A. acidocaldarius and B. subtilis (Konsula and Liakopoulou, 2004; Satheesh et al., 2010; Ilaria et al., 2011; Fincan and Baris, 2014) but AMYSBS showed maximum activity in the presence of Co2+ while Ca2+ didn’t put significant effect on the activity of this enzyme. Same pattern of behavior was reported for amylases from G. thermoleovorans and Anoxybacillus flavithermus (Maheswar and Satyanarayana, 2007; Aguloglu et al., 2014). On the other hand, presence of Ca2+ showed an inhibitory effect on the amylase activity from Anoxybacillus flavithermus (Aguloglu et al., 2014) whereas, both Ca2+or Co2+ put inhibitory effect on amylase activity from Bacillus sp. TM1 (Sajedi et al., 2004).

 

Conclusion

 

In this study we produced the recombinant α-amylase from locally isolated Geobacillus SBS-4S and the insoluble and inactive AMYSBS was refolded to soluble active form that was utilized for the characterization. AMYSBS showed a high level of activity at a broad range of temperature and pH. Moreover, release of reducing sugars due to hydrolysis of starch from cotton cloth, make it a suitable candidate for its use in textile industry.

 

Acknowledgements

 

This work was supported by Higher Education Commission of Pakistan.

 

Statement of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this article.

 

References

 

Aguloglu, F.S., Enez, B., Ozdemir, S. and Matpan, B.F., 2014. Purification and characterization of thermostable α-amylase from thermophilic Anoxybacillus flavithermus. Carbohyd. Polym., 102: 144-150. https://doi.org/10.1016/j.carbpol.2013.10.048

Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J., 1990. Basic local alignment search tool. J. mol. Biol., 215: 403-410. https://doi.org/10.1016/S0022-2836(05)80360-2

Bai, Y., Huang, H., Meng, K., Shi, P., Yang, P., Luo, H., Luo, C., Feng, Y. and Zhang, W., 2012. Identification of an acidic α-amylase from Alicyclobacillus sp. A4 and assessment of its application in the starch industry. Fd. Chem., 131: 1473-1478. https://doi.org/10.1016/j.foodchem.2011.10.036

Basma, T., Elhalem, A., Sawy, M.E., Rawia, F.G., Khadiga, A. and Talib, A., 2015. Annals of Agriculture Science. Production of amylases from Bacillus Amyloliquefaciens under submerged fermentation using some agro-industrial by-products. Annls. Agric. Sci., 60: 193-202. https://doi.org/10.1016/j.aoas.2015.06.001

Bradford, M.M., 1976. A dye binding assay for protein. Anal. Biochem., 72: 248-254. https://doi.org/10.1016/0003-2697(76)90527-3

Buisson, G., Duee, E., Haser, R. and Payan, F., 1987. Three dimensional structure of porcine pancreatic alpha-amylase at 2.9 a resolution: Role of calcium in structure and activity. EMBO J., 6: 3909-3916.

Chang, J., Yong, S.L., Shu, J.F., Inhye, P. and Yong, L.C., 2013. Recombinant expression and characterization of an organic-solvent-tolerant α-amylase from Exiguobacterium sp. DAU5. Appl. Biochem. Biotechnol., 169: 1870-1883. https://doi.org/10.1007/s12010-013-0101-x

Dheeran, P., Kumar, S., Jaiswal, Y.K. and Adhikari, D.K., 2010. Characterization of hyperthermostable α-amylase from Geobacillus sp. IIPTN. Appl. Microbiol. Biotechnol., 86: 1857-1866. https://doi.org/10.1007/s00253-009-2430-9

Fincan, S.A. and Baris, E., 2014. Production, purification, and characterization of thermostable α -amylase from thermophilic Geobacillus stearothermophilus. Starch, 66: 182-189. https://doi.org/10.1002/star.201200279

Gregor, M.E.A., Janecek, S. and Svensson, B., 2001. Relationship of sequence and structure to specificity in the alpha-amylase family of enzymes. Biochem. Biophys. Acta, 1546: 1-20. https://doi.org/10.1016/S0167-4838(00)00302-2

Han, P, Zhou, P., Hu, S., Yang, S., Qiaojuan, Y. and Zhengqiang, J., 2013. A novel multifunctional α-amylase from the thermophilic fungus Malbranchea cinnamomea: Biochemical characterization and three-dimensional structure. Appl. Biochem. Biotechnol., 170: 420-435. https://doi.org/10.1007/s12010-013-0198-y

Hemamalini, T. and Dev, V.R.G., 2017. Comprehensive review on electrospinning of starch polymer for biomedical applications. Int. J. Biol. Macromol., 106: 712-718. https://doi.org/10.1016/j.ijbiomac.2017.08.079

Ilaria, F., Ceyda, K., Annarita, P., Ida, R., Ebru, T.O., Betul, K., Laura, D., Barbara, N. and Licia, L., 2011. Purification, biochemical characterization and gene sequencing of a thermostable raw starch digesting α-amylase from Geobacillus thermoleovorans subsp. stromboliensis subsp. nov. World J. Microbiol. Biotechnol., 27: 2425-2433. https://doi.org/10.1007/s11274-011-0715-5

Jorgensen, S., Vorgias, C.E. and Antranikian, G., 1977. Cloning sequencing and expression of an extracellular α-amylase from the hyperthermophilic archeon Pyrococccus furiosus in Escherichia coli and Bacillus subtilis. J. biol. Chem., 272: 1599-1616.

Konsula, Z.M. and Liakopoulou, K., 2004. Hydrolysis of starches by the action of an α-amylase from Bacillus subtilis. Process Biochem., 39: 1745-1749. https://doi.org/10.1016/j.procbio.2003.07.003

Kronstad, J.W., Schnepf, H.E. and Whiteley, H.R., 1983. Diversity of locations for Bacillus thuringiensis crystal protein genes. J. Bact., 154: 419-428.

Kumar, S. and Khare, S.K., 2012. Purification and characterization of maltooligosaccharide-forming α-amylase from moderately halophilic Marinobacter sp. EMB8. Bioresour. Technol., 116: 247-251. https://doi.org/10.1016/j.biortech.2011.11.109

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685. https://doi.org/10.1038/227680a0

Li, X., Wang, Y., Park, J.T., Gu, L. and Li, D., 2017. An extremely thermostable maltogenic amylase from Staphylothermus marinus: Bacillus expression of the gene and its application in genistin glycosylation. Int. J. biol. Macromol., 107: 413-417. https://doi.org/10.1016/j.ijbiomac.2017.09.007

Maheswar, U.R.L. and Satyanarayan, T., 2007. Purification and characterization of a hyperthermostable and high maltogenic α-amylase of an extreme thermophile Geobacillus thermoleovorans. Appl. Biochem. Biotechnol., 142: 179-193. https://doi.org/10.1007/s12010-007-0017-4

Matsuura, Y., Kusunoki, M., Harada, W. and Kakudo, M., 1984. Structure and possible catalytic residues of Taka-amylase A. J. Biochem., 95: 697-702. https://doi.org/10.1093/oxfordjournals.jbchem.a134659

Najafi, M.F., Deobagkar, D. and Deobagkar, D., 2005. Purification and characterization of an extracellular α-amylase from Bacillus subtilis AX20. Protein Expr. Purif., 41: 349-354. https://doi.org/10.1016/j.pep.2005.02.015

Nazina, T.N., Tourova, T.P., Poltaraus, A.B., Novikova, E.V., Grigoryan, A.A., Ivanova, A.E., Lysenko, A.M., Petrunyaka, V.V., Osipov, G.A. and Belyaev, S.S., 2001. Taxonomic study of aerobic thermophilic bacilli: description of Geobacillus subteaneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovolans, Bacillus kaustophilus, Bacillus thermoglusidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovolans, G. kaustophilus, G. thermoglusidasius and G. thermodenitrificans. Int. J. Syst. Evol. Microbiol., 51: 433-446. https://doi.org/10.1099/00207713-51-2-433

Ozturk, M.T., Nagihan, A., Saliha, I.O. and Fusun, G., 2013. Ligase-independent cloning of amylase gene from a local Bacillus subtilis isolate and biochemical characterization of the purified enzyme. Appl. Biochem. Biotechnol., 171: 263-278. https://doi.org/10.1007/s12010-013-0331-y

Onodera, M., Yatsunami, R., Sukimura, W.T., Fukui, T., Nakasone, K., Takashina, T. and Nakamura, S., 2013. Gene analysis, expression, and characterization of an intracellular α-amylase from extremely halophilic archaeon Haloarcula japonica. Biosci. Biotechnol. Biochem., 77: 281-288. https://doi.org/10.1271/bbb.120693

Pandey, A., Nigam, P., Soccol, C.R., Soccol, V.T., Singh, D. and Mohan, R., 2000. Advances in microbial amylases. Biotechnol. appl. Biochem., 31: 135-152. https://doi.org/10.1042/BA19990073

Prakash, O. and Jaiswal, N., 2010. α-Amylase: An ideal representative of thermostable enzymes. Appl. Microbiol. Biotechnol., 160: 2401-2414. https://doi.org/10.1007/s12010-009-8735-4

Qi, Y., Zhang, C., Guo, F., Wang, S., Bie, X., Lu, F. and Lu, Z., 2012. Secreted expression of a hyperthermophilic α-amylase gene from Thermococcus sp. HJ21 in Bacillus subtilis. J. mol. Microbiol. Biotechnol., 22: 392-398. https://doi.org/10.1159/000346215

Qin, Y., Zongqing, H. and Ziduo, L., 2014. A novel cold-active and salt-tolerant α-amylase from marine bacterium Zunongwangia profunda: molecular cloning, heterologous expression and biochemical characterization. Extremophiles, 18: 271-281. https://doi.org/10.1007/s00792-013-0614-9

Sabir, F., Tayyab, M., Muneer, B., Hashmi, A.S., Awan, A.R., Rashid, N., Wasim, M. and Firyal, S., 2017. Characterization of recombinant thermostable phytase from Thermotoga naphthophila: A step for the fulfilment of domestic requirement of phytase in Pakistan. Pakistan J. Zool., 49: 1945-1951. http://dx.doi.org/10.17582/journal.pjz/2017.49.6.1945.1951

Saburi, W., Morimoto, N., Mukai, A., Kim, D.H., Takehana, T., Koike, S., Matsui, H. and Mori, H., 2013. A thermophilic alkalophilic α-amylase from Bacillus sp. AAH-31 shows a novel domain organization among glycoside hydrolase family 13 enzymes. Biosci. Biotechnol. Biochem., 77: 1867-1873. https://doi.org/10.1271/bbb.130284

Sajedi, R.H., Naderi, M.H., Khajeh, K., Ranjbar, B., Ghaemi, N. and Naderi, M.M., 2004. Purification, characterization and structural investigation of a new moderately thermophilic and partially calcium-independent extracellular α-Amylase from Bacillus sp. TM1. Appl. Biochem. Biotechnol., 119: 41-50. https://doi.org/10.1385/ABAB:119:1:41

Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual, third ed. Cold Spring Harbor Laboratory, Cold Spring Harbor Press, New York, pp. 31-125.

Sanger, F., Nicklen, S. and Coulson, A.R., 1977. DNA sequencing with chain-terminating inhibitors. Proc. natl. Acad. Sci. U.S.A., 74: 5463-5467. https://doi.org/10.1073/pnas.74.12.5463

Satheesh, G.K., Subhosh, M.C., Mallaiah, K.V., Sreenivasulu, P. and Yong, L.C., 2010. Purification and characterization of highly thermostable α-amylase from thermophilic Alicyclobacillus acidocaldarius. Biotechnol. Bioproc. Eng., 5: 435-440. https://doi.org/10.1007/s12257-009-0072-5

Shah, I.J., Gami, P.N., Shukla, R.M. and Acharya, D.K., 2014. Optimization for α-amylase production by Aspergillus oryzae using submerged fermentation technology. Basic Res. J. Microbiol., 1: 1-10.

Singh, K. and Kayastha, A.M., 2014. α-Amylase from wheat (Triticum aestivum) seeds: Its purification, biochemical attributes and active site studies. Fd. Chem., 162: 1-9. https://doi.org/10.1016/j.foodchem.2014.04.043

Subash, C.B.G., Anbu, P., Arshad, M.K.M.D., Lakshmipriya, T., Voon, C.H., Hashim, U. and Chinni, S.V., 2017. Biotechnological processes in microbial amylase production. BioMed Res. Int., 2017: Article ID 1272193. https://doi.org/10.1155/2017/1272193

Tamura, K., Dudley, J., Nei, M. and Kumar, S., 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24: 1596-1599. https://doi.org/10.1093/molbev/msm092

Tayyab, M., Rashid, N. and Akhtar, M., 2011a. Isolation and identification of lipase producing thermophilic Geobacillus sp. SBS-4S: Cloning and characterization of the lipase. J. Biosci. Bioeng., 111: 272-278. https://doi.org/10.1016/j.jbiosc.2010.11.015

Tayyab, M., Rashid, N., Angkawidjaja, C., Kanaya, S. and Akhtar, M., 2011b. Highly active metal locarboxypeptidase from newly isolated Geobacillus strain SBS-4S: Cloning and characterization. J. Biosci. Bioeng., 111: 259-265. https://doi.org/10.1016/j.jbiosc.2010.11.002

Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22: 4673-4680. https://doi.org/10.1093/nar/22.22.4673

Uitdehaag, J.C., Mosi, R., Kalk, K.H., Veen, B.A., Dijkhuizen, L., Withers, S.G. and Dijkstra, B.W., 1999. X-ray structures along the reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol., 6: 432-436. https://doi.org/10.1038/8235