Antimicrobial Resistance of Escherichia coli Isolates from Mastitic Milk and its Possible Relationship with Resistance and Virulence Genes
Aqeela Ashraf1,2,*, Muhammad Imran1 and Yung-Fu Chang2
1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, Pakistan
2Department of Population Medicine and Diagnostic Sciences, Cornell University, Ithaca, NY, USA
ABSTRACT
Mastitis caused by Escherichia coli is a notable threat to dairy industry due to its high genetic variability, enormous number of environmental sources and increased resistance to antibiotics. The present study was aimed to determine the antimicrobial resistance of E. coli isolates from bovine mastitis and identification of antimicrobial resistance and virulence genes associated with them. Antimicrobial susceptibility testing was performed by disk diffusion method. Resistance and virulence genes were detected by PCR. The results showed that 100% of isolates were resistant to penicillin, 54% to ampicillin, 44% to tetracycline and 30% to streptomycin, while none of them was resistant to chloramphenicol. These E. coli isolates carried one or more antimicrobial resistance genes. Genes present with highest frequency were tetA (42%), tetB (28%) and ampC (26%). Fewer E. coli isolates carried tetD (10%), tetE (8%) and tetG (8%) genes. None of the isolates was positive for bla2 resistance genes. PCR results of virulence genes confirmed that 66% of strains were carrying the traT gene, 26% the Shiga toxin gene and 16% the intimin (eae) gene, while all strains were negative for aerobactin gene. Conclusively, E. coli isolates were resistant to at least two or more antibiotics, irrespective of presence or absence of relevant resistance and virulence genes.
Article Information
Received 21 November 2017
Revised 20 December 2017
Accepted 02 January 2018
Available online 20 June 2018
Authors’ Contribution
MI and YC conceived and designed the study, and supervised the work. AA carried out experimental work and wrote the manuscript.
Key words
Antimicrobial resistance, Bovine mastitis, E. coli, Resistance genes, Virulence genes.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.4.1435.1441
* Corresponding author: [email protected]
0030-9923/2018/0004-1435 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introduction
Bovine mastitis is one of the most important and costly diseases of the dairy industry (Hogeveen et al., 2011). E. coli is among the most prevalent bacteria in an environment with high degree of genetic variability, so it is difficult to control and eliminate from dairy herds. It is one of the most common opportunistic environmental pathogens, which causes bovine mastitis. Severity of intra-mammary infection depends on host characteristics (Burvenich et al., 2003). Antibiotic resistance cases are increasing remarkably due to their excessive use and high rates of antibiotic resistance transfer between different bacteria (Kahlmeter and Poulsen, 2012). Various studies were performed to find out the relationship between virulence factors of E. coli and its pathogenicity for causing mastitis, but no association was observed (Suojala et al., 2011; Wenz et al., 2006).
Antimicrobial resistant phenotypes and their genetic determinants may have an association with specific epidemiological features. To understand and control antimicrobial resistance, evaluation of antimicrobial resistance genes and virulence factors is important (Seyda et al., 2014). Antibiotic resistance and virulence genes could be located on the same chromosomal structures or plasmids, the evaluation of these virulence factors and antibiotic resistance genes can be helpful (Bean et al., 2004; Suojala, 2010).
The emergence of antimicrobial resistance among E. coli strains of animal origin is a critical public health issue worldwide (Copur-Cicek et al., 2014; Paterson, 2006). Several studies also explained that antimicrobial resistant E. coli infections in humans are often due to strains coming from animal sources (Altalhi et al., 2010; Lei et al., 2010; Rasheed et al., 2014). Antibiotics used for humans and animals are closely related, overuse of these drugs resulted into emergence of multidrug-resistant bacteria (Cantas et al., 2013; Walther et al., 2017). The present study was performed to investigate antimicrobial resistance and the frequency of resistance genes and virulence factors in E. coli isolates from bovine mastitis.
Materials and Methods
Sample collection
In this study fifty E. coli strains isolated from mastitic milk were collected from Quality Milk Production Services, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA. These E. coli were picked randomly from the isolates collected in the last five years. E. coli cultures, stored in Luria-Bertani medium and glycerol, were sub-cultured on tryptic soy agar for further use in the current study.
Antimicrobial sensitivity testing
Antimicrobials were tested for susceptibility by the Kirby-Bauer disk diffusion method using Mueller-Hinton agar (Sigma-Aldrich, USA), following Clinical and Laboratory Standards Institute (CLSI) standard guidelines. The antimicrobial agents tested were ampicillin (10μg), chloramphenicol (30μg) penicillin (10μg), streptomycin (10μg) and tetracycline (30μg). The quality control strain used was E. coli American Type Culture Collection (ATCC) 25922. Plates were incubated for 18 to 24 h at 37°C and sensitivity was tested for E. coli isolates against all antimicrobial agents, and the results were inferred according to the criteria given by Clinical Laboratory Standards Institute guidelines (Patel et al., 2015).
Table I.- Oligonucleotide primers used to detect antimicrobial resistance genes and virulence genes.
| Target gene | Primer sequence | Size (bp) | Reference |
| Resistance genes | |||
| tetA | F: GGCCTCAATTTCCTGACG | 372 | |
| R: AAGCAGGATGTAGCCTGTGC | |||
| tetB | F: GAGACGCAATCGAATTCGG | 228 | |
| R: TTTAGTGGCTATTCTTCCTGCC | |||
| tetC | F: TGCTCAACGGCCTCAACC | 397 | |
| R: AGCAAGACGTAGCCCAGCG | |||
| tetD | F: GGATATCTCACCGCATCTGC | 436 | |
| R: CATCCATCCGGAAGTGATAGC | |||
| tetE | F: TCCATACGCGAGATGATCTCC | 442 | |
| R: CGATTACAGCTGTCAGGTGGG | |||
| tetG | F: CAGCTTTCGGATTCTTACGG | 844 | |
| R: GATTGGTGAGGCTCGTTAGC | |||
| cmlA | F: CCGCCACGGTGTTGTTGTTATC | 698 | |
| R: CACCTTGCCTGCCCATCATTAG | |||
| strA | F: CTTGGTGATAACGGCAATTC | 548 | |
| R: CCAATCGCAGATAGAAGGC | |||
| strB | F: ATCGTCAAGGGATTGAAACC | 509 | |
| R: GGATCGTAGAACATATTGGC | |||
| aadA | F: GTGGATGGCGGCCTGAAGCC | 525 | |
| R: AATGCCCAGTCGGCAGCG | |||
| ampC | F: TTCTATCAAMACTGGCARCC | 1048 | |
| R: CCYTTTTATGTACCCAYGA | |||
| bla1 | F: TCGCCTGTGTATTATCTCCC | 768 | |
| R: CGCAGATAAATCACCACAATG | |||
| bla2 | F: TGGCCAGAACTGACAGGCAAA | 462 | |
| R: TTTCTCCTGAACGTGGCTGGC | |||
| Virulence genes | |||
| eae | F: ATATCCGTTTTAATGGCTATCT | 425 | |
| R: AATCTTCTGCGTACTGTGTTCA | |||
| aer | F: TACCGGATTGTCATATGCAGACCGT | 602 | |
| R: AATATCTTCCTCCAGTCCGGAGAAG | |||
| traT | F: GATGGCTGAACCGTGGTTATGCACA | 307 | |
| R: CGGGTCTGGTATTTATGC | |||
| stx1 | F: ATAAATCGCCATTCGTTGACTACAG | 180 | |
| R: AACGCCCACTGAGATCATCGGCACT | |||
| stx2 | F: GTCTGAAACTGCTCCTCGCCAGTTA | 255 | |
| R: TCGCCAGTTATCTGACATTCTG | |||
DNA isolation
E. coli isolates were sub-cultured in Luria-Bertani broth (Merck, Germany) overnight. Genomic DNA was isolated from these cultures by Qiagen DNeasy Blood and Tissue Kit (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. The concentration of genomic DNA was determined using Nanodrop 2000c (Thermo Fischer Scientific Inc., Waltham, MA, USA) and stored at −20oC until further use.
PCR amplification
Oligonucleotide primers used for PCR amplification of resistance and virulence genes are given in Table I. PCR reaction mixtures were prepared in a total volume of 25 μL containing 1.5 μL MgCl2, 2.5 μL PCR buffer, 200 μM dNTPs, 1 μM each primer, 5 U of Taq DNA polymerase, and 1 μL (50–200 ng/μL) of DNA. PCR reaction mixtures were thermally denatured for 5 min at 95 °C, followed by 30 cycles of 1 min at 94 °C, 60 s at 52-58 °C (annealing temperature varied according to primer pairs) and 1 min at 72 °C. A final extension step of 10 min at 72 °C was also performed. PCR products were analyzed by using 1.2 to 1.5% agarose gels, depending on the fragment size of PCR product.
PCR was also performed to detect the virulence genes encoding intimin (eaeA), outer membrane protein (traT), aerobactin (aer) and Shiga toxin (stx1 and stx2). PCR was carried out in a total volume of 25 μL containing 1× PCR buffer, 1.5 mM of MgCl2, 250 μM of each of dNTPs, 0.5 μM of each of the virulence gene-specific primers, 1.5 U of Taq DNA polymerase (Sigma) and 2 μL of template DNA. The thermal PCR profile included initial denaturation at 95°C for 30 s, followed by 35 cycles of 94 °C for 30 s, 50-60 °C for 45 s (annealing temperature varied according to primer pairs) and 70 °C for 90 s. A final extension step of 10 min at 72 °C was also performed (Güler et al., 2008). The PCR products were analyzed by 1.5% agarose gel electrophoresis.
Results and Discussion
Antimicrobial susceptibility testing
Antimicrobial susceptibility of E. coli strains, isolated from randomly collected mastitic milk samples, was evaluated to five commonly used antimicrobials, as shown in Figure 1. Percentage of multidrug resistant isolates, which are resistant to two or more antimicrobials, was high. In fact, all E. coli isolates were resistant to two or more antimicrobials under study.
All E. coli isolates were completely resistant to penicillin as shown in Figure 2. It has been reported that E. coli is intrinsically resistant to some of the antibiotics including penicillin (Greenway and England, 1999). If we compare the resistance patterns of these commonly used antibiotics to a study conducted by Srinivasan et al. (2007) almost ten years ago in the same area, we can see a remarkable difference. Ampicillin resistance has decreased fundamentally from 98.4% to 54% in this study. Similarly, streptomycin resistance has also decreased from 40.3% to 30%. However, tetracycline resistance in E. coli isolates increased from 24.8% to 44%. None of the isolates was resistant to chloramphenicol. The reason for this can be attributed to the fact that it is not commonly used in the herd. Chloramphenicol is not allowed to be used as veterinary medicine in the United States since the 1980s (Gilmore, 1986). Tetracycline resistance found in 44% of E. coli isolates in this study is higher than reported by San Martín et al. (2002) and Lanz et al. (2003). According to these studies, 20.6% and 20% of E. coli isolates from bovine mastitis were resistant to tetracycline, respectively. In some other studies, tetracycline resistance of E. coli isolates from bovine mastitis was found to be 33.2% (Erskine et al., 2002) and 62% (Lehtolainen et al., 2003). Ampicillin resistance, which is 54% in this study, is high as compared to some previously reported studies, where 15.7% (Makovec and Ruegg, 2003) and 21.9% (Erskine et al., 2002) of E. coli isolates from bovine mastitis appeared as ampicillin resistant. Various factors contribute to the difference in resistance pattern in this study and previously reported studies. They include differences in sensitivity of assays, microbial culture conditions and identification, sampling conditions and area of sampling, initial exposure to antibiotics, etc. However, antibiotic administration for treatment of gram negative mastitis is not recommended (Suojala et al., 2013).
Table II.- Percentage of occurrence of antimicrobial resistance genes in E. coli isolates from mastitic milk.
| Gene | tetA | tetB | tetC | tetD | tetE | tetG | cmlA | strA | strB | aadA | ampC | bla1 | bla2 |
| Occurrence (n=50) | 21 | 14 | 3 | 5 | 4 | 4 | 1 | 12 | 2 | 6 | 13 | 2 | 0 |
| Percentage | 42% | 28% | 6% | 10% | 8% | 8% | 2% | 24% | 4% | 12% | 26% | 4% |
0 |
Antimicrobial resistance genes
Antimicrobial resistance genes were found in various combinations among different E. coli isolates. Most of E. coli (78%) isolates were resistant to more than one antibiotic under study. Similarly, they were positive for more than one antimicrobial resistance genes as mentioned in Table II. Results indicated that 31 of E. coli isolates contained at least two antimicrobial resistance genes, 16 carried three of the genes tested and five isolates carried four antimicrobial resistance genes; however, combinations were different.
Antimicrobial resistance genes tetA, tetB and ampC were most frequent and they were found in 42%, 28%, and 26% of isolates, respectively. Fewer E. coli isolates carried tetD (10%), tetE (8%) and tetG (8%) genes. bla2 genes were not found in any of the E. coli isolates under study.
In total, 20% of E. coli isolates resistant to tetracycline were not positive for any tet gene, suggesting that other genes conferring tetracycline resistance might have been responsible for the observed resistance. Also, 26% of E. coli isolates resistant to ampicillin and streptomycin did not carry any of the tested antimicrobial resistance genes, suggesting that other mechanisms or genes might have contributed to the observed resistance phenotype. None of the E. coli strain was resistant to chloramphenicol, but cmlA gene was detected in one of the sample. There was no association of specific pattern seen that could be linked with penicillin resistance.
In the present study, the strong associations observed among various antimicrobial resistance genes raise the possibility that a selective pressure due to the use of one antimicrobial during livestock production may result in the dissemination of strains carrying resistance genes for other antimicrobials. Resistance to aminoglycosides, beta-lactams, chloramphenicol, sulfonamides, tetracycline and trimethoprim has been acquired by E. coli strains from other microorganisms (Lietzau et al., 2006).
In general, antibiotic resistance profiles of E. coli isolates demonstrated that a large percentage of isolates were resistant to the majority of antibiotics tested. Most of E. coli isolates were found to be resistant to two or more antibiotics tested, but did not essentially contain resistant gene responsible for the conferred resistance.
Virulence genes
PCR results of virulence genes showed that 33 (66%) strains were carrying the traT gene, 11 (22%) the stx1 gene, 4 (2%) the stx2 gene, 8 (16%) the intimin (eae) gene, while all strains were negative for aer gene as shown in Table III. In another recently reported study, the percentage of eae gene was found to be 14.8%; however, stx1 and stx2 genes were not detected in any of pathogenic E. coli isolates (Dong et al., 2017). The isolates were jointly evaluated for antibiotic susceptibility and virulence properties. However, in some cases there was no significant difference in virulence genes between antibiotic-resistant and antibiotic-susceptible strains.
Table III.- Percentage of occurrence of virulence genes in E. coli isolates from mastitic milk.
| Gene |
eae |
aer |
traT |
stx1 |
stx2 |
| Occurrence (n=50) |
8 |
0 |
33 |
11 |
2 |
| Percentage |
16% |
0% |
66% |
22% |
4% |
The distribution of resistance genes and virulence genes was variable and could not be accounted fully for antimicrobial resistance as there were many isolates showing susceptibility to a particular antibiotic and carrying the resistance gene for that as well. However, in a few cases antimicrobial resistance was associated with the identified resistance genes. Increased incidence of antimicrobial resistance and growing demand of animal based proteins for human consumption is very challenging. The above-mentioned concerns made it more difficult to control dairy animal diseases due to limited availability of suitable antibiotics (Ganda et al., 2016).
Conclusion
The antimicrobial resistance of E. coli isolates from bovine mastitis was found to be higher against commonly used antibiotics in dairy industry, which include ampicillin, streptomycin, and tetracycline. Various resistance and virulence genes were also detected in these isolates, but no relationship was established on the basis of results obtained. The discovery of underlying dynamics of these antimicrobial resistant pathogens may lead to better control and prevention of bovine mastitis.
Acknowledgments
We are grateful to Quality Milk Production Services (QMP), Cornell University, Ithaca, NY, USA for providing bacterial strains and Higher Education Commission of Pakistan for providing funding to accomplish this work.
Animal rights statement
Not applicable.
Statement of conflict of interest
Authors declare no conflict of interest.
References
Altalhi, A.D., Gherbawy, Y.A. and Hassan, S.A., 2010. Antibiotic resistance in Escherichia coli isolated from retail raw chicken meat in Taif, Saudi Arabia. Foodb. Pathog. Dis., 7: 281-285. https://doi.org/10.1089/fpd.2009.0365
Bean, A., Williamson, J. and Cursons, R.T., 2004. Virulence genes of Escherichia coli strains isolated from mastitic milk. Zoon. Publ. Hlth., 51: 285-287. https://doi.org/10.1111/j.1439-0450.2004.00772.x
Burvenich, C., Van Merris, V., Mehrzad, J., Diez-Fraile, A. and Duchateau, L., 2003. Severity of E. coli mastitis is mainly determined by cow factors. Vet. Res., 34: 521-564. https://doi.org/10.1051/vetres:2003023
Cantas, L., Shah, S.Q.A., Cavaco, L.M., Manaia, C.M., Walsh, F., Popowska, M., Garelick, H., Bürgmann, H. and Sørum, H., 2013. A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front. Microbiol., 4: 96. https://doi.org/10.3389/fmicb.2013.00096
Copur-Cicek, A., Ozgumus, O.B., Saral, A. and Sandalli, C., 2014. Antimicrobial resistance patterns and integron carriage of Escherichia coli isolates causing community-acquired infections in Turkey. Annls. Lab. Med., 34: 139-144. https://doi.org/10.3343/alm.2014.34.2.139
Dong, H., Zhang, H., Li, K., Mehmood, K., Rehman, MU., Nabi, F., Wang, Y., Chang, Z., Wu, Q. and Li, J., 2017. Prevalence and potential risk factors for Escherichia coli isolated from Tibetan piglets with White Score Diarrhea. Pakistan J. Zool., 50: 57-63.
Erskine, R.J., Walker, R.D., Bolin, C.A., Bartlett, P.C. and White, D.G., 2002. Trends in antibacterial susceptibility of mastitis pathogens during a seven-year period. J. Dairy Sci., 85: 1111-1118. https://doi.org/10.3168/jds.S0022-0302(02)74172-6
Fitzmaurice, J., 2003. Molecular diagnostic assay for Escherichia coli O157: H7. Dep. Microbiol. Natl. Univ. Ireland, Univ. Coll. Galway, Irel.
Ganda, E.K., Bisinotto, R.S., Lima, S.F., Kronauer, K., Decter, D.H., Oikonomou, G., Schukken, Y.H., Bicalho, R.C., Sargeant, J.M., Scott, H.M., Leslie, K.E., Ireland, M.J., Bashiri, A., Hertl, J.A., Schukken, Y.H., Welcome, F.L., Tauer, L.W., Grohn, Y.T., Erskine, R.J., Wagner, S., DeGraves, F.J., Pol, M., Ruegg, P.L., Martin, R., Bertelsen, R.J., Heikkila, M.P., Saris, P.E., Riekerink, R.G.O., Barkema, H.W., Kelton, D.F., Scholl, D.T., Oikonomou, G., Machado, V.S., Santisteban, C., Schukken, Y.H., Bicalho, R.C., Kuehn, J.S., Oikonomou, G., Erskine, R.J., Eberhart, R.J., Hutchinson, L.J., Spencer, S.B., Campbell, M.A., Botrel, M.A., Suojala, L., Kaartinen, L., Pyorala, S., Schukken, Y.H., Schukken, Y.H., Dolejska, M., Hunt, K.M., Cabrera-Rubio, R., Wenz, J.R., Barrington, G.M., Garry, F.B., Dinsmore, R.P., Callan, R.J., Wenz, J.R., Garry, F.B., Barrington, G.M., Quigley, L., Caporaso, J.G., Foditsch, C., Bokulich, N.A., Edgar, R.C., Boutin, S., Benjamini, Y., Hochberg, Y., Team, R.C., Paulson, J.N., Stine, O.C., Bravo, H.C., Pop, M., Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R., Schukken, Y.H., Lago, A., Godden, S.M., Bey, R., Ruegg, P.L., Leslie, K., Lago, A., Godden, S.M., Bey, R., Ruegg, P.L., Leslie, K., Leininger, D.J., Roberson, J.R., Elvinger, F., Ward, D., Akers, R.M., Jimenez, E., Dogan, B., Fairbrother, J.H., Addis, M.F., Britten, A.M., Wellenberg, G.J., Poel, W.H. van der, Oirschot, J.T. Van, Dworecka-Kaszak, B., Krutkiewicz, A., Szopa, D., Kleczkowski, M., Bieganska, M., Vetrovsky, T., Baldrian, P., Nadkarni, M.A., Martin, F.E., Jacques, N.A., Hunter, N., Falentin, H., Koskinen, M.T., Martin, R., Menard, L., Vanasse, C., Diaz, C., Rivard, G., Murai, A., Maruyama, S., Nagata, M., Yuki, M., Richey, M.J., Foster, A.P., Crawshaw, T.R., Schock, A., Schultze, W.D., Brasso, W.B., Franco, M.M., Bhatt, V.D., Kim, J., Costa, M.C., Vlckova, K., Lax, S., Zhou, Y., Zhao, J., Stressmann, F.A., Helden, P.D. van, Helden, L.S. van, Hoal, E.G. and Wittum, T.E., 2016. Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin. Scient. Rep., 6: 33-38. https://doi.org/10.1038/srep37565
Gebreyes, W.A. and Altier, C., 2002. Molecular characterization of multidrug-resistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J. clin. Microbiol., 40: 2813-2822. https://doi.org/10.1128/JCM.40.8.2813-2822.2002
Gilmore, A., 1986. Chloramphenicol and the politics of health. Can. Med. Assoc. J., 134: 423.
Greenway, D.L.A. and England, R.R., 1999. The intrinsic resistance of Escherichia coli to various antimicrobial agents requires ppGpp and σ(s). Lett. appl. Microbiol., 29: 323-326. https://doi.org/10.1046/j.1472-765X.1999.00642.x
Guillaume, G., Verbrugge, D., Chasseur-Libotte, M.L., Moens, W. and Collard, J.M., 2000. PCR typing of tetracycline resistance determinants (Tet A–E) in Salmonella enterica serotype Hadar and in the microbial community of activated sludges from hospital and urban wastewater treatment facilities in Belgium. FEMS Microbiol. Ecol., 32: 77-85. https://doi.org/10.1016/S0168-6496(00)00016-7
Güler, L., Gündüz, K. and Ok, Ü., 2008. Virulence factors and antimicrobial susceptibility of Escherichia coli isolated from calves in Turkey. Zoon. Publ. Hlth., 55: 249-257. https://doi.org/10.1111/j.1863-2378.2008.01121.x
Hogeveen, H., Huijps, K. and Lam, T.J.G.M., 2011. Economic aspects of mastitis: new developments. N.Z. Vet. J., 59: 16-23. https://doi.org/10.1080/00480169.2011.547165
Kahlmeter, G. and Poulsen, H.O., 2012. Antimicrobial susceptibility of Escherichia coli from community-acquired urinary tract infections in Europe: The ECO· SENS study revisited. Int. J. Antimicrob. Agents, 39: 45-51. https://doi.org/10.1016/j.ijantimicag.2011.09.013
Kaipainen, T., Pohjanvirta, T., Shpigel, N.Y., Shwimmer, A., Pyörälä, S. and Pelkonen, S., 2002. Virulence factors of Escherichia coli isolated from bovine clinical mastitis. Vet. Microbiol., 85: 37-46. https://doi.org/10.1016/S0378-1135(01)00483-7
Lanz, R., Kuhnert, P. and Boerlin, P., 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol., 91: 73-84. https://doi.org/10.1016/S0378-1135(02)00263-8
Lehtolainen, T., Shwimmer, A., Shpigel, N.Y., Honkanen-Buzalski, T. and Pyörälä, S., 2003. In vitro antimicrobial susceptibility of Escherichia coli isolates from clinical bovine mastitis in Finland and Israel. J. Dairy Sci., 86: 3927-3932. https://doi.org/10.3168/jds.S0022-0302(03)74001-6
Lei, T., Tian, W., He, L., Huang, X.H., Sun, Y.X., Deng, Y.T., Sun, Y., Lv, D.H., Wu, C.M. and Huang, L.Z., 2010. Antimicrobial resistance in Escherichia coli isolates from food animals, animal food products and companion animals in China. Vet. Microbiol., 146: 85-89. https://doi.org/10.1016/j.vetmic.2010.04.025
Lietzau, S., Raum, E., Von Baum, H., Marre, R. and Brenner, H., 2006. Clustering of antibiotic resistance of E. coli in couples: Suggestion for a major role of conjugal transmission. BMC Infect. Dis., 6: 1. https://doi.org/10.1186/1471-2334-6-119
Makovec, J.A., Ruegg, D.P.L., 2003. Antimicrobial resistance of bacteria isolated from dairy cow milk samples submitted for bacterial culture: 8,905 samples (1994–2001). J. Am. Vet. Med. Assoc., 222: 1582-1589. https://doi.org/10.2460/javma.2003.222.1582
Oliveira, L., Langoni, H., Hulland, C. and Ruegg, P.L., 2012. Minimum inhibitory concentrations of Staphylococcus aureus recovered from clinical and subclinical cases of bovine mastitis. J. Dairy Sci., 95: 1913-1920. https://doi.org/10.3168/jds.2011-4938
Patel, J.B., Cockerill, F., Bradford, P.A. and Eliopoulos, G.M., 2015. Performance standards for antimicrobial susceptibility testing. Twenty-fith Informational Supplement, Clinical and Laboratory Standards Institue.
Paterson, D.L., 2006. Resistance in gram-negative bacteria: Enterobacteriaceae. Am. J. Med., 119: 20-28. https://doi.org/10.1016/j.amjmed.2006.03.013
Poirel, L., Naas, T., Guibert, M., Chaibi, E.B., Labia, R. and Nordmann, P., 1999. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum β-lactamase encoded by an Escherichia coli integron gene. Antimicrob. Agents Chemother., 43: 573-581.
Rasheed, M.U., Thajuddin, N., Ahamed, P., Teklemariam, Z. and Jamil, K., 2014. Antimicrobial drug resistance in strains of Escherichia coli isolated from food sources. Rev. Inst. Med. Trop., 56: 341-346. https://doi.org/10.1590/S0036-46652014000400012
San Martín, B., Kruze, J., Morales, M.A., Agüero, H., León, B., Esppinoza, S., Iragüen, D., Puga, J. and Borie, C., 2002. Resistencia bacteriana en cepas patógenas aisladas de mastitis en vacas lecheras de la V Región, Región Metropolitana y Xa Región, Chile. Arch. Med. Vet., 34: 221-234. https://doi.org/10.4067/S0301-732X2002000200008
Seyda, C., Gökçen, D. and Ünlü, S.M., 2014. Detection of several virulence properties, antibiotic resistance and phylogenetic relationship in E. coli isolates originated from cow mastitis. Acta Vet. Brno, 64: 413-425. https://doi.org/10.2478/acve-2014-0039
Srinivasan, V., Gillespie, B.E., Lewis, M.J., Nguyen, L.T., Headrick, S.I., Schukken, Y.H. and Oliver, S.P., 2007. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol., 124: 319-328. https://doi.org/10.1016/j.vetmic.2007.04.040
Suojala, L., 2010. Bovine mastitis caused by Escherichia coli: Clinical, bacteriological and therapeutic aspects. Helsinki University Press, Helsinki.
Suojala, L., Kaartinen, L. and Pyörälä, S., 2013. Treatment for bovine Escherichia coli mastitis–an evidence-based approach. J. Vet. Pharmacol. Ther., 36: 521-531. https://doi.org/10.1111/jvp.12057
Suojala, L., Pohjanvirta, T., Simojoki, H., Myllyniemi, A.L., Pitkälä, A., Pelkonen, S. and Pyörälä, S., 2011. Phylogeny, virulence factors and antimicrobial susceptibility of Escherichia coli isolated in clinical bovine mastitis. Vet. Microbiol., 147: 383-388. https://doi.org/10.1016/j.vetmic.2010.07.011
Van, T.T.H., Chin, J., Chapman, T., Tran, L.T. and Coloe, P.J., 2008. Safety of raw meat and shellfish in Vietnam: An analysis of Escherichia coli isolations for antibiotic resistance and virulence genes. Int. J. Fd. Microbiol., 124: 217-223. https://doi.org/10.1016/j.ijfoodmicro.2008.03.029
Walther, B., Tedin, K. and Lübke-Becker, A., 2017. Multidrug-resistant opportunistic pathogens challenging veterinary infection control. Vet. Microbiol., 200: 71-78. https://doi.org/10.1016/j.vetmic.2016.05.017
Wenz, J.R., Barrington, G.M., Garry, F.B., Ellis, R.P. and Magnuson, R.J., 2006. Escherichia coli isolates’ serotypes, genotypes, and virulence genes and clinical coliform mastitis severity. J. Dairy Sci., 89: 3408-3412. https://doi.org/10.3168/jds.S0022-0302(06)72377-3