Study on Accuracy and Efficiency of Molecular Diagnostic Techniques used for Tuberculosis and Analysis of Associated Risk Factors for Tuberculosis in Jail Inmates of Quetta, Pakistan

Niamatullah Kakar, Farhat Abbas, Muhammad Shafee and Tauseef Asmat*

Center of Excellence in Vaccinology and Biotechnology, University of Balochistan, Quetta

ABSTRACT

Tuberculosis (TB) is airborne infectious disease and poses a great threat to public health. Precisely and timely detection of Mycobacterium tuberculosis is prerequisite for the successful treatment of TB. Aim of this study was to evaluate the prevalence of tuberculosis along with associated risk factors in Quetta Jail, Pakistan. In this cross-sectional study, 186 sputum samples were collected randomly from jail inmates. Sputum was processed for smear microscopy and culture inoculation for the detection of Mycobacterium tuberculosis infection. Moreover, the suspected samples were further investigated by polymerase chain reaction (PCR). Three samples were found positive by PCR test while other detection methods were not that sensitive to detect the tuberculosis at that stage. Two patients were reported with history of tuberculosis but were effectively treated before imprisonment. On age basis, 128/186 (68.88%) patients were of younger age (18-30 years) and 10 (5.37 %) were above 50 year. Illiteracy, unemployment (daily wages) and tobacco smoking were some of the main risk factors common in inmates. The trend of sharing blankets, towels and utensils were 158/186 (84.49%), 152/186 (81.72%) and 165/186 (88.70%), respectively which likely increase the risk of disease spread. Smear microscopy revealed that 27.92% prisoners were involved in acute and chronic inflammatory disease. PCR proved to be more sensitive compared to the sputum smears or culture based tuberculosis diagnosis.


Article Information

Received 02 November 2017

Revised 20 January 2018

Accepted 10 February 2018

Available online 21 June 2018

Authors’ Contribution

NK and TA Planned the study. NK, FA and MS conducted the experiments. TA analysed the data. NK, FA, MS and TA wrote the manuscript

Key words

Tuberculosis, Prisoners, AFB and Culture, PCR.

DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.5.1461.1465

* Corresponding author: [email protected]

0030-9923/2018/0004-1461 $ 9.00/0

Copyright 2018 Zoological Society of Pakistan



Introduction

 

Although developed countries have minimized if not eradicated Tuberculosis (TB) infection but it is still a one of the leading causes of death in underdeveloped countries (Raviglione and Sulis, 2016). The prevalence of TB is a global public health concern therefore World Health Organization (WHO) has launched new end-TB strategy in 2014. Despite the attempts to control tuberculosis by vaccination, sanitation and several other measures (Leung, 2012) still 10 million new TB cases have been reported worldwide during the year 2015 (Tatar et al., 2016; Beiranvand, 2016). Prevalence of TB in many areas of Pakistan is enormous depending on the availability of health care facilities, social and economic status. Pakistan is ranked at the 5th position in world among the countries bearing high burden of tuberculosis (Ahmad et al., 2018; WHO, 2015). There is no proper disease surveillance program in Pakistan, especially with respect to Quetta, Balochistan. The availability of data regarding prevalence, morbidity, mortality is limited to understand the disease pattern. Lower literacy rate and no awareness campaign have further aggravated the situation. Because of the mounted morbidity and mortality in many areas of country, it becomes necessary to at least evaluate the prevalence of tuberculosis in high-risk groups (Banu et al., 2010).

To date, there is very limited data available on the prevalence of tuberculosis in Balochistan province of Pakistan. Among marginalized settings in the country like inmates, in whom the prevalence of the disease seems to be higher and may be at high risk of contracting tuberculosis. Prisoners are grouped in high risk category to acquire tuberculosis infection and may lead to pulmonary tuberculosis compared to the general population, due to overcrowding, closed living condition, insufficient ventilation, generally low socioeconomic status, malnutrition and poor health (Coninx et al., 2000). Currently, very limited empirical data is available on the prevalence of pulmonary tuberculosis in jail inmates in Pakistan (Akhtar et al., 2007). The prevalence of tuberculosis in Karachi juvenile inmates was reported to be 3.9% (Hussain et al., 2003), while 4.8% in Khyber Pakhtunkhwa province prisons and in Karachi central prison the prevalence of TB was 3.75% (Rao, 2004). Moreover, several studies have previously reported the prevalence of infectious diseases among prisoners and have suggested the comprehensive and standardized administration system to prevent and control those infectious diseases (Zhang et al., 2016; Shafee et al., 2014; Kakar et al., 2017). This study was designed to assess the prevalence of tuberculosis among inmates in district jail Quetta, Pakistan.

 

Materials and Methods

Study design and area

A cross-sectional study was designed to estimate the prevalence and risk factors of tuberculosis among inmates of Central District Jail Quetta, Pakistan. The jail comprises of 11 barracks in total, 09 for male, 1 for juvenile and 1 for female prisoners. The total numbers of male prisoners were (n=450) of different duration of incarceration. In each barrack the numbers of prisoners were around 45-55. A pre-structured questionnaire was designed to collect the demographic data of age, educational level, profession, marital status, occupation, duration of incarceration, nutrition, current smoking status, family history of tuberculosis, vaccine (BCG), mean accommodation area (ft2) per prisoner in a barrack, number of prisoners per toilet in barrack, sharing of blankets, utensils and towels etc.

A random sampling technique was used for male prisoners with 18-60 years of age and those were investigated for sputum acid fast bacilli (AFB) smear and culture technique and further confirmed by specific PCR. The inmates whose prison term was ≤ 3 months from the date of interview and those did not give consent to participate were excluded from the study.

Sample collection and processing for TB

Sputum samples were collected in 50ml tube and transported to laboratory in cold chain. All the samples were subjected to Ziehl-Neelsen (ZN) staining technique for the detection of acid fast bacilli (AFB) by microscopy and sputum culture for inoculation techniques. Briefly, loop-full sputum was spread evenly on slide and fixed by passing rapidly over flame. The slide was then covered with carbolfuchsin (1%) and heated to enable the dye to bind the cell wall mycolic acids of the bacterium. The smear was then washed with clean water and decolorized with H2SO4. Slide was then counter stained with methylene blue for 1min and immediately washed with clean water (Shafee et al., 2014; Moosazadeh et al., 2015).

For culture analysis, samples were added with an equal amount of 4% NaOH solution and were vortexed. Samples were further incubated for 15 min at room temperature for decontamination and centrifuged to concentrate the pellet. About 2-3 drops of the samples were placed on slopes of Ogawa medium and incubated at 37°C for extended period of 8 weeks.

DNA extraction and PCR amplification

Clinically suspected patients were reconfirmed through conventional PCR amplification by targeting IS 6110 gene with specific primer (Forward 5’ CCTGCGAGCGTAGGCGTCGG 3’, Reverse 5’ CTCGTCCAGCGCCGCTTCGG 3’). Sputum samples of suspected patients were subjected to DNA extraction using thermolysis at 80°C for 60 min. The PCR reaction was carried out in 25 µl volume and PCR conditions was adopted as proposed by other researchers (Eisenach et al., 1990). Amplified product of 123 bp was visualized using gel doc system (Dolphin). Mycobacterium tuberculosis strain H37Rv was used as a positive control and was kindly provided by Provincial TB Reference Lab, Quetta while PCR grade water was used as a negative control.

 

Results

 

During the study period, a total of 450 prisoners were detained in the central jail Quetta. Among these inmates 186 volunteered to take part in study. Those volunteers were interviewed and samples were collected. All the prisoners participated in this study were only male with the mean age of 39 (18-60 years) as permission was denied by Jail authorities to include the female prisoners. Majority of the inmates 128/186 (68.88 %) were with age of 18-30 years and only 14.51% (27/186) were 31-40 years old. While 21/186 (11.29%) were in age group of 41-50 years and 10 (5.37%) jail inmates were above 50 years of age (Table I).

The literacy rate was only 48/186 (25.89%) among the jail inmates. 34 (18.27%) were unemployed and 113 (60.75%) were working on daily wages. BCG Vaccination scar was evident only in 06 cases (3.27%). The number of prisoners with the internment duration of >4 years were 15 (8.06%) and 29 (15.59%) were for the duration of 2-3 years while 68 (36.59%) were incarcerated for 1-2 years and 74 (39.78%) were jailed for less than one year. The mean area per inmates was almost 20 ft2 in barracks. The 44 (23.65%) inmates were reported as smoker of 1-5 cigarettes/day, 18 (9.67%) smoked 6-10 cigarettes/day and 66 (35.48%) smoked >10 cigarettes/day. Three (1.61%) cases reported with the family history of tuberculosis. Prisoners sharing blankets, towels and routine use utensils during their period of incarceration were 158 (84.49%), 152 (81.72%) and 165 (88.70%), respectively (Table I).

 

Table I.- Socio-demographic features of inmates tested for tuberculosis.

Variables

No of prisoners

Total %age

Age (years)
 

18-30

31-40

41-50

> 50

128

27

21

10

68.88

14.51

11.29

5.37

Education
 

Illiterate

Literate

138

48

74.11

25.98

Previous occupation
 

Employed

Unemployed

Daily wages

39

34

113

20.96

18.27

60.75

Duration of incarceration
 

<1 years

1-2 years

2-3 years

>4years

74

68

29

15

39.78

36.59

15.59

8.06

Smoking status
 

Non smoker

1-5 cigarettes/day

6-10 cigarettes/day

≥ 10 cigarettes/day

58

44

18

66

31.18

23.65

9.67

35.48

Family history of tuberculosis
 

Yes

No

03

183

1.61

98.38

H/O BCG vaccination
 

Yes

No

06

180

3.27

96.77

Sharing of blankets
 

Yes

No

158

28

84.49

15.05

Sharing of towels
 

Yes

No

152

34

81.72

18.27

Sharing of utensil
 

Yes

No

165

21

88.70

11.92

Married
 

Yes

No

80

106

43.01

56.98

Drug addiction
 

Yes

No

35

151

18.8

81

 

Microscopically, study revealed different grade of infection (Table II). Sixteen (8.60%) sample revealed acute (Polymorph nuclear leucocytes) inflammation, 20 (10.75%) chronic (mono nuclear cells) while 52 (27.92%) cases were of acute and chronic infection as shown in Table II. All of the sputum smear and culture were negative for acid fast bacilli (AFB) as shown in Table II but three were found positive by PCR as shown in Table III. The samples were further investigated by PCR and results revealed that 03 prisoners were positive for TB. The subject diagnosed positive for TB with PCR were incarcerated in jail for more than 3 years and were having all positives for TB infection like smoking, family history of TB and microscopic examination of their blood samples also revealed the abundance of PMN leucocytes and mononuclear cells.

 

Table II.- Microscopic examination of smears.

Characteristics

No

%age

Acute PMN leucocytes

16

8.60

Chronic mononuclear cells

20

10.75

Acute and chronic PMN leucocytes + mononuclear cells

52

27.92

Normal smear

98

52.68

Total

186

100%

 

Table III.- Prevalence of tuberculosis in jail inmates in Quetta, Pakistan.

No. of samples

Positive samples for TB by AFB method

Positive samples for TB by PCR

186

00

03

 

Discussion

 

Direct smear microscopy is the most important and economical mean of diagnosis and control of tuberculosis in the community (Hajia et al., 2005). Culture technique was also included in this study to avoid false negative results that may occur due to paucibacillary, dead bacilli, and poor quality of specimen, staining or microscopy. Culture technique is known as standard in diagnostic studies, with its relative specificity of 99% and sensitivity around 80%. Previous study had identified substantial number of negative smear but culture positive TB cases, which demonstrate that sputum culture is more sensitive, specific and useful in these settings (Banu et al., 2010; Cheesbrough, 2005). The current study further provides the evidence that PCR based diagnosis could be helpful to diagnosis the tuberculosis at early stage of infection. Since PCR can amplify billions copies of targeted genes from tiny amounts of DNA so it’s more efficient compared to any other diagnostic method including AFB. Furthermore, this study demonstrated that more than half (52.68%) of the prisoners smears were of normal cellular morphology, while 8.6% and 10.75% prisoners acquired acute and chronic infection, respectively (Table III). Tuberculosis rate in prisons in some Asian countries is several times higher compared to their general population (Maclntyre et al., 1997). In Bangladesh, 2227/100000, Thailand, 568/100000, and in Pakistan, 657/100000 showing many times higher infection than general population (Banu et al., 2010). While in Karachi central prison prevalence was reported 3.75 times more than in general population (Cheesbrough, 2005).

Pakistan is high endemic country for tuberculosis and the situation is alarming in general population. The prevalence of latent TB infection in juvenile inmates in Karachi, Pakistan was 3.9 %, while in Khyber Pushtoonkhwa Province was much higher (48%) (Hussain et al., 2003). Our study revealed that 30 (56.60%) prisoners who were incarcerated for longer period (1-4 year) that may put them at a high risk of horizontal transmission or reactivation of past M. tuberculosis infection (Table II). As coughing, overcrowding and poor ventilation are the main factors that promote the transmission of TB infection (Cheesbrough, 2005).

Tobacco smoking also increases the risk of acquiring TB infection and plays a key role in the transmission of the disease by passive cigarette smoking in prison. Several studies have reported increased risk of transmission of TB infection due smoking. In our study 128 prisoners were cigarette smokers which highlight the risk of acquiring TB infection (Chiang et al., 2002; Nisar et al., 1993).

High proportions of the prisoners were poorly educated or illiterate and were with low socio-economic status. Similarly, Sharing utensils, towels and blankets was also higher among prisoners. These could also contribute in the dissemination of tuberculosis in jail inmates. Poverty, malnutrition and unemployment also contribute the associated risk factors for tuberculosis that might lead to a weakened immune system. In our study, 18.27% and 60.75% prisoners were unemployed or were working at daily wages, respectively.

Most importantly, majority 180/186 (96.77%) of the prisoners were non-vaccinated. In given living condition in prison, inmates are more exposed for acquiring TB infection. The possible explanation to be almost TB free prison could be well ventilated Barracks, improved hygienic conditions and regular inspection of prisoner’s living conditions by higher authorities.

 

Conclusion

 

Early diagnosis, isolation and appropriate treatment of TB positive prisoners may help to reduce the transmission of tuberculosis. Special attention ought to be paid to those with history for tuberculosis in their families.

 

Acknowledgements

 

We are deeply indebted to the Pathology department, Fatima Jinnah General & Chest Hospital Quetta, Pakistan for their constant support and technical assistance. We are also thankful to the University of Balochistan and Central Jail Quetta, Pakistan for their support to conduct and complete this study. The study was part of M. Phil research project of first Author.

 

Statement of conflict of interests

All the authors have declared no conflict of interest.

 

References

 

Ahmad, B., Idrees, M., Ahmad, K., Ahmad, D., Ali, S. and Bashir, S., 2018. Genetic diversity of Mycobacterium tuberculosis complex prevailing In Khyber Pakhtunkhwa, Pakistan. Pakistan J. Zool., 50: 663-669. http://dx.doi.org/10.17582/journal.pjz/2018.50.2.663

Akhtar, S., White, F., Hasan, R., Rozi, S., Younas, M. and Ahmed, F., 2007. Hyperendemic pulmonary tuberculosis in peri urban areas of Karachi, Pakistan. BMC Publ. Hlth., 7: 70. https://doi.org/10.1186/1471-2458-7-70

Banu, S., Hossain, A., Uddin, M.R., Ahmed, T. and Khatun, R., 2010. Pulmonary tuberculosis and drug resistance in Dhaka Central jail: The largest prison in Bangladesh. PLoS One, 5: 10759. https://doi.org/10.1371/journal.pone.0010759

Beiranvand, R., Karimi, A., Delpisheh, A., Sayehmiri, K., Soleimani, S. and Ghalavandi, S., 2016. Correlation assessment of climate and geographic distribution of tuberculosis using geographical information system (GIS). Iranian J. Publ. Hlth., 45: 86-93.

Cheesbrough, M., 2005. District laboratory practice in tropical countries, 2nd Edn. Cambridge University Press. https://doi.org/10.1017/CBO9780511581304

Chiang, C.Y., Hsu, C.J., Hsu, P.K., Suo, J. and Lin, T.P., 2002. Pulmonary tuberculosis in Taiwanese prison population. J. Formos med. Assoc., 101: 537-541.

Coninx, R., Maher, D., Reyes, H. and Grzemska, M., 2000. Tuberculosis in prisons in countries with high prevalence. Br. med. J., 320: 440-442. https://doi.org/10.1136/bmj.320.7232.440

Eisenach, K.D., Cave, M.D., Bates, J.H. and Crawford, J.T., 1990. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infect. Dis., 161: 977-981. https://doi.org/10.1093/infdis/161.5.977

Hajia, M., Rahbar, M. and Alikhani, Y., 2005. Efficiency of PCR method for screening pulmonary tuberculosis patients under DOTs protocol therapy. Iranian J. Publ. Hlth., 34: 9-13.

Hussain, H., Akhtar, S. and Nanan, D., 2003. Prevalence of and associated risk factors in Mycobacterium tuberculosis infection in prisoners in NWFP, Pakistan. Int. J. Epidemiol., 32: 794-799. https://doi.org/10.1093/ije/dyg247

Kakar, N., Asmat, T.M., Abbas, F., Rehman, H.U., Kakar, A., Khan, K. and Bugti, F.S., 2017. Prevalence of human immunodeficiency virus in the inmates of district Jail Quetta, Balochistan. Pure appl. Biol., 6: 164-170.

Leung, C.C., 2012. The year in review. Part II: Tuberculosis and lung disease. Int. J. Tuberculosis Lung Dis., 17: 1151-1159. https://doi.org/10.5588/ijtld.13.0385

Maclntyre, C.R., Kendig, N., Kummer, L., Birago, S. and Graham, N.M., 1997. Impact of tuberculosis control measures and crowding on the incidence of tuberculosis infection in Maryland prison. Clin. Infect. Dis., 24: 1060-1067. https://doi.org/10.1086/513632

Moosazadeh, M., Khanjani, N., Nasehi, M. and Bahrampour, A., 2015. Predicting the incidence of smear positive tuberculosis cases in Iran using time series analysis. Iranian J. Publ. Hlth., 44: 1526-1534.

Nisar, M., William, C.S.D., Ashby, D. and Davies, P.D.O., 1993. Tuberculin testing in residential homes for the elderly. Thorax, 48: 1257-1260. https://doi.org/10.1136/thx.48.12.1257

Rao, N.A., 2004. Prevalence of pulmonary tuberculosis in Karachi central prison. J. Pak. med. Assoc., 54: 413-415.

Raviglione, M. and Sulis, G., 2016. Tuberculosis 2015: Burden, Challenges and Strategy for Control and Elimination. Infect. Dis. Rep., 8: 6570. https://doi.org/10.4081/idr.2016.6570

Shafee, M., Abbas, F., Ashraf, M., Alam, M.M., Kakar, N. and Ahmad, Z., 2014. Hematological profile and associated risk factors with pulmonary tuberculosis in Quetta, Pakistan. Pak. J. med. Sci., 30: 36-40.

Tatar, D., Senol, G., Alptekin, S., Gunes, E., Aydin, M. and Gunes, O., 2016. Assessment of extra pulmonary tuberculosis in two provinces of Turkey. Iranian J. Publ. Hlth., 45: 305-313.

WHO, 2015. Use of high burden country lists for TB by WHO in the post-2015 era. Retrieved from: http://www.who.int/tb/publications/global_report/high_tb_burdencountrylists2016-2020.pdf.

Zhang, S., Li, X., Zhang, T. and Wang, X., 2016. Framework for establishment of a comprehensive and standardized administration system for prevention and control of tuberculosis in college student community in China. Iranian J. Publ. Hlth., 45: 1300-1308.