Comparative Mitogenomic and Phylogentic Analyses of a Schizothoracine Fish, Gymnodiptychus dybowskii from Two Water Systems in Xinjiang
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
1College of life Science and Technology, Xinjiang University, Urumqi 830046, China
2Fisheries College, Zhejiang Ocean University, Zhoushan 316004, China
3Xinjiang Fisheries Research Institute, Urumqi, 830000, China
ABSTRACT
Gymnodiptychus dybowskii belonging to subfamily Schizothoracinae is a rare and endangered aboriginal fish in Xinjiang. In this study, the complete mitochondrial genomes of G. dybowskii from Tarim River system (16, 677bp) and Ili River system (16, 667bp) were sequenced. Besides, their genetic characteristics were also identified and compared simultaneously. Genetic distance and sequence differentiation suggested that great genetic variation existed within species and the sample from Kaidu River in South Xinjiang might be a cryptic species or subspecies of G. dybowskii. The phylogenetic analyses from 12 concatenated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishes were well recognized from each other in branching diagram. The primitive group and the specialized group + the highly specialized group constituted a sister relationship with strong supports.
Article Information
Received 18 December 2017
Revised 25 January 2018
Accepted 10 February 2018
Available online 06 September 2018
Authors’ Contribution
TY conceived and designed the work. YL performed the experiments. WM analyzed the data and wrote the manuscript. MH and TG revised the manuscript.
Key words
Gymnodiptychus dybowskii, Complete mitochondrial genome, Phylogenetic analysis.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.6.2119.2127
* Corresponding author: [email protected]
0030-9923/2018/0006-2119 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introduction
Schizothoracine fishes are characterized by a line of specialized anal scale on both sides of the anus and anal fin. They are members of the family Cyprinidae and consist of 15 genera and more than 100 species all over the world (Mirza, 1991). In China, their distribution pattern presents Qinghai-Tibet Plateau-centered characteristics (Chen and Cao, 2000). As a most diverse group of ichthyofauna in Xinjiang, it contains about 11 species belonging to 5 genera accounting for over 15% of the Chinese schizothoracine species (Wang, 1998; Guo et al., 2012).
Xinjiang is located in the western border of China and is the largest province with a land mass of 1.66 million square kilometers, accounting for a total area of 1/6 China. Tianshan Mountains span across the central part of Xinjiang in the middle from east to west, dividing it into two parts: south Xinjiang and north Xinjiang (Sabit, 2012). Gymnodiptychus dybowskii is a rare and endangered aboriginal fish in Xinjiang, which has been listed as Class I wild aquatic protected animal of Xinjiang in 2004. It mainly distributes in Ili River system and river systems in Junggar basin on the northern slope of Tianshan Mountains with the altitude 1500-2900 m. In Tarim River system of south Xinjiang, it can be only found in upper and middle reaches of Kaidu River (Guo et al., 2012). As one of specialized schizothoracine fishes, it is nearly esquamate, only covered with shoulder scale, anal scale and ateral-line scale. These changes of morphological characteristic are in close connection with adaptation of the plateau environment, and it also reveals the evolutionary direction of whole subfamily Schizothoracinae (Cao et al., 1981).
Population genetic studies based on the mitochondrial Cyt b gene showed a low genetic variation of G. dybowskii in Ili River system, but strong genetic divergence between individuals from Kaidu River and Ili River. To further confirm the differences, we amplified and compared the complete mtDNA sequences of G. dybowskii collected from south and north Xinjiang in this study. Both selection pressure test and phylogenetic analysis were performed to detect the natural selection and species differentiation during the uplift of the Qinghai Tibet Plateau. The results are expected to provide useful references for the adaptive evolution and biogeography studies of schizothoracinae fishes.
Materials and methods
Sample collection and DNA extraction
In the present study, the specimen of G. dybowskii were collected in Kaidu River and Kunes River in 2014, respectively (Fig. 1). Fresh tail fins were preserved in 95% ethanol immediately, and the total genomic DNA was extracted from caudal fin using standard phenol-chloroform methods (Maniatis et al., 1982).
PCR amplification and sequencing
Fragments of COI, Cyt b, 16S rRNA and ND4 gene were amplified by universal primers FishF1/FishR1 (Ward et al., 2005), L14724/H15915 (Xiao et al., 2001), 16Sar/16Sbr (Palumbi, 1996) and ND4F/ND4R (Xiao et al., 2005), respectively. Based on the obtained partial sequences and consulting the mitochondrial genomes of closely related species, LA-PCR (long and accurate polymerase chain reaction) primer pairs were designed by software Primer 5.0 to amplify G. dybowskii mtDNA (Table I). PCRs were performed in an Eppendorf thermal cycler. LA-PCR amplification was performed within a reaction mixture containing 0.5 μL LA Taq DNA polymerase (5U/μL), 5 μL 10×LA PCR buffer II (Mg2+ Plus), 8 μL dNTP mixture (2.5 mM each), 1 μL each primers (20 μM) and 2.5 ng template DNA (50 ng/μL). Sterile distilled H2O was added to reach a total volume of 50 μL. PCR was carried out with an initial denaturation at 95°C for 1 min, followed by 30 cycles of 94°C for 30 s, 57-64°C for 15 s, and a final extension at 72°C for 1min/kb. Negative controls were conducted to confirm the absence of contaminants. Products were detected by 1.0% agarose gel electrophoresis, purified with the Gel Midi purification Kit (Tiangen Biotech) and then sequenced by Sanger method.
Data analysis
The corresponding gene locations were determined by BLAST comparison with either nucleotide or amino acid sequences of other Schizothoracinae fishes. EasyCodeML software was employed to analyze the selection pressure of 13 protein-coding genes (PCGs) (Gao and Chen, 2016). The relative influence of natural selection acting on PCGs can be detected by comparing the rates of non-synonymous
Table I.- Primers used in amplifying complete mitogenomes of G. dybowskii.
|
Sample name |
Source |
Primer |
Nucleotide sequence (5’-3’) |
Anne aling (°C) |
|
|
SLCC |
Kaidu River (South Xinjiang) |
Lna2 |
Forward |
CGAACTCAACCCAAGAGAGCAATG |
60 |
|
Reverse |
ACAAGTCAGTTTCCAAATCCCCCG |
||||
|
Lnac4 |
Forward |
TCCTCCTCGCCGTGTTTACAGTCG |
64 |
||
|
Reverse |
AGGTGTTCTCGGGTGTGGAATGGT |
||||
|
Lnc2 |
Forward |
TTTGTCTGGCTAATACCGCATACG |
59 |
||
|
Reverse |
TCGTAAAATAGCGTAGGCGAACAG |
||||
|
p |
Forward |
CAGTAGATAACGCCACGCTAACACG |
62 |
||
|
Reverse |
TAATAGCACGCCAGTGTGGGGGTA |
||||
|
NLCC |
Kunes River (North Xinjiang) |
Lba1 |
Forward |
CAGCCTGCCCAGTGACGATAAGTT |
63 |
|
Reverse |
TGTGAGGTCTACTGATGCTCCCGC |
||||
|
Lbab |
Forward |
ACTACCCCCATCATTCCTGTTAC |
57 |
||
|
Reverse |
GTTTCGGTCTGTGAGAAGCATTG |
||||
|
Lbb1 |
Forward |
GCCTCATCAATCCTGGGGGCTATC |
61 |
||
|
Reverse |
GCTAATGGGTTCAGGAGCGATGTG |
||||
|
Lbbc |
Forward |
GTCCACAGGATTTTCAACAGCCC |
59 |
||
|
Reverse |
TCGTATGCGGTATTAGCCAGACA |
||||
|
Lbca2 |
Forward |
CACCTCAGACATTTCAACCGCCTT |
61 |
||
|
Reverse |
TTTTCTTTCCTCCGTGGTCGCCCC |
||||
|
Lbc1 |
Forward |
TTGCCTACTCATCCGTAAGCCATA |
57 |
||
|
Reverse |
TGTTGCGTTATCTACTGAAAAGCC |
||||
substitutions (Ka) versus synonymous substitutions (Ks), which indicates the net balance between deleterious and beneficial mutations (Yang and Bielawski, 2000; Hurst, 2002; Nielsen, 2005). We examined three pairs of null and alternative hypothesis models to assess the Ka/Ks ratio (or ω, dN/dS) for all codon sites. The likelihood ratio tests (LRTs) were performed to compare the fit of three pairwise models: M0 (one-ratio) vs. M3 (discrete), M1a (nearly neutral) vs. M2a (positive selection), and M7 (β distribution) vs. M8 (β distribution and Ka/Ks ratio).
In order to illustrate phylogenetic relationship of G. dybowskii in Schizothoracinae fishes, forty-eight related species belonging to ten genera were used to draw dendrogram, with six taxa under genus Barbus regarded as the out-groups. All sequences were available from NCBI Genbank and aligned by MUSCLE 3.6 (Edgar, 2004). Neighbor-Joining (NJ) method and Kimura 2-parameter model performed with Mega6.0 were used to construct phylogenetic trees based on concatenated amino acids sequences of the 12 PCGs excluding ND6 gene.
Table II.- The mitochondrial genome characteristics of G. dybowskii.
|
Gene |
Str and |
Position |
Size (bp) |
Intergenic region |
No. of proteins |
Start codon |
End codon |
K2P distance |
|
tRNA Phe |
H |
1-69 |
69 |
0.015 |
||||
|
12S rRNA |
H |
70-1024 |
955 |
0.018 |
||||
|
tRNA Val |
H |
1025-1096 |
72 |
0.029 |
||||
|
16S rRNA |
H |
1097-2778 |
1682 |
0.022 |
||||
|
tRNA Leu(UUR) |
H |
2779-2854 |
76 |
1 |
0.000 |
|||
|
ND1 |
H |
2856-3830 |
975 |
4 |
324 |
ATG |
TAG |
0.130 |
|
tRNA Ile |
H |
3835-3906 |
72 |
-2 |
0.044 |
|||
|
tRNA Gln |
L |
3905-3975 |
71 |
3/2 |
0.014 |
|||
|
tRNA Met |
H |
3979-4047/3978-4046 |
69 |
0.077 |
||||
|
ND2 |
H |
4048-5092/4047-5091 |
1045 |
348 |
ATG |
T-- |
0.135 |
|
|
tRNA Trp |
H |
5093-5163/5092-5162 |
71 |
1 |
0.000 |
|||
|
tRNA Ala |
L |
5165-5233/5164-5232 |
69 |
1 |
0.045 |
|||
|
tRNA Asn |
L |
5235-5307/5234-5306 |
73 |
-4 |
0.014 |
|||
|
OL |
L |
5304-5351/5303-5350 |
48 |
-11 |
0.021 |
|||
|
tRNA Cys |
L |
5341-5407/5340-5406 |
67 |
-1 |
0.000 |
|||
|
tRNA Tyr |
L |
5407-5477/5406-5476 |
71 |
1 |
0.060 |
|||
|
COI |
H |
5479-7029/5478-7028 |
1551 |
516 |
GTG |
TAA |
0.062 |
|
|
tRNA Ser(UCN) |
L |
7030-7100/7029-7099 |
71 |
3 |
0.029 |
|||
|
tRNA Asp |
H |
7104-7175/7103-7174 |
72 |
12/13 |
0.029 |
|||
|
COII |
H |
7188-7878 |
691 |
230 |
ATG |
T-- |
0.091 |
|
|
tRNA Lys |
H |
7879-7954 |
76 |
1 |
0.055 |
|||
|
ATP8 |
H |
7956-8120 |
165 |
-7 |
54 |
ATG |
TAG |
0.085 |
|
ATP6 |
H |
8114-8797 |
684 |
-1 |
227 |
ATG |
TAA |
0.100 |
|
COIII |
H |
8797-9581 |
785 |
261 |
ATG |
TA- |
0.079 |
|
|
tRNA Gly |
H |
9582-9653 |
72 |
0.000 |
||||
|
ND3 |
H |
9654-10002 |
349 |
116 |
ATG |
T-- |
0.102 |
|
|
tRNA Arg |
H |
10003-10072 |
70 |
0.029 |
||||
|
ND4L |
H |
10073-10369 |
297 |
-7 |
98 |
ATG |
TAA |
0.056 |
|
ND4 |
H |
10363-11743 |
1381 |
460 |
ATG |
T-- |
0.114 |
|
|
tRNA His |
H |
11744-11812 |
69 |
0.078 |
||||
|
tRNA Ser(AGY) |
H |
11813-11881 |
69 |
1 |
0.061 |
|||
|
tRNA Leu(CUN) |
H |
11883-11955 |
73 |
3 |
0.014 |
|||
|
ND5 |
H |
11959-13782 |
1824 |
-4 |
607 |
ATG |
TAA |
0.107 |
|
ND6 |
L |
13779-14300 |
522 |
173 |
ATG |
TAA |
0.119 |
|
|
tRNA Glu |
L |
14301-14369 |
69 |
4 |
0.030 |
|||
|
Cyt b |
H |
14374-15514 |
1141 |
380 |
ATG |
T-- |
0.105 |
|
|
tRNA Thr |
H |
15515-15585/15515-15586 |
71/72 |
87/74 |
0.691 |
|||
|
tRNA Pro |
L |
15673-15742/15661-15730 |
70 |
0.044 |
||||
|
D-loop |
H |
15743-16677/15731-16667 |
935 /937 |
1.804 |
Forward slashes denote values of SLCC/NLCC; otherwise, both are identical. Negative numbers indicate overlapping nucleotide.
Results
Mitochondrial genome origination and sequence differentiation
The length of 16, 677 bp (Genbank accession no. KT588613) and 16,667 bp (Genbank accession No. KX688545) complete mitogenome sequences of G. dybowskii from Kaidu River (SLCC) and Kunes River (NLCC) were obtained and analyzed, respectively (Table II). They consisted of 13 PCGs (Cyt b, ATP6, ATP8, COI-COIII, ND1-ND6 and ND4L), two ribosomal RNA genes (12S rRNA and 16S rRNA), 22 tRNA genes and two non-coding regions (CR and OL) (Table II). The location and arrangement order of the 37 genes were considered to be relatively conserved just like most metazoan and determined by comparison of DNA or amino acid sequence with other Schizothoracinae fish mitochondrial genomes (Gong et al., 2012; Jiang et al., 2014; Yang et al., 2016; Tong et al., 2017).
The pairwise genetic distance between different genes was calculated from 0.000 (tRNALeu(UUR), tRNATrp, tRNACys and tRNA Gly) to 1.804 (D-loop). The similarity of whole nucleotide sequences between two mitochondrial genomes was 92.6%, even much lower than that between different species by BLAST in NCBI. The level of homology of 13 PCGs and two ribosomal RNA genes between two individuals ranged from 87.9% (ND2) to 98.2% (12S rRNA), confirming that 12S rRNA gene was the most conserved gene in G. dybowskii mtDNA. Control region was the most rapidly evolving region of mtDNA, with 5- to 10- fold higher substitution rate than the rest part. It was one of the most commonly used markers for addressing evolutionary relationships of closely related species or subspecies (Moore, 1995). The gene variation analysis suggested that besides D-loop gene, ND2, ND1 and ND6 genes were also ideal molecular markers in genetic studies, which could be used to analyze the genetic diversity among different populations.
Selection tests
In order to test for the possibility of selection mode on mtDNA protein-coding sequences, we adopted site model to detect the Ka/Ks ratio in 13 PCGs for two G. dybowskii, as well as other four schizothoracine fishes (Aspiorhynchus laticeps, Diptychus maculates, Schizothorax biddulphi and S. pseudoaksaiensis) distributed and collected in Xinjiang. ND6 nucleotide sequence was reverse complement in order to infer the correct amino acid sequence.
The LRTs under the first model (M0 vs. M3) showed that 12 PCGs were significant except for ND4L gene (P=0.639440891), but no positive site was detected for all 13 PCGs. The LRTs under the second model (M1a vs. M2a) showed that only COII gene was significant (P=0.029621169), but no positive site was detected. The LRTs under the third model (M7 vs. M8) showed that four genes (COIII, ND3, ND4, ND5) were significant, and 1, 2, 3 and 7 positive sites were detected, respectively, but the posterior probability did not reach 95% level. The ω values of four genes were 1, 1.69083, 1.23762 and 1.96092, respectively (Table III).
Phylogenetic analysis
Multiple alignments of 12 concatenated heavy-strand encoded gene sequences were concatenated to conduct phylogenetic analysis by NJ method. The ND6 gene was not included because of being encoded on the light-strand and had a strikingly different nucleotide composition relative to other mitochondrial PCGs (Arnason et al., 2010).
Table III.- Results of site model on COIII, ND3, ND4 and ND5 genes.
|
Gene |
Model |
np |
Ln L |
Estimates of parameters |
Model compared |
LRT P-value |
Positive sites |
|
COIII |
M7 |
15 |
-2178.710959 |
p=0.01824, q=0.11945 |
|||
|
M8 |
17 |
-2175.434750 |
p0=0.97398, p=0.04179, q=0.54830, (p1=0.02602), ω=1.00000 |
M7 vs. M8 |
0.037771176 |
220 I 0.554 |
|
|
ND3 |
M7 |
15 |
-1087.956641 |
p=0.04120, q=0.26936 |
|||
|
M8 |
17 |
-1084.151680 |
p0=0.97153, p=0.05064, q=0.43842, (p1= 0.02847), ω=1.69083 |
M7 vs. M8 |
0.022260065 |
83 A 0.917, 84 D 0.578 |
|
|
ND4 |
M7 |
15 |
-4562.036585 |
p=0.36527, q=5.61137 |
|||
|
M8 |
17 |
-4557.178766 |
p0=0.98783, p=0.66527, q=13.26254, (p1= 0.01217), ω=1.23762 |
M7 vs. M8 |
0.007767406 |
43 S 0.744, 86 R 0.865, 189 D 0.623 |
|
|
ND5 |
M7 |
15 |
-5663.404398 |
p=0.13861, q=1.14597 |
|||
|
M8 |
17 |
-5659.281408 |
p0=0.98935, p=0.03112, q=0.19861, (p1= 0.01065), ω= 1.96092 |
M7 vs. M8 |
0.016196016 |
27 E 0.837, 29 A 0.767, 30 K 0.937, 273 P 0.798, 486 S 0.813, 573 A 0.759, 580 G 0.567 |
A total of 65 individuals from 48 published sub species mitochondrial genomes that represented 10 genera (Oxygymnocypris, Platypharodon, Chuanchia, Gymnocypris, Schizopygopsis, Diptychus, Gymnodiptychus, Ptychobarbus, Aspiorhynchus and Schizothorax) and 6 out-group taxa (Barbus barbus, Barbus pobeguini, Barbus eburneensis, Barbus hulstaerti, Barbus trimaculatus and Barbus fasciolatus) were assembled to investigate the phylogenetic relationships of Schizothoracinae subfamily (Fig. 1). The NJ tree was divided into two clades (Fig. 2). Clade A consisted of highly specialized schizothoracine fishes and specialized schizothoracine fishes, while clade B contained primitive schizothoracine fishes.
Discussion
Hebert et al. (2003) examined COI sequence divergences for 13320 animal species belonging to 11 phyla, and revealed that 98% interspecific genetic distance was greater than 2%, with the mean divergence value of 11.3%. The result validated the ability of COI sequences to diagnose species in certain taxonomic groups as DNA barcoding. Furthermore, closely related species of vertebrates ordinarily showed from 2% to 5% sequence divergence at mitochondrial cytochrome b gene (Avise, 1994; Avise and Walker, 1999). Here, we found that the K2P distance based on COI and Cyt b gene between two G. dybowskii was 6.2% and 10.5%, respectively, which was much higher than the threshold value and implied potential existence of a cryptic species or subspecies. The existing molecular phylogeography researches revealed by partial mtDNA and nDNA genes had also strongly confirmed it. We examined the population genetic differentiation of G. dybowskii from both South and North Slope of Tianshan Mountain, and found that the genetic distance between them was even more than 10% based on Cyt b gene, exceeding the divergence level of species suggested by Avise (Meng et al., 2015). Li et al. (2016) used two mtDNA genes (Cyt b and 16S rRNA) combined with a nuclear gene (RAG-2) to evaluate the phylogeography and historical demography of G. dybowskii across three northern Qinghai-Tibetan Plateau river systems: the Kaidu River, Ili River and Junggar Basin. Results showed that they have resolved three reciprocally monophyletic clades which should be treated as species or minimally, as evolutionarily significant units (ESUs).
Through the selection pressure analysis of 13 PCGs, positive sites were detected in four genes, of which three were NADH dehydrogenase genes and one was Cytochrome c oxidase gene. Mitochondria is the center of cellular energy metabolism. NADH dehydrogenase is one of the “entry enzymes” of cellular respiration or oxidative phosphorylation in the mitochondria. It is used in the electron transport chain for generation of ATP. Cytochrome c oxidase is the terminal enzyme of the respiratory chain in the mitochondria. It catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. These two genes participate in oxidative respiratory chain and are likely to play an important role in hypoxia adaptation, which is critical for the plateau adaption. However, all the positive sites were not significant in this study. On the one hand, it may be related to the fewer species (only 5 species in Xinjiang were selected). On the other hand, plateau adaptation is a complex evolutionary process, many nuclear genes may play a more direct role, and natural selection will favor these genes much more.
Although phylogenetic interrelationships of Schizothoracinae subfamily have been extensively investigated in the perspective of molecular biology in previous studies (He et al., 2004, 2016; He and Chen, 2006, 2007; Qi et al., 2006, 2015; Haysa et al., 2014; Zhang et al., 2016), however, analyses mainly focusing on schizothoracine fishes distributed in Xinjiang based on the whole mtDNA sequences were rare. A broad range of taxa were chosen for phylogenetic analysis here. The topology structure was identified with previous molecular research conclusions and supported the morphological classification of Cao et al. (1981). Primitive grade schizothoracine fishes were in the base of tree, followed by the specialized grade schizothoracine fishes, and highly specialized schizothoracine fishes placed on the top of the phylogenetic tree. This arrangement structure was coincidence with their evolutionary status. Clade A can be further divided into two well-supported (BP=100) subclades A1 and A2. Three species belonging to Ptychobarbus genus (branch A1-2) which should have been categorized into specialized grade schizothoracine fishes, were clustered together with highly specialized grade (branch A1-1). This phenomenon was also found in phylogeny analyses by partial mitochondrial DNA genes and complete mitogenome (Haysa et al., 2014; Zhang et al., 2016). As a monophyletic group, we conjectured that Ptychobarbus genus might be a transitional group between highly specialized and specialized grade schizothoracine fishes. According to the classification based on morphological specificities, for example, maxilla bone, the 2nd prosethmoid bone and so on, Wu (1984) considered that Ptychobarbus and Gymnodiptychus were grouped as sister taxon and had close relationships. But our research results didn’t agree with the morphological classification because they situated in independent subclades (A1 and A2) and didn’t gather together.
Species of Gymnocypris and Schizopygopsis were cross-clustering and did not form a monophyletic group separately. Mitochondrial DNA data did not fully support the morphological findings (He and Chen, 2007). Oxygymnocypris stewartii located in the root of branch A1-1 and was a sister to other highly specialized grade schizothoracine fishes with high bootstrap value. In subclade A2, Gymnodiptychus pachycheilus and G. pachycheilus weiheensis first gathered and then clustered with G. dybowskii, with Diptychus maculates placing outside of them. That meant perhaps Diptychus was the earlier diverged genus of this group.
The taxonomic status of species within genus Schizothoracinae have been confused and disputed since Heckel (1838) erected this genus. Chen and Cao (2000) deemed the features of mandible bone as ecological bases for subgenus classification, and divided Schizothorax genus into two subgenus: Schizothorax and Racoma. But cluster analysis found there weren’t any one-to-one genetic relationships between each other, not upholding the subgenus division of Schizothorax fishes. He and Chen (2006) investigated biogeography and molecular phylogeny of the genus Schizothorax in China inferred from cytochrome b sequences, and their results also not congruent with the traditional subdivision of the genus Schizothorax. They gained a clear geographical structure across drainages and suggested species from the same drainage often shared the same evolutionary lineage. As sympatric species belonging to two different genus, the genetic distances between A. laticeps and S. biddulphi based on Cyt b and COI gene were all less than the intergeneric genetic threshold values recommend by Kartavtsev and Lee (2006) and Ward et al. (2005), respectively, which showed relatively close phylogenetic relationships with each other. As anadromous migration species, reproductive time of A. laticeps (late April to mid May) and S. biddulphi (April to early July) overlaps to some extent in natural water (Guo et al., 2012). Besides, the artificial hybridization experiment only for scientific purposes has succeed before. Maybe the discrepancy could be explained in terms of introgressive hybridization or incomplete lineage sorting. Therefore, some academics speculated that A. laticeps should be a specialized species within the Schizothorax genus (Yang et al., 2011; Haysa et al., 2014). But the accuracy remains to be further tested and investigated from the whole genome level.
Conclusion
In this report, we sequenced the complete mitogenomes of G. dybowskii collected from two distinctively different water systems in Xinjiang. The organization and gene arrangement of the mitogenome was similar to those reported from other schizothoracine fishes. However, comparative genomic analysis revealed that the mtDNA genomic features were apparently different in two G. dybowskii individuals, with 7.4% sequence divergence between them, indicating a potential cryptic species or subspecies of G. dybowskii in Kaidu River. It was speculated that geographical isolation of Tianshan Moutains caused and increased the genetic differentiation of G. dybowskii populations. In addition, the phylogenetic relationships of G. dybowskii together with 48 related species were analyzed by Neighbor-Joining method. The topological structure showed that schizothoracine fishes form a strongly supported monophyletic group that was a sister taxon to Barbus barbus. The primitive grade schizothoracine fishes formed monophyletic group, and constituted sister group relationships with specialized grade schizothoracine fishes + highly specialized schizothoracine fishes. The findings could hopefully provide the basis of the genetic conservation management of G. dybowskii in Xinjiang.
Acknowledgments
We are grateful to Mr. Chen Peng and Mr. Niu Jiangong for sampling collecting from Tarim River and Ili River, respectively. This study is supported by the Scientific Research Startup Foundation of Zhejiang Ocean University (2016-2017) and the National Natural Science Foundation of China (No. 31360637).
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Arnason, U., Gullberg, A. and Xu, X., 2010. A complete mitochondrial DNA molecule of the white-handed gibbon, Hylobates lar, and comparison among individual mitochondrial genes of all hominoid genera. Hereditas, 124: 185-189. https://doi.org/10.1111/j.1601-5223.1996.00185.x
Avise, J.C., 1994. Molecular markers, natural history and evolution. Chapman and Hall, New York. https://doi.org/10.1007/978-1-4615-2381-9
Avise, J.C. and Walker, D., 1999. Species realities and numbers in sexual vertebrates: perspectives from an asexually transmitted genome. Proc. natl. Acad. Sci., 96: 992-995. https://doi.org/10.1073/pnas.96.3.992
Cao, W.X., Chen, Y.Y., Wu, Y.F. and Zhu, S.Q., 1981. Origin and evolution of Schizothoracine fishes in relation to the upheaval of the Xizang Plateau. Studies on the period, amplitude and type of the uplift of the Qinghai-Xizang Plateau. Tibetan Expedition Team of the Chinese Academy of Science, Science Press, Beijing, pp. 118-130.
Chen, Y.F. and Cao, W.Y., 2000. Schizothoracinae. Fauna Sinica, Osteichthyes, Cypriniformes III. Science Press, Beijing, pp. 273-335.
Edgar, R.C., 2004. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res., 32: 1792-1797. https://doi.org/10.1093/nar/gkh340
Gao, F. and Chen, J., 2016. EasyCodeML: An interactive visual tool for CodeML analysis. Available at: http://blog.sciencenet.cn/blog-460481-974600.html
Gong, X.L., Cui, Z.K., Zhang, X.Y. and Wang, C.H., 2012. Complete mitochondrial DNA sequence of the endangered Tarim schizothoracin (Schizothorax biddulphi Günther). Mitochond. DNA, 23: 385-387. https://doi.org/10.3109/19401736.2012.696635
Guo, Y., Zhang, R.M., Cai, L.G., Ma, Y.W., Niu, J.G., Tiliwaldi, T., Liu, J., Li, N., Li, H., Du, J.S., Adakebaike, K., Haysar, A., Haysa, A. and Xie, C.G., 2012. The Fauna of Xinjiang fishes. Xinjiang science and Technology Press, Urumqi, pp. 12-13.
Haysa, A., Guo, Y., Meng, W., Yang, T.Y. and Ma, Y.W., 2014. Phylogeny and divergence time estimation of Schizothoracinae fishes in Xinjiang. Hereditas, 36: 1013-1020.
Hebert, P.D.H., Ratnasingham, S. and de-Waard, J.R., 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. biol. Sci., 270: 96-99. https://doi.org/10.1098/rsbl.2003.0025
Heckel, J.J., 1838. Fische aus Caschmir, gesammelt und herausgegeben von Carl Freiherrn von Hügel, beschrieben von Joh Jacob Heckel. Taylor & Francis, Vienna, pp. 11-112.
He, D.K., Chen, Y.F., Chen, Y.Y. and Chen, Z.M., 2004. Molecular phylogeny of the specialized schizothoracine fishes (Teleostei: Cyprinidae), with their implications for the uplift of the Qinghai-Tibetan Plateau. Chin. Sci. Bull., 49: 39-48. https://doi.org/10.1360/03wc0212
He, D.K. and Chen, Y.F., 2006. Biogeography and molecular phylogeny of the genus Schizothorax (Teleostei: Cyprinidae) in China inferred from cytochrome b sequences. J. Biogeogr., 33: 1448-1460. https://doi.org/10.1111/j.1365-2699.2006.01510.x
He, D.K. and Chen, Y.F., 2007. Molecular phylogeny and biogeography of the highly specialized grade schizothoracine fishes (Teleostei: Cyprinidae) inferred from cytochrome b sequences. Chin. Sci. Bull., 52: 777-788. https://doi.org/10.1007/s11434-007-0123-2
He, D.K., Chen, Y.F., Liu, C.L., Tao, J., Ding, C.Z. and Chen, Y.Y., 2016. Comparative phylogeography and evolutionary history of schizothoracine fishes in the Changtang Plateau and their implications for the lake level and Pleistocene climate fluctuations. Ecol. Evol., 6: 656-674. https://doi.org/10.1002/ece3.1890
Hurst, L.D., 2002. The Ka/Ks ratio: Diagnosing the form of sequence evolution. Trends Genet., 18: 486-487. https://doi.org/10.1016/S0168-9525(02)02722-1
Jiang, M., Yang, C. and Wen, H., 2014. The complete mitochondrial genome of Aspiorhynchus laticeps and its phylogenetic analysis. Meta Gene, 2: 218-225. https://doi.org/10.1016/j.mgene.2014.01.006
Kartavtsev, Y.P. and Lee, J.S., 2006. Analysis of nucleotide diversity at the cytochrome b and cytochrome oxidase 1 genes at the population, species, and genus levels. Genetika, 42: 437-461. https://doi.org/10.1134/S1022795406040016
Li, G.G., Peng, Z.G., Zhang, R.Y., Tang, Y.T., Tong, C., Feng, C.G., Zhang, C.F. and Zhao, K., 2016. Mito-nuclear phylogeography of the cyprinid fish Gymnodiptychus dybowskii in the arid Tien Shan region of Central Asia. Biol. J. Linn. Soc., 118: 304-314. https://doi.org/10.1111/bij.12724
Maniatis, T., Fritsch, E. and Sambrook, J., 1982. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York.
Meng, W., Yang, T.Y., Guo, Y., Hai, S., Ma, Y.W., Ma, X.F. and Cai, L.G., 2015. Remarkable genetic divergence of Gymnodiptychus dybowskii between south and north of Tianshan Mountain in northwest China. Biochem. Syst. Ecol., 58: 48-50. https://doi.org/10.1016/j.bse.2014.10.005
Mirza, M.R., 1991. A contribution to the systematics of the Schizothoracine fishes (Pisces: Cyprinidae) with the description of three new tribes. Pakistan J. Zool., 23: 339-341.
Moore, W.S., 1995. Inferring phylogenies from mtDNA variation: Mitochondrial-gene trees versus nuclear gene trees. Evolution, 49: 718-726. https://doi.org/10.1111/j.1558-5646.1995.tb02308.x
Nielsen, R., 2005. Molecular signatures of natural selection. Annu. Rev. Genet., 39: 197-218. https://doi.org/10.1146/annurev.genet.39.073003.112420
Palumbi, S.R., 1996. Nucleic acids II: The polymerase chain reaction. In: Molecular systematics (eds. D.M, Hillis, C. Moritz and B.K. Mable). Sinauer Associates Inc., Sunderland, pp. 205-247.
Qi, D.L., Li, T.P., Zhao, X.Q., Guo, S.C. and Li, J.X., 2006. Mitochondrial cytochrome b sequence variation and phylogenetics of the highly specialized Schizothoracine fishes (Teleostei: Cyprinidae) in the Qinghai-Tibet Plateau. Biochem. Genet., 44: 270-285. https://doi.org/10.1007/s10528-006-9022-5
Qi, D.L., Guo, S.C., Chao, Y., Kong, Q.H., Li, C.Z., Xia, M.Z., Xie, B.S. and Zhao, K., 2015. The biogeography and phylogeny of schizothoracine fishes (Schizopygopsis) in the Qinghai-Tibetan Plateau. Zool. Scr., 44: 523-533. https://doi.org/10.1111/zsc.12116
Sabit, M., 2012. Geography of Xinjiang. Beijing Normal University Press, Beijing.
Tong, C., Tang, Y.T. and Zhao, K., 2017. The complete mitochondrial genome of Gymnocypris przewalskii kelukehuensis (Teleostei: Cyprinidae). Conserv. Genet. Resour., 9: 1-3. https://doi.org/10.1007/s12686-017-0707-3
Wang, D.Z., 1998. The Schizothoracinae fishes in Xinjiang. Arid Zone Res., 15: 26-32.
Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. and Hebert, P.D., 2005. DNA barcoding Australia’s fish species. DNA barcoding Australia’s fish species. Phil. Trans. R. Soc. B., 360: 1847-1857. https://doi.org/10.1098/rstb.2005.1716
Wu, Y.F., 1984. Systematic studies on the Cyprinid fishes of the subfamily Schizothoracinae from China. Acta Biol. Plat. Sin., 3: 119-140.
Xiao, H., Chen, S.Y., Liu, Z.M., Zhang, R.D., Li, W.X., Zan, R.G. and Zhang, Y.P., 2005. Molecular phylogeny of Sinocyclocheilus (Cypriniformes: Cyprinidae) inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol., 36: 67-77. https://doi.org/10.1016/j.ympev.2004.12.007
Xiao, W., Zhang, Y. and Liu, H., 2001. Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): Taxonomy, biogeography and coevolution of a special group restricted in East Asia. Mol. Phylogenet. Evol., 2: 163-173. https://doi.org/10.1006/mpev.2000.0879
Yang, T.Y., Meng, W., Gao, T.X., Hai, S. and Guo, Y., 2016. Complete mitochondrial genome of Diptychus maculatus (Cypriniformes: Cyprinidae: Schizothoracinae). Mitochond. DNA, 27: 2020-2021. https://doi.org/10.3109/19401736.2014.953098
Yang, T.Y., Meng, W., Hai, S., Zhang, R.M. and Guo, Y., 2011. Molecular phylogeny of Schizothoracinae fishes in Xinjiang based on mitochondrial cytochrome b gene sequences. Arid Zone Res., 28: 555-561.
Yang, Z. and Bielawski, J.P., 2000. Statistical methods for detecting molecular adaptation. Trends Ecol. Evol., 15: 496-503. https://doi.org/10.1016/S0169-5347(00)01994-7
Zhang, J., Chen, Z., Zhou, C.J. and Kong, X.H., 2016. Molecular phylogeny of the subfamily Schizothoracinae (Teleostei: Cypriniformes: Cyprinidae) inferred from complete mitochondrial genomes. Biochem. Syst. Ecol., 64: 6-13. https://doi.org/10.1016/j.bse.2015.11.004