Complete Mitochondrial DNA Genome Sequences for Two Lineages in Coilia mystus (Clupeiformes: Engraulididae): Mitogenomic Perspective on the Phylogenetic Relationships of Genus Coilia
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
1College of Marine Sciences, Shanghai Ocean University, Shanghai 201306, China
2State Key Laboratory of Satellite Ocean Environment Dynamics, The Second Institute of Oceanography, State Oceanic Administration, Hangzhou 310012, China
3Marine Fisheries Research Institute of Zhejiang Province, Zhoushan 316021, China
4Fishery College, Ocean University of China, Qingdao 266003, China
5Fishery College, Zhejiang Ocean University, Zhoushan 316022, China
Ai Guo and Jiaguang Xiao contributed equally to this study.
ABSTRACT
To better understand the genetic diversity and phylogeny of Coilia, the complete mitochondrial genomes of two lineages in Coilia mystus were compared. They were all typical circular double stranded DNA molecule with 17075 bp in C. mystus N and 16964 bp in C. mystus S, respectively, containing the standard metazoan set of 22 transfer RNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and non-coding regions. The mitogenomes of C. mystus N and C. mystus S shared the identical structural organization and gene arrangement with those of other Coilia fishes. Both lineages of C. mystus showed similar features in not only the strand-specific asymmetry of nucleotide composition, but also the codon usage of genes. Whereas a significant variation among Coilia species was detected in length of the control region, mainly caused by the variable number of tandem repeats. Phylogenetic analysis was performed based on 13 concatenated mitochondrial protein-coding genes from 8 Coilia mitochondrial genomes. The results supported that C. lindmani at first clustered with C. nasus and C. grayii which had close relationships (d=0.028), then clustered with C. mystus which exhibited obvious genetic differentiation between C. mystus N and C. mystus S (d=0.083). C. reynaldi was at the basal part of the trees, and showed obvious genetic differentiations with other Coilia species (d>0.19). Our results suggested that the north and south lineages of C. mystus could be genetically distinct as different species.
Article Information
Received 17 June 2017
Revised 24 August 2017
Accepted 02 October 2017
Available online 06 September 2018
Authors’ Contribution
AG, JX, TG and YZ conceived and designed the experiments. JX and BS performed the experiments and analyzed the data. AG, TG and YZ contributed reagents/materials. AG, JX and BS wrote the article. TG and YZ proofread the manuscript and approved the final version.
Key words
Coilia mystus, Mitochondrial genome, Genome structure, Genetic divergence, Phylogeny.
DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.6.2141.2151
* Corresponding author: [email protected]
0030-9923/2018/0006-2141 $ 9.00/0
Copyright 2018 Zoological Society of Pakistan
Introduction
As an important functional eukaryotic organelle, mitochondria become highly economized and conserved (Boore, 1999). Most genes of the original endosymbiont are lost or have been transferred to the nucleus after the Genome Reductive Evolution (GRE) process (Andersson and Kurland, 1998; Khachane et al., 2007; Ghiselli et al., 2013; Kannan et al., 2014). In animals, mitochondrial DNA (mtDNA) is a compact double-stranded circular molecule that typically contains 13 protein-coding genes (PCGs), 2 ribosomal RNA genes and 22 transfer RNAs. Moreover, a large noncoding control region (CR) commonly related to the initiation of transcription and replication sequences usually presents in CRs (Boore 1999; Breton et al., 2014). The mtDNA genomes have played a significant role in the studies of population genetics and reconstruction of phylogeny due to their intrinsic properties (i.e., fast evolutionary rate, high information content, maternal inheritance and lack of recombination) (Simon et al., 2006).
Fish of the genus Coilia are small to moderate in size and primarily inhabit in coastal waters or estuaries in the Indo-West Pacific region, and some of them can tolerate low salinities in freshwater (Wongratana, 1980). Taxonomical debates and genetic divergence of Coilia, especially Coilia nasus and Coilia mystus in China, are always the hot topics of research. At present, it is commonly accepted that Coilia brachygnathus and Coilia nasus taihuensis are synonym of C. nasus (Yang et al., 2010), because small genetic divergence has been found between diadromous and freshwater ecotypes of C. nasus (Cheng and Lu, 2005; Yang et al., 2010). C. mystus which is widely distributed along the coast of China is a short distance migration fish (Whitehead, 1985). Initially, three clades of C. mystus were described as the Yangtze River group, the Minjiang River group and the Pearl River group, respectively (Cheng et al., 2008; Yan et al., 2009). Recently, the updated conclusion revealed C. mystus should be divided into two clades: C. mystus Northern populations (N) and C. mystus Southern populations (S) (Yang, 2012). The C. mystus (N) which was distributed in the north of the coast of Ningbo in China, was just the above-mentioned Yangtze River group; the C. mystus (S) which widely lived in the rest of southern coast of China consist of the Minjiang River group and the Pearl River group as previously described (Yang, 2012). Actually, there is no significant differentiation in morphological characters between C. mystus (N) and C. mystus (S), excepting on the number of gill rakers and vertebra (Yang, 2012).
In this study, we compared the complete mitogenomes of five Coilia species to explore the divergence among different species and lineages of C. mystus. Phylogenetic analysis was conducted based on the protein coding genes of the mitogenomes using the Maximum Likelihood (ML) and the Bayesian Inference (BI) methods to gain insight on the genetic diversity between two lineages of C. mystus and its phylogenetic status in genus Coilia.
Materials and methods
Samples collection and sequencing
Two specimens of C. mystus, namely, C. mystus Northern populations (N) and C. mystus Southern populations (S), collected from Shanghai and Daya Bay in the coast of China, respectively, were sequenced in this study. The identifications of C. mystus N and C. mystus S were based on the results of Yang (2012). Moreover, six mitochondrial genome sequences were downloaded from GenBank for genetic comparation and phylogenetic reconstruction, including Coilia grayii, Coilia lindmani, Coilia reynaldi and three specimens of C. nasus (Table II, Lavoue et al., 2010; Zhang et al., 2016, a, b; Zhao et al., 2016). Total genomic DNA was isolated from the muscle tissue by proteinase K digestion followed by the standard phenol/chloroform method (Sambrook and Russell, 2001).
The complete mitogenomes of C. mystus were amplified using a long-PCR technique (Chang et al., 1994; Miya and Nishida, 1999) and primer-walking method. Both PCR primers were designed referring to congeneric mitogenome sequence available in GenBank and implemented in Primer Premier 5.0 software (PRIMER Biosoft International). Contiguous segments overlapped by at least 50 bp to ascertain the accuracy of sequencing. Long-PCR and normal PCR reactions were performed in a TAKARA thermal cycler following the standard procedures (Cheng et al., 2012). All fragments were sequenced on ABI Prism 3730 from both strands after purification.
Sequence annotation and analysis
Sequences were edited and aligned using DNASTAR software (DNASTAR, Madison, WI, USA) with default parameters, and refined manually. Locations for protein-coding genes and rRNAs were identified by DOGMA (Wyman et al., 2004). Gene predictions were further improved by comparing DNA sequences with those of C. nasus, C. lindmani and C. reynaldi. The base composition and codon usage of the 13 protein-coding genes were analyzed with Mega 5.0 (Tamura et al., 2011). Nucleotide composition skew analysis was carried out with the formulas AT-skew = [A - T] / [A + T] and GC-skew = [G - C] / [G + C], respectively (Perna and Kocher, 1995). Most tRNA genes were identified by their proposed cloverleaf secondary structures using web-based tRNAscan-SE software (http://lowelab.ucsc.edu/tRNAscan-SE/). The remaining tRNA genes unidentified were determined by inspecting sequences for tRNA-like secondary structures and anticodons. Control region was identified by comparing with the homologous sequences. Variable number of tandem repeats (VNTRs) were detected using Tandem Repeats Finder (Benson, 1999).
Phylogenetic reconstruction
Phylogenetic analysis was performed based on 13 concatenated mitochondrial PCGs from 8 Coilia mitochondrial genomes, Engraulis japonicas (NC_003097) (Inoue et al., 2001a) and Engraulis encrasicolus (NC_009581) (Lavoue et al., 2007) were used as the out-groups. Nucleotide sequences from all 10 mitochondrial PCGs were edited and aligned using ClustalX 1.83 under default settings (Thompson et al., 1997), stop codons and gaps were removed and finally concatenated into a sequence matrix (11,391 sites in length).
The phylogenetic trees were built using two approaches including maximum-likelihood (ML) analysis by PAUP* 4.0 (Swofford, 2002) and a partitioned Bayesian inference (BI) analysis by Mrbayes 3.12 (Huelsenbeck and Ronquist, 2001). Substitution model selection was conducted by a comparison of Akaike Information Criterion (AIC) scores (Akaike, 1974) with jModelTest 2 (Darriba et al., 2012). GTR + G model was chosen as the best-fitting model for ML analyses and the node reliability was estimated after 1000 bootstrap replicates. For the Bayesian procedure, a set of optimal models was selected for different positions (GTR+I+G for the 1st and the 3rd positions, GTR+I for the 2nd position). Four Markov chains were run for 1,000,000 generations by sampling the trees every 1000 generations. After the first 2500 trees (25%) were discarded as burn-in, the 50% majority rule consensus tree and the Bayesian posterior probabilities (BPP) were estimated using the remaining 7500 sampled trees.
Table I.- Characteristics of the mitochondrial genomes of C. mystus N and C. mystus S.
|
Gene/Region |
Position |
Size (bp) Nucleotide (N/S) |
Am ino acid |
Gapb (N/S) |
Codon |
Str and |
||
|
From(N/S) |
To (N/S) |
Start |
Stopa |
|||||
|
tRNAPhe |
1 |
69 |
69 |
0 |
H |
|||
|
12S rRNA |
70 |
1022 |
953 |
0 |
H |
|||
|
tRNAVal |
1023 |
1094 |
72 |
0 |
H |
|||
|
16S rRNA |
1095 |
2786 |
1692 |
0 |
H |
|||
|
tRNALeu(UUR) |
2787 |
2861 |
75 |
0 |
H |
|||
|
ND1 |
2862 |
3836 |
975 |
324 |
1 |
ATG |
TAA |
H |
|
tRNAIle |
3838 |
3909 |
72 |
-1 |
H |
|||
|
tRNAGln |
3909 |
3979 |
71 |
-1 |
L |
|||
|
tRNAMet |
3979 |
4047 |
69 |
0 |
H |
|||
|
ND2 |
4048 |
5093 |
1046 |
348 |
0 |
ATG |
TA |
H |
|
tRNATrp |
5094 |
5163 |
70 |
2 |
H |
|||
|
tRNAAla |
5166 |
5234 |
69 |
1 |
L |
|||
|
tRNAAsn |
5236 |
5308 |
73 |
0 |
L |
|||
|
OL |
5309 |
5342/5341 |
34/33 |
-3 |
H |
|||
|
tRNACys |
5340/5339 |
5405/5404 |
66 |
0 |
L |
|||
|
tRNATyr |
5406/5405 |
5476/5475 |
71 |
1 |
L |
|||
|
CO I |
5478/5477 |
7022/7021 |
1545 |
514 |
0 |
GTG |
TAA |
H |
|
tRNASer(UCN) |
7023/7022 |
7093/7092 |
71 |
5 |
L |
|||
|
tRNAAsp |
7099/7098 |
7166/7165 |
68 |
11 |
H |
|||
|
CO II |
7178/7177 |
7868/7867 |
691 |
230 |
0 |
ATG |
T |
H |
|
tRNALys |
7869/7868 |
7941/7940 |
73 |
1 |
H |
|||
|
ATPase8 |
7943/7942 |
8110/8109 |
168 |
55 |
-10 |
ATG |
TAA |
H |
|
ATPase6 |
8101/8100 |
8783/8782 |
683 |
227 |
0 |
ATG |
TA |
H |
|
CO III |
8784/8783 |
9568/9567 |
785 |
261 |
0 |
ATG |
TA |
H |
|
tRNAGly |
9569/9568 |
9639/9638 |
71 |
0 |
H |
|||
|
ND3 |
9640/9639 |
9989/9988 |
350 |
116 |
-1 |
ATG |
TA |
H |
|
tRNAArg |
9989/9988 |
10057/10056 |
69 |
0 |
H |
|||
|
ND4L |
10058/10057 |
10354/10353 |
297 |
98 |
-7 |
ATG |
TAA |
H |
|
ND4 |
10348/10347 |
11728/11727 |
1381 |
460 |
0 |
ATG |
T |
H |
|
tRNAHis |
11729/11728 |
11797/11796 |
69 |
1 |
H |
|||
|
tRNASer(AGY) |
11799/11798 |
11865/11864 |
67 |
0 |
H |
|||
|
tRNALeu(CUN) |
11866/11865 |
11937/11936 |
72 |
0 |
H |
|||
|
ND5 |
11938/11937 |
13773/13772 |
1836 |
611 |
-4 |
ATG |
TAA |
H |
|
ND6 |
13770/13769 |
14291/14290 |
522 |
173 |
1 |
ATG |
TAA |
L |
|
tRNAGlu |
14293/14292 |
14361/14360 |
69 |
5/4 |
L |
|||
|
Cyt b |
14367/14365 |
15507/15505 |
1141 |
380 |
0 |
ATG |
T |
H |
|
tRNAThr |
15508/15506 |
15577/15575 |
70 |
-1 |
H |
|||
|
tRNAPro |
15577/15575 |
15647/15645 |
71 |
0 |
L |
|||
|
Control region |
15648/15646 |
17075/16964 |
1428/1319 |
H |
||||
a, TA and T represent incomplete stop codons; b, positive numbers correspond to the nucleotides separating adjacent genes, negative numbers indicate overlapping nucleotides.
Results and discussion
General features of the mitogenomes
The complete mitogenome sequences of C. mystus N and C. mystus S were 17, 075 bp and 16,964 bp in length (Fig. 1, Table I). Actually, C. mystus N had the longest mitogenome and the shortest was that of C. lindmani (16835 bp) in all sequenced Coilia species (Table II). Length differences were primarily the result of variation in intergenic nucleotides and the control region, predominately, variable number tandem repeats detected in control regions of all eight mitogenomes of Coilia fishes. The mitogenomes of C. mystus N and C. mystus S had the same structural organization and gene arrangement with those of other Coilia fishes (Fig. 1). Both C. mystus N and C. mystus S exhibited a clear strand-specific bias in composition, most of the genes were encoded on the heavy stand (H-strand) except for ND6 and 8 tRNAs (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro), which were oriented to on the light strand (L-strand). These features also could be found in other vertebrates (Lavoue et al., 2010, 2013; Li et al., 2013; Liu et al., 2017; Shan et al., 2014; Teacher et al., 2012).
The AT content of mitogenomes varied among Coilia taxa (Table II) from 56.3% (C. reynaldi) to 57.8% (C. mystus N). Overall structural compositions of Coilia, this specific bias in nucleotide composition commonly exhibited excepting the first codon positions of PCGs like other bony fishes (Mabuchi et al., 2007; Cheng et al., 2012; Xiao, 2015). For GC- / AT-skews analysis, all Coilia species were displayed a positive AT-skew from 0.069 (C. mystus N) to 0.094 (C. reynaldi), especially in rRNA genes (≥0.255), and a strong negative GC-skew from -0.257 (C. mystus N) to -0.271 (C. nasus PYH and C. grayii), especially in PCGs (≤-0.274) (Supplementary Table I).
Table II.- Genomic characteristics of eight Coilia mitochondrial genomes.
|
Species |
Gen Bank acces sion |
Genome |
13 protein-coding genes |
2 rRNA |
22 tRNA |
CR |
||||||||
|
L (bp) |
A+T (%) |
L (bp)* |
A+T (%) |
L (bp) |
A+T (%) |
L (bp) |
A+T (%) |
L (bp) |
A+T (%) |
|||||
|
All pos. |
1st cod pos. |
2nd cod pos. |
3rd cod pos. |
|||||||||||
|
C. mystus S |
MF36 3002 |
16964 |
57.6 |
11391 |
57.5 |
49.7 |
58.5 |
64.4 |
2645 |
54.0 |
1548 |
55.7 |
1319 |
67.6 |
|
C. mystus N |
MF36 3003 |
17075 |
57.8 |
11391 |
57.9 |
49.7 |
58.4 |
65.6 |
2645 |
53.7 |
1548 |
55.0 |
1428 |
67.4 |
|
C. nasus AS |
KM25 7636 |
16900 |
57.5 |
11391 |
57.5 |
49.5 |
58.5 |
64.6 |
2641 |
54.0 |
1549 |
55.3 |
1252 |
66.7 |
|
C. nasus NB |
KM36 3243 |
16896 |
57.5 |
11391 |
57.6 |
49.5 |
58.5 |
64.7 |
2641 |
54.0 |
1549 |
55.3 |
1252 |
66.3 |
|
C. nasus PYH |
KM2 76661 |
16896 |
57.5 |
11391 |
57.5 |
49.5 |
58.5 |
64.6 |
2641 |
54.1 |
1549 |
55.5 |
1252 |
67.1 |
|
C. reynaldi |
NC01 4276 |
17064 |
56.3 |
11391 |
55.6 |
48.5 |
58.4 |
59.8 |
2641 |
53.7 |
1550 |
54.5 |
1419 |
69.2 |
|
C. grayii |
KP31 7088 |
16851 |
57.2 |
11391 |
57.4 |
49.3 |
58.4 |
64.5 |
2640 |
53.7 |
1549 |
55.4 |
1208 |
65.2 |
|
C. lindmani |
NC01 4271 |
16835 |
56.7 |
11391 |
56.9 |
49.0 |
58.4 |
63.2 |
2640 |
53.8 |
1550 |
55.1 |
1191 |
63.7 |
*excluding the stop codons; L, length; pos., position.
Protein-coding genes and Codon usage
All 13 protein-coding genes found in other vertebrates were also present in C. mystus N and C. mystus S as well as other Coilia species, including three subunits of the cytochrome c oxidase (COI-III), seven subunits of the NADH ubiquinone oxidoreductase complex (ND1-6, ND4L), one subunit of the ubiquinol cytochrome b oxidoreductase complex (Cyt b), and two subunit of ATP synthases (ATP6 and ATP8) (Fig. 1, Table I). Without regard to the stop codons, the length of 13 protein-coding genes were exactly same (11391 bp) among all the Coilia species (Table II). The mitogenome of C. mystus N and C. mystus S exhibited a canonical genetic code shared by most vertebrates (Inoue et al., 2001b; Ramakodi et al., 2015). An orthodox initiation codon ATG was used for all protein-coding genes except for COI starting with GTG (Table I). A diverse pattern of codon usage within stop codons consisting complete stop codon and incomplete stop codon was showed in Table I, which seems to be a common tendency in fish mitogenomes (Cheng et al., 2012; Li et al., 2013).
The mitochondrial genomes of C. mystus N and C. mystus S consisted of 3797 codons excluding stop codons. Codons for Leucine possessed the highest percentage value of 15.39% and 16.01%, which may be related to the function of chondriosome of encoding many transmembrane proteins (Gillespie et al., 2006), while those for Cysteine were the least represented with a percentage value of 0.82% and 0.81%, as observed in other Coilia fishes (Supplementary Fig. S1; Zhang, 2015). Comparing the relative synonymous codon usage (RSCU) of Coilia, it showed the similar tendency in H-strand that A-terminal was in great abundance and G-terminal was extremely destitute (Fig. 2). The underlying mechanism responsible for the strand bias has been generally interpreted as evidence of an asymmetrical directional mutation pressure associated with replication processes when one strand remains transiently in a single-stranded state, making it more vulnerable to DNA damage (Perna and Kocher, 1995).
Transfer and ribosomal RNA genes
The complete set of 22 tRNA genes which were usually found in metazoans was present in C. mystus N and C. mystus S mitogenome. In addition, 14 tRNA genes were transcribed on the H-strand, whereas other 8 tRNA genes were oriented to the L-strand (Table I). Although G-U wobbles and other atypical pairings were constantly detected, typical cloverleaf secondary structures were shown for 21 tRNA genes with the exception of tRNASer (AGY) who lacked the recognizable DHU stem found in almost all vertebrate mitogenomes (Li, 2014; Miya and Nishida, 1999; Zhang et al., 2016a). Stem mismatches were common for mitochondrial tRNA genes and were probably repaired via a post-transcriptional editing process (Lavrov et al., 2000).
The two rRNA genes which were identified in C. mystus N and C. mystus S with no length variation, a small (12S) subunit of rRNA comprising 953 bp long and a large (16S) subunit of 1692 bp, were also similar size to their counterparts in other Coilia mitogenomes (Table II). But subtle differences also existed, 16S rRNA in C. nasus and C. reynaldi were 1688 bp, 16S rRNA in C. grayii and C. lindmani were 1687 bp (Zhang, 2015).
Control region and sequence repeats
Mitochondrial control region is the major non-coding segment in the vertebrate mitogenome which is AT-rich and highly variable by a faster rate of evolution (Sbisa et al., 1997). This region frequently lead to the length variation in the whole mitogenome, whereas its control elements related to regulatory functions are known to be highly conserved (Arnason and Rand, 1992; Broughton and Dowling, 1994; Lunt et al., 1998). The control region of both C. mystus was located between the tRNAPro and tRNAPhe genes, and determined to be 1428 bp in C. mystus N and 1319 bp in C. mystus S. Actually, C. mystus N had the longest control region and the shortest was that of C. lindmani (1191 bp) in all sequenced Coilia species (Table II). The variable number tandem repeats (VNTRs) which was common in genus Coilia fishes (Zhu et al., 2008), was the main reason for different length among Coilia. The VNTRs were found always presenting after about 200bp at the start of control region and having different type among Coilia species. It is worth mentioning that it showed different type and size repeats between two linages of C. mystus, however it shared the identical repeat and times among three C. nasus (Fig. 3, Table III). The different type and size of repeat unit between two lineages of C. mystus provided strong evidence to support that the two clades may represent different species. The VNTRs were believed resulting from illegitimate elongation model (Buroker et al., 1990).
The structures of control region for Coilia species were identical except for the length change. By comparing with the recognition sites among Coilia species, three conservative domains were detected: the extended termination associated sequence domain (TAS), the central conserved sequence block domain and the conserved sequence block domain (Fig. 3). The motif-TACAT in TAS was easily found, and so was the complementary TAS (cTAS) motif-ATGTA in the extended termination associated sequence domain which may function as a recognition site for terminating synthesis of heavy strand (Clayton, 1991). Moreover, the VNTRs were in this domain. In the central conserved sequence block domain, CSB-F which distinguished the central conserved sequence block domain from the termination associated sequence domain, CSB-E which was always characterized by the GTGGG box and CSB-D were recognized. The conserved sequence block domain which was thought to be involved in positioning RNA polymerase both for transcription and for priming replication (Shadel and Clayton, 1997) was characterized by CSB1, CSB2 and CSB3.
Table III.- The variable number tandem repeats (VNTRs) among genus Coilia.
|
Species |
Repeat unit |
Rep eat unit (bp) |
Repeat time |
|
C. mystus S |
ATATTATGCATTATATTACATATATATTATGGTATAGTAC |
40 |
6 |
|
C. mystus N |
GTACATACTATGCATTATATTACATATATTATGGTATA |
38 |
9 |
|
C. nasus |
ATATTACATATATTATGGTATAGTACATACTATGTATT |
38 |
5 |
|
C. reynaldi |
TACATATATGATATAGTACATACTATGCATTATATTACA |
39 |
12 |
|
C. grayii |
TATATTACATATATTATGGTATAGTACATACTATGTAT |
38 |
4 |
|
C. lindmani |
CATATTATGTATTATATTACATATATTATGGTATAGTA |
38 |
3 |
Table IV.- Matrix of net average genetic distances based on 13 protein-coding genes sequences among genus Coilia.
|
C. mystus S |
C. mystus N |
C. nasus |
C. grayii |
C. lindmani |
|
|
C. mystus N |
0.083 |
||||
|
C. nasus |
0.083 |
0.080 |
|||
|
C. grayii |
0.086 |
0.082 |
0.028 |
||
|
C. lindmani |
0.095 |
0.093 |
0.051 |
0.055 |
|
|
C. reynaldi |
0.195 |
0.194 |
0.195 |
0.197 |
0.198 |
Divergence of the two C. mystus mitogenomes
A sliding window analysis was used to quantify genome-wide nucleotide variability between C. mystus N and C. mystus S, contrastively, a same analysis between C. mystus N and C. mystus (a downloaded sequence from GenBank, KJ710625) was also performed (Fig. 4). The divergences between C. mystus N and C. mystus S were much higher (Fig. 4A) when compared with the nucleotide divergences between the C. mystus N and C. mystus (KJ710625) which was also collected from Yangtze estuary (<0.05, Fig. 4B). The higher divergences were showed in ND1, ND4, ND5, ND6 and Cyt b, while lower divergences were observed in tRNA or rRNA. From the nucleotide divergence analysis, it could demonstrate that there were obvious genetic divergences between north lineage and south lineage in C. mystus.
Phylogenetic analysis
ML and BI analyses are done with the concatenated nucleotide data containing 8 Coilia sequences and two outgroup taxa. The topological relationships of two phylogenetic analyses remained consistent, and all analyses provided high bootstrap support values for all internodes (Fig. 5). The resultant topology showed C. lindmani at first clustered with C. nasus and C. grayii which had close relationships. Then they clustered with the clade C. mystus which exhibited obvious genetic differentiation between C. mystus N and C. mystus S. C. reynaldi was at the basal part of the trees, and was showed obvious genetic differentiations with other Coilia species (Table IV). In accordance with the phylogenetic analyses, the genetic distance between C. mystus N and C. mystus S also revealed the obvious genetic differentiation (0.083), even higher than the genetic distance among C. nasus, C. grayii and C. lindmani (0.028~0.055). In conclusion, the mitogenomic data supported the deep intraspecific differentiations in C. mystus, revealing that C. mystus N and C. mystus S might be the different species.
For the first time, our study investigates phylogenetic relationships within genus Coilia based on the complete mitogenome sequences. The tree topologies obtained in the present study were identical regardless of the analytic method used, and were statistically well supported by high bootstrap and posterior probability values. Therefore, the result suggested that the north and south lineages of C. mystus could be genetically distinct as different species. The divergences of north and south lineages of C. mystus was probably on account of the drastic changes of sea level on ice age of Pleistocene (Yang, 2012; Liu et al., 2012). The C. mystus was separated in two shelters. Moreover, C. mystus was short-distance migration species (Whitehead, 1985). This life habit might have great influences on the divergences of north and south lineages of C. mystus.
Acknowledgments
We are grateful to Ms. Nan Zhang for her constructive suggestions on the manuscript and technical assistance and we gratefully thank Cunyin Dou, Yuting Wang and Yancui Chen for collecting the specimens. This work was supported by Special Fund for Agro-scientific Research in the Public Interest (No. 201303048 and No. 201303050) and the Scientific Startup Foundation of Zhejiang Ocean University (Q1505). We declare that there are no conflicts of interests regarding the publication of this article and authors are solely responsible for the contents and writing of the paper.
There is supplementary material associated with this article. Access the material online at: http://dx.doi.org/10.17582/journal.pjz/2018.50.6.2141.2151
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Akaike, H., 1974. A new look at the statistical model identification. IEEE Trans. Autom. Contr., 19: 716-723. https://doi.org/10.1109/TAC.1974.1100705
Andersson, S.G. and Kurland, C.G., 1998. Reductive evolution of resident genomes. Trends Microbiol., 6: 263-268. https://doi.org/10.1016/S0966-842X(98)01312-2
Arnason, E. and Rand, D.M., 1992. Heteroplasmy of short tandem repeats in mitochondrial DNA of Atlantic Cod, Gadus morhus. Genetics, 132: 211-200.
Boore, J.L., 1999. Animal mitochondrial genomes. Nucl. Acids Res., 27: 1767-1780. https://doi.org/10.1093/nar/27.8.1767
Benson, G., 1999. Tandem repeats finder: A program to analyze DNA sequences. Nucl. Acids Res., 27: 573-580. https://doi.org/10.1093/nar/27.2.573
Breton, S., Milani, L., Ghiselli, F., Guerra, D., Stewart, D.T. and Passamonti, M., 2014. A resourceful genome: updating the functional repertoire and evolutionary role of animal mitochondrial DNAs. Trends Genet., 30: 555-564. https://doi.org/10.1016/j.tig.2014.09.002
Broughton, R.E. and Dowling, T.E., 1994. Length variation in mitochondrial DNA of the minnow Cyprinella spiloptera. Genetics, 138: 179-190.
Buroker, N.E., Brown, J.R. and Gilbert, T.A., 1990. Length heteroplasmy of sturgeon mitochondrial DNA: an illegitimate elongation model. Genetics, 124: 157-163.
Chang, Y.C., Huang, F.L. and Lo, T.B., 1994. The complete nucleotide sequence and gene organization of carp (Cyprinus carpio) mitochondrial genome. J. mol. Evol., 38: 138-155. https://doi.org/10.1007/BF00166161
Cheng, J., Ma, G.Q., Song, N. and Gao, T.X., 2012. Complete mitochondrial genome sequence of bighead croaker Collichthys niveatus (Perciformes, Sciaenidae): A mitogenomic perspective on the phylogenetic relationships of Pseudosciaeniae. Gene, 491: 210-223. https://doi.org/10.1016/j.gene.2011.09.020
Cheng, Q.Q. and Lu, D.R., 2005. PCR-RFLP analysis of cytochrome b gene does not support Coilia ectenes taihuensis being a subspecies of Coilia ectenes. J. Genet., 84: 307-310. https://doi.org/10.1007/BF02715801
Cheng, Q.Q., Ma, C.Y., Zhuang, P., Sha, Z.X., Lu, X. and Miao, J., 2008. Genetic structure and evolution characters in three populations of Coilia mystus based on cytochrome b gene segment sequence of mitochondrial DNA. J. Fish. China, 32: 1-7.
Clayton, D.A., 1991. Nuclear gadgets in mitochondrial DNA replication and transcription. Trends Biochem. Sci., 16: 107-111. https://doi.org/10.1016/0968-0004(91)90043-U
Darriba, D., Taboada, G.L., Doallo, R. and Posada, D., 2012. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods, 9: 772. https://doi.org/10.1038/nmeth.2109
Ghiselli, F., Milani, L., Guerra, D., Chang, P.L., Breton, S., Nuzhdin, S.V. and Passamonti, M., 2013. Structure, transcription, and variability of metazoan mitochondrial genome: perspectives from an unusual mitochondrial inheritance system. Genome Biol. Evol., 5: 1535-1554. https://doi.org/10.1093/gbe/evt112
Gillespie, J.J., Johnston, J.S., Cannone, J.J., Gutell, R.R., 2006. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): Structure, organization, and retrotransposable elements. Insect mol. Biol., 15: 657-686. https://doi.org/10.1111/j.1365-2583.2006.00689.x
Huelsenbeck, J.P. and Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17: 754-755. https://doi.org/10.1093/bioinformatics/17.8.754
Kannan, S., Rogozin, I.B. and Koonin, E.V., 2014. MitoCOGs: Clusters of orthologous genes from mitochondria and implications for the evolution of eukaryotes. BMC Evol. Biol., 14: 237. https://doi.org/10.1186/s12862-014-0237-5
Khachane, A.N., Timmis, K.N. and Martins dos Santos V.A., 2007. Dynamics of reductive genome evolution in mitochondria and obligate intracellular microbes. Mol. Biol. Evol., 24: 449-456. https://doi.org/10.1093/molbev/msl174
Lavoue, S., Miya, M., Saitoh, K., Ishiguro, N.B. and Nishida, M., 2007. Phylogenetic relationships among anchovies, sardines, herrings and their relatives (Clupeiformes), inferred from whole mitogenome sequences. Mol. phylogenet. Evol., 43: 1096-1105. https://doi.org/10.1016/j.ympev.2006.09.018
Lavoue, S., Miya, M. and Nishida, M., 2010. Mitochondrial phylogenomics of anchovies (family Engraulidae) and recurrent origins of pronounced miniaturization in the order Clupeiformes. Mol. phylogenet. Evol., 56: 480-485. https://doi.org/10.1016/j.ympev.2009.11.022
Lavoue, S., Miya, M., Musikasinthorn, P., Chen, W.J. and Nishida, M., 2013. Mitogenomic evidence for an Indo-West Pacific origin of the Clupeoidei (Teleostei: Clupeiformes). PLoS One, 8: e56485. https://doi.org/10.1371/journal.pone.0056485
Lavrov, D.V., Brown, W.M. and Boore, J.L., 2000. A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus. Proc. natl. Acad. Sci. U.S.A., 97: 13738-13742. https://doi.org/10.1073/pnas.250402997
Li, N., Zhang, Z.H., Zhao, L.L. and Gao, T.X., 2013. Complete mitochondrial DNA sequence of the Pacific sand lance Ammodytes hexapterus (Perciformes: Ammodytidae): Mitogenomic erspective on the distinction of Ammodytes hexapterus and Ammodytes personatus. Mitochond. DNA, 24: 463-465. https://doi.org/10.3109/19401736.2013.766180
Li, N., 2014. Molecular phylogeography of sand lance and the red stingray in the Northwestern Pacific. PhD thesis, Ocean University of China, Qingdao, China.
Liu, M., Lin, L.S., Gao, T.X. and Grant, W.S., 2012. What maintains the central north Pacific genetic discontinuity in Pacific herring? PLoS One, 7: e50340. https://doi.org/10.1371/journal.pone.0050340
Liu, Z.S., Song, N., Yanagimoto, T., Han, Z.Q., Shui, B.N. and Gao, T.X., 2017. Complete mitochondrial genome of three fish species (Perciformes: Amblyopinae): genome description and phylogenetic relationships. Pakistan J. Zool., 49: 111-120. http://doi.org/10.17582/journal.pjz/2017.49.1.111.120
Lunt, D.H., Whipple, L.E. and Hyman, B.C., 1998. Mitochondrial DNA variable number tandem repeats (VNTRs): Utility and problems in molecular ecology. Mol. Ecol., 7: 1441-1455. https://doi.org/10.1046/j.1365-294x.1998.00495.x
Inoue, J.G., Miya, M., Tsukamoto, K. and Nishida, M., 2001a. Complete mitochondrial DNA sequence of the Japanese anchovy Engraulis japonicas. Fish. Sci., 67: 828-835. https://doi.org/10.1046/j.1444-2906.2001.00329.x
Inoue, J.G., Miya, M., Tsukamoto, K. and Nishida, M., 2001b. A mitogenomic perspective on the basal teleostean phylogeny: Resolving higher-level relationships with longer DNA sequences. Mol. phylogenet. Evol., 20: 275-285. https://doi.org/10.1006/mpev.2001.0970
Mabuchi, K., Miya, M., Azuma, Y. and Nishida, M., 2007. Independent evolution of the specialized pharyngeal jaw apparatus in cichlid and labrid fishes. BMC Evol. Biol., 7: 12. https://doi.org/10.1186/1471-2148-7-10
Miya, M. and Nishida, M., 1999. Organization of the mitochondrial genome of a deep-sea fish, Gonostoma gracile (Teleostei: Stomiiformes): First example of transfer RNA gene rearrangements in bony fishes. Mar. Biotechnol., 1: 416-426. https://doi.org/10.1007/PL00011798
Perna, N.T. and Kocher, T.D., 1995. Patterns of nucleotide composition at four folded generate sites of animal mitochondrial genomes. J. mol. Evol., 41: 353-358. https://doi.org/10.1007/BF00186547
Ramakodi, M.P., Singh, B., Wells, J.D., Guerrero, F. and Ray, D.A., 2015. A 454 sequencing approach to dipteran mitochondrial genome research. Genomics, 105: 53-60. https://doi.org/10.1016/j.ygeno.2014.10.014
Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York, US.
Sbisa, E., Tanzariello, F., Reyes, A., Pesole, G. and Saccone, C., 1997. Mammalian mitochondrial D-loop region structural analysis: Identification of new conserved sequences and their functional and evolutionary implications. Gene, 205: 125-140. https://doi.org/10.1016/S0378-1119(97)00404-6
Shadel, G.S. and Clayton, D.A., 1997. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem., 66: 409-435. https://doi.org/10.1146/annurev.biochem.66.1.409
Shan, B.B., Zhao, L.L., Gao, T.X. and Lu, H.S., 2014. The complete mitochondrial genome of Nibea coibor (Perciformes, Sciaenidae). Mitochond. DNA, 17: 1-2. https://doi.org/10.3109/19401736.2014.958726
Simon, C., Buckley, T.R., Frati, F., Stewart, J.B. and Beckenbach, A.T., 2006. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst., 37: 545-579. https://doi.org/10.1146/annurev.ecolsys.37.091305.110018
Swofford, D.L., 2002. PAUP* 4.0: Phylogenetic analysis using parsimony. Sinauer Associates, Inc., Sunderland, MA.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S., 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol., 28: 2731-2739. https://doi.org/10.1093/molbev/msr121
Teacher, A.G., Andre, C., Merila, J. and Wheat, C.W., 2012. Whole mitochondrial genome scan for population structure and selection in the Atlantic herring. BMC Evol. Biol., 12: 248. https://doi.org/10.1186/1471-2148-12-248
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignments aided by quality analysis tools. Nucl. Acids Res., 24: 4876-4882. https://doi.org/10.1093/nar/25.24.4876
Whitehead, P.J.P., 1985. FAO Species Catalogue, Vol. 7. Clupeoid Fishes of the World (Suborder Clupeoidei). Part 1: Chirocentridae, Clupeidae and Pristigasteridae. FAO Fish. Synop., 125: 305-579.
Wongratana, T., 1980. Systematics of clupeoid fishes of the Indo-Pacific region. PhD thesis, University of London, London, UK.
Wyman, S.K., Jansen, R.K. and Boore, J.L., 2004. Automatic annotation of organellar genomes with DOGMA. Bioinformatics, 20: 3252-3255. https://doi.org/10.1093/bioinformatics/bth352
Xiao, J.G., 2015. The complete mitochondrial genomes and phylogenetic analysis of Sillago species. Master thesis, Ocean University of China, Qingdao, China.
Yan, X.L., Tang, W.Q. and Yang, J.Q., 2009. Population genetic structure of tapertail anchovy (Coilia mystus) in coastal waters of southeast China based on mtDNA control region sequences. Biodiv. Sci., 17: 143-150. https://doi.org/10.3724/SP.J.1003.2009.08286
Yang, Q.L., Han, Z.Q., Sun, D.R., Xie, S.G. and Lin, L.S., 2010. Genetics and phylogeny of genus Coilia, in China based on AFLP markers. Chin. J. Oceanol. Limnol., 28: 795-801. https://doi.org/10.1007/s00343-010-9093-3
Yang, Q.L., 2012. Phylogenetic analysis of genus Coilia in China and molecular phylogeography of C. nasus and C. mystus. PhD thesis, Ocean University of China, Qingdao, China.
Zhang, N., 2015. Studies on complete mitochondrial genomes of genus Coilia and Lota lota. Master thesis, Ocean University of China, Qingdao, China.
Zhang, Z.H., Zhang, N., Liu, M. and Gao, T.X., 2016. The complete mitochondrial genome of Coilia grayii (Clupeiformes: Engraulidae). Mitochond. DNA, 27: 3175. https://doi.org/10.3109/19401736.2014.926508
Zhang, N., Song, N., Han, Z.Q. and Gao, T.X., 2016a. The complete mitochondrial genome of Coilia nasus (Clupeiformes: Engraulidae) from the coast of Ningbo in China. Mitochond. DNA, 27: 1. https://doi.org/10.1080/24701394.2016.1248429
Zhang, N., Song, N. and Gao, T.X., 2016b. The complete mitochondrial genome of Coilia nasus (Clupeiformes: Engraulidae) from Ariake Sea. Mitochond. DNA, 27: 1518. https://doi.org/10.3109/19401736.2014.926508
Zhao, L.L., Zhao, Y.H., Zhang, N., Gao, T.X. and Zhang, Z.H., 2016. The complete mitogenome of Coilia nasus (Clupeiformes: Engraulidae) from Poyang Lake. Mitochond. DNA, 27: 1608.
Zhu, T.J., Yang, J.Q. and Tang, W.Q., 2008. MtDNA control region sequence structure of the genus Coilia in Yangtze River estuary. J. Shanghai Ocean Univ., 17: 152-157. https://doi.org/10.1007/s11741-008-0213-1