Molecular Characterization of Cry11 Crystal Protein Gene from Bacillus thuringiensis Isolated from Different Soil Samples

Dilara A. Bukhari1,*, Naureen Fatima1 and Abdul Rehman2

1Department of Zoology, Government College University, Lahore

2Department of Microbiology and Molecular Genetics, University of the Punjab, New Campus, Lahore 54590

ABSTRACT

The present study was aimed at screening the local Bacilllus thuringiensis (B.t.) isolates for Cry11 and assess their potential use for mosquito control. A total of 15 B.t. isolates were collected, of which 75% were from dry, leaf litter, garden soil samples, 15% were from animal waste and 10 % were from moist soil of the crop area. A 650bp of cry11 gene was amplified by PCR and seven isolates were found positive for cry11 gene. The 16S rDNA study exposed that these screened B.t. confirmed 99% homology with B.t. serovar tolworthi, B.t. str. Al Hakam, B.t. serover thuringiensis, B.t. serovar konkukian, B.t. serovar Chinensis. B.t. serover Indiana, and B.t. serover kurstuki. The toxicity bioassays with B.t. spores proved that seven B.t. isolates harboring cry11 gene (viz., NF B.t.,1,2,3,4,5,6,7) were toxic to 3rd instar larvae of mosquito, Aedes aegypti. Among seven B.t. isolates, three isolates NF5 B.t. 7.2, NF1 B.t. 1.1 and NF2 B.t. 4.2 were found most toxic which were isolated from moist soil containing decaying cattle waste, dry waste animal dung and leaf litter soil, respectively. So, these isolates have a great potential to grow into a biopesticidal formulation for control of mosquitoes.


Article Information

Received 09 September 2017

Revised 13 March 2018

Accepted 25 October 2018

Available online 31 October 2018

Authors’ Contribution

DAB designed the study and supervised the work. NF performed experiments and analyzed the results. AR helped in manuscript preparation and revision.

Key words

Bacillus thuringiensis, Insecticidal activity, cry11 gene, Bioinsecticide Aedes aegypti.

DOI: http://dx.doi.org/10.17582/journal.pjz/2018.50.6.2351.2356

* Corresponding author: [email protected]

0030-9923/2018/0006-2351 $ 9.00/0

Copyright 2018 Zoological Society of Pakistan



Introduction

Synthetic pesticides have been successfully used during past several decades to kill variety of insects and crop pests. Pest controlled by chemicals has caused serious damages to wild life. Over use of pesticides develop confrontation in pests, making the chemicals ineffective. Insecticides have also caused toxic effects on non-target pest and also cause the pollution of bottom water table. The requirement of most suitable, alternate, more effectual and environment-friendly control agents became imperative (Lacey et al., 2001). Bio-insecticides were continuously in front position. Cry protein invention was an influential approach for enlightening the use of B.t-based biopesticides. 80-90% control of pest is through Bacillus thuringiensis (Schnepf et al., 1998; Glare and O’Callaghan, 2000).

B.t. was first discovered in 1901 by Japenese Shigetane Ishiwatta, from diseased silkworm larvae (Burges, 1967; Dulmage et al., 1971; Krieg et al., 1983). B.t. is an aerobic ubiquitous, gram-positive, spore former and produced δ-endotoxins (cry protein). It forms various shapes of insecticidal crystal proteins. Specificity of B.t. is their toxicity against specific insect. Magnesium, calcium and inorganic phosphate enhance ICPs (Kumar and Bambawale, 2002).

It grows aerobically and forms heat resistant spores. They have large filamentous and make parasporal crystals (Cry) proteins with molecular masses of 135, 125, 68 and 28 kDa during sporulation which kill particular target pests of different crops (Ahmad and Shakoori, 2013).

During sporulation many B.t. strains produce ICPs (proteinaceous Cry protein encoded by cry genes and cyt gene to be found on the plasmid). B.t. δ-endotoxin is a globular protein molecule mount up as a protoxin and released in the gut of a pest in alkaline medium. The specific enzyme proteases convert the protoxin into active toxin. This active toxin then binds to its specific receptors (lacking aminopeptidase activity) inside the insect’s gut and causes pore formation in epithelial cell surface, which ultimately leads to disturbance in electric potential across the membrane due to leakage of ions and finally death of insect larvae due to swelling of epithelial cells of midgut. The cry11 genes are dipteran specific and are known to control mosquito and black flies worldwide (Abdullah et al., 2006).

Cry proteins have been classified into 56 groups divided into classes and subclasses according to their amino acid similarity. Genes coding for the Cry proteins (cry genes) follow the protein classification. The cry11 genes encode 67-94 kDa proteins highly active against different species of mosquito larvae. Cry11Aa, Cry11Ba and Cry11Bb proteins are very active toxins found in the Bti, jegathesan and Medellin, respectively (Crickmore et al., 1998). B.t. subsp. chinensis strain CT-43 has been widely used as an agricultural biopesticide for a long time. As a pest producing strain, B.t. subsp. chinensis strain CT-43 is highly toxic to lepidopterous and dipterous insects. It forms various ICPs consisting of Cry1Aa3, Cry1Ba1, Cry1Ia14, Cry2Aa9, and Cry2Ab1 which is very toxic to diptarian insect (Jieping et al., 2011).

The present study was aimed at isolating and characterizing Bacilllus thuringiensis strains from different soil samples from Lahore. The toxicity of spores of B.t. strains harbouring cry11 genes was evaluated against 3rd instar larvae of mosquito A. aegypti for their potential use as bioinsecticide.

 

Materials and methods

Isolation and biochemical characterization of B.t.

Soil samples were collected from different localities of Lahore and were further processed for the isolation of the B. thuringiensis according to Martin and Travers (1989) and Bukhari and Shakoori (2010). Gram staining, crystal staining and endospore staining (Sneath, 1986) were performed for morphological characterization. The Gram-positive rods, spore and crystal formers were characterized biochemically according to Cheesbrough (1993), Collee and Miles (1989) and Benson (1994).

Molecular characterization of bacterial isolates

DNA was isolated from B.t. according to Kronstad et al. (1983). Specific primers for 16S rDNA of full-length 1.6kb gene were used (Bukhari and Shakoori, 2010). PCR amplification was done according to Saiki et al. (1988) using Fermentas PCR reagents (#EP0402). 4Q281 B. thuringiensis 16S ribosomal RNA gene was used as a reference gene. The nucleotide sequences of 16S rDNA gene of local B.t. isolates were later deposited in the NCBI database. Moreover, dendrograms were constructed on the basis of homology using MEGA7 program.

PCR based detection of cry11 gene

Detection of cry 11 gene in B.t. isolates was done by amplification of Cry 11 gene using the following primers; Forward: 5′ATGGAAGATAGTTCTTTAGAT3′ Reverse: 5′ CTACTTTAGTAACGGATT 3′, in a thermal cycler (Progene, Techne) (Bukhari and Shakoori, 2009).

Biotoxicity assays of bacterial spores

Bacterial spores were prepared according to Makino et al. (1994). The toxicity of spores of B.t. isolates found positive for cry11 gene was evaluated against 3rd instar larvae of Aedes aegypti according to procedure described by Bukhari and Shakoori (2010). Bioinsecticidal activity of B.t. isolates was checked and compared with the control HD500 strain. The toxicity assessment was determined through Log- Probit analysis (Finney, 1952).


 

Results and discussion

Characteristics of B.t. isolates

Fifteen B.t. isolates, collected from different ecological environment, were selected on the basis of various biochemical tests. B.t. was positive for catalase activity and Voges-Proskauer test, could decompose tyrosine and hydrolyze casein and starch. It could grow on media containing 0.001% lysozyme and showed strong lecithinase and hemolytic activity with blood agar test. The bacterium did not grow at 65°C. They produced spores and intracellular protein crystals which were visible green and deep pink in colour after malachite green and acid fucshin staining.

Molecular characterization B.t. isolates

The genomic DNA of B.t. was isolated and PCR products of 16S rDNA were visualized through agarose gel electrophoresis. The sequence alignment of 16S rDNA gene from NF.B.t 2, 4, 5, respectively showed 99% homology with B.t. str. Al Hakam, B.t. serovar konkukian, and B.t. serovar Chinensis, respectively. All the sequences of 16S rDNA gene from B.t. isolates were submitted to GenBank and their accession numbers are KT216626, KT216627 and KT216628, respectively. Dendrogram is showing the relatedness of 16S rDNA of these B.t. isolates (Fig. 1).

Prevalence of cry11 gene in the B.t. isolates

PCR is an effective tool for characterization of gene coding for Cry protein and also used to analyze B.t. collections. At first time, it was introduced by Carrozi et al. (1991) who identified cry gene to predict its insecticidal activity. In this study B.t. specific primer and cry11gene specific primers were designed to amplify the conserved region of cry gene family. The use of degenerate oligonucleotide primer increases the probability of amplification of novel gene and limited the detection of closely related gene Kuo and Chak (2000).

In the present study, five B.t. isolates were positive for cry11 gene. In which 48% B.t. strain were screened from dry soil samples and 14% from leaf litter, moist and garden soil. B.t. is effective against larval stage as compared to the adult stage and forms parasporal crystalline inclusion during sporulation.

Aronson et al. (1986) reported that cry11 gene which is toxic absolutely to dipteran species (A. aeygypti). In this study, the suitable conditions for amplification of full length gene 1.9kb were ascertained but in our B.t. strain the PCR product size is above 650bp. So, partial type cry11 gene was amplified. Expected restriction fragment sizes of digested cry11 genes fragment size (bp) is in between 550 to 750bp because cry11 specific primers were used to detect cry11 gene group. Therefore, the band at 650 bp could be corresponding to a different sub-type of cry11 gene Corazzi et al. (1991). In this study, the nucleotide sequence of conserved region of cry11 has a very high similarity (99%) with other reported strain B.t. BMB171, B.t. serovar thuringiensis, gallerie, chinensis CT-43, kurstaki, tolworthi, Bacillus thuringiensis B.t. 407, Bacillus thuringiensis subspecies morrisoni, Bacillus thuringiensis IGS strain SBS B.t. 4-6, having mosquitocidal toxin genes (Sauka et al., 2010).

Various species of B. thuringiensis serotypes reported to be toxic against mosquitoes, black flies and other flies. The conserved regions of cry11 gene of PCR products of 650 bp have a very high similarity (99%) with other reported mosquitocidal toxin genes. B.t. subsp. CT-43 chinensis and strongly suggest that their encoding genes are restricted to this B. thuringiensis svar and showed maximum homology with B.t. serovar konkukian serovar tolworthi, B.t. serovar. Al Hakam, B.t. serover thompsoni, B.t. serovar konkukian and B.t. serovar fukuokaensis, gallerie, chinensis, Indiana, kurstaki (Bukhari and Shakoori, 2010).

 

Table I.- The toxic B.t. isolates, screened from various areas and soil textures, against 3rd instar larvae of mosquito (Aedes aegypti). Out of six, the most toxic B.t. isolate was NF5.

Strain ID

Area of collection

Soil texture

LC50 (µg/ml)

NF1

Faisal Town (cow rearing area)

Dry waste, Animal dung

645.211±1.30

NF2

Faisal Town near AMC

Leaf litter soil

570.262±0.95

NF3

Wheat crop area (PU)

Dry soil

763.731±1.2

NF4

Garden soil

Model Town park (H Block)

754.5960±1.1

NF5

Moist soil

Dirty, sewage water Pico road, Township

522.027±0.17

NF6

Dry soil

Soil drain area

914.634±0.99

NF7

Dry soil

Soil drain area

1007.33±1.3

HD 500

-

Reference strain

673± 1.34


 

Biotoxicity of B.t. isolates

Among six B.t. isolates, NF5 was found the most toxic and was isolated from the moist soil containing a dirty sewage water. The LC50 was 522.027±0.17 μg/ml against the 3rd third instar larvae of A. aegypti and showed 100% mortality at 1000μg of spores/ml (Fig. 2C). At this dose, NF1 and 2 showed 100% (Fig. 2A) and 94% (Fig. 2B), mortality. The positive control HD-500 showed mortality of 94%. The LC50 (522 µg/ml) of NF5 was quite less than HD500 LC50 (673µg/ml) (Table I). So, NF5 is more toxic as compared to the HD500. Shakoori et al. (2011) reported that the LC50 of SBSB B.t. 48 spores, recombinant organisms and recombinant Cry 11B protein was 700 µg/ml, 525 µg/ml and 390 ng/ml, respectively, as against 850 µg/ml, 550 µg/ml and 470 ng/ml HD500 standard B.t. strain. Bukhari and Shakoori (2009) reported that the LC50 of DAB Bt 5 (SBS Bt 45) recombinant organisms and crude Cry 11B protein was 350 ±1.76 µg/ml and 407 ± 0.69 ng/ml, respectively. All these B.t. isolates, with minor difference, showed high mortality percentage against mosquito larvaes.

Yamada and Agata (1999) mentioned the PCR based detection of B.t. strains, the 16S rDNA gene based primers were made to order and used to differentiate the Bacillus spp. The sequence of 16S rDNA gene is a molecular clock to estimate relationship among bacteria and helpful to identify bacterium up to genus and species level. Among six B.t. isolates, NF5 was found the most toxic and was isolated from moist soil containing sewage water, decaying dirty, cattle waste.

Malik et al. (2012) emphasized on the use of the pellet of the B. thuringiensis spores as a biopesticide. The present work was done by using the spore diet of B. thuringiensis instead of using the isolated crystal proteins; the spore forms in the pellet contain variety of crystal proteins. One of these proteins is the Cry11 protein which is really very toxic for the Dipterans. The formulation used in this study was safe, easy to use, and having long shelf time. The active ingredient in the formulation was the spore crystal complex, which is effective, cheaper to achieve than the crystal alone, and often used in test.

 

Conclusions

In the present study a total of 15 local B. thuringiensis isolates were collected from different habitats. Out of 15, 7 isolates were found positive for cry11 gene after amplification through PCR and the most toxic isolates were identified on 16S rDNA sequencing. The toxicity bioassays with B.t. spores were performed and NF5 with LC50 (522 µg/ml) was found more toxic as compared to the positive control HD500. This study provides a convenient method which is time saving and economical. This study also recommends that B. thuringiensis at spore stage provides good mortality percentage. These Bt strains have promising potential to grow into a biopesticidal formulation for mosquitoes control.

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Abdullah, M.F, Valaitis, A.P. and Dean, D.H., 2006. Identification of Bacillus thuringiensis Cry11Ba, toxin-binding amino peptidase from mosquito, Anopheles quadrimanculatus. Biochemistry, 7: 16

Ahmad, M.S. and Shakoori, A.R., 2013. Isolation and molecular characterization and toxicity of cry1C gene harboring Bacillus thuringiensis from different habitats and different localities of Pakistan. Pakistan J. Zool., 45: 261-271.

Aronson, A.J., Beckman, W. and Dunn, P., 1986. Bacillus thuringiensis and related insect pathogens. Microbiol. Rev., 50: 1-24.

Benson, H.J., 1994. Microbiological applications. Complete version laboratory manual in general microbiology, 6th edition. W.M.C. Brown Publishers.

Bukhari, D.A. and Shakoori, A.R., 2009. Cloning and expression of Bacillus thuringiensis cry11 crystal protein gene in Escherichia coli. Mol. Biol. Rep., 36: 1661-1670. https://doi.org/10.1007/s11033-008-9366-5

Bukhari, D.A. and Shakoori, A.R., 2010. Isolation and molecular characterization of cry4 harbouring Bacillus thuringiensis isolates from Pakistan and mosquitocidal activity of their spores and total proteins. Pakistan J. Zool., 42: 1-15.

Burges, H.D., 1967. The standardization of products based on Bacillus thuringiensis. In: Insect pathology and microbial control (ed. P. Van Derlaan). North Holland Publ. Co., Amsterdam, pp. 306-314.

Carozzi, N.B., Kramer, V.C., Warren, G.W., Evola, S. and Koziel, M.G., 1991. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl. environ. Microbiol., 57: 3057-3061.

Cheesebrough, M., 1993. Medical laboratory manual for tropical countries, Vol. 11: Microbiology. ELBS, University Press, Cambridge.

Collee, J.G. and Miles, R.S., 1989. Test for identification of bacteria. In: Practical medical microbiology (eds. J.G. Collce, J.P, Duguid, A.G. Fraser and B.P. Marmion). Churchill Livingstone, pp. 141-160.

Crickmore, N., Zeigler, D., Feitelson, J., Schnepf, E., van Rie, J. and Lereclus, D., 1998. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev., 62: 807-813.

Dulmage, H.T., Boeing, O.P., Rhenborg, C.S. and Hensen, G.D., 1971. A proposed standardized bioassay for formulations of Bacillus thuringiensis based on the international unit. J. Inverteb. Pathol., 18: 240-245. https://doi.org/10.1016/0022-2011(71)90151-0

Finney, D.J., 1952. Probit analysis. University Press, London.

Glare, T.R. and Callaghan, M., 2000. Bacillus thuringiensis. In: Biology, ecology and safety. John Wiley and Sons, Chichester, pp. 423.

Jieping, J.H., Wen, Y., Xiaohu, S., Huajun, Z., Mingshun, L., Youwen, Z., Ming, S., Shengyue, W. and Ziniu, Y., 2011. Complete genome sequence of Bacillus thuringiensis subsp. chinensis strain CT-43. J. Bact., 193: 3407-3408. https://doi.org/10.1128/JB.05085-11

Krieg, A., Huger, A., Langenbr uch, G. and Scherrer, W., 1983. Bacillus thuringiensis var. tenebrionsis: A new pathotype effective against larvae of Coleoptera. J. appl. Ent., 96: 500-508.

Kronstad, J.W., Schnepf, H.E. and Whiteley, H.R., 1983. Diversity of location for the Bacillus thuringiensis crystal protein gene. J. Bact., 154: 419-428.

Kumar, P.A. and Bambawale, O.M., 2002. Insecticidal proteins of Bacillus thuringiensis and their applications in agriculture. In: Advance in microbial toxin research (ed. R.K. Upadhyay). Kluwer Academic/Plenum Publishers, New York, pp. 259-280. ISBN 0-306-47255-4. https://doi.org/10.1007/978-1-4757-4439-2_16

Kuo, W.S. and Chak, K.F., 2000. Identification of novel cry-type genes from Bacillus thuringiensis strains on the basis of restriction fragment length polymorphism of the PCR-amplified DNA. Appl. environ. Microbiol., 62: 1369-1377.

Lacey, K., Tiyag, R.D. and Valero, J.R., 2001. Production of Bacillus thuringiensis biopesticides using wastewater sludge as a raw material: effect of inoculum and sludge solids concentration. Process Biochem., 37: 197-208. https://doi.org/10.1016/S0032-9592(01)00198-4

Makino, S., Ito, N., Inoue, T., Miyata, S. and Moriyama, R., 1994. A spore-lytic enzyme released from Bacillus cereus spore during germination. Microbiology, 140: 1403-1410. https://doi.org/10.1099/00221287-140-6-1403

Malik, K., Munir, F., Naz, S. and Sharif, S., 2012. Biotoxicity assay of Bacillus thuringiensis (spores) against Tribolium castaneum. Afr. J. Microbiol. Res., 6: 3980-3983.

Martin, P.A.W. and Travers, R.S., 1989. Worldwide abundance and distribution of Bacillus thuringiensis isolates. Appl. environ. Microbiol., 55: 2437-2442.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A., 1988. Primer-directed enzymatic amplification of DNA with thermosable DNA polymerase. Science, 239: 487-491. https://doi.org/10.1126/science.239.4839.487

Sauka, D.H., Monella, R.H. and Benintende, G.B., 2010. Detection of the mosquitocidal toxin genes encode Cry11 proteins from Bacillus thuringiensis using a novel PCR-RFLP method. Rev. Argent. Microbiol., 42: 23-26.

Schnepf, E., Crickmore, N., Van-Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D.R. and Dean, D.H., 1998. Bacillus thuringiensis and its insecticidal proteins. Microbiol. Mol. Biol. Rev., 62: 774-806.

Shakoori, F.R., Zahid, M.T., Bukhari, D.A. and Shakoori, A.R., 2011. Cloning and expression of cry11B gene from local isolate of Bacillus thuringiensis and its mosquitocidal activity Pakistan J. Zool., 43: 701-713.

Sneath, P.H.A., 1986. Endospore-forming Gram-positive rods and cocci. In: Bergey’s manual of systematic bacteriology (ed. J.P. Butler). Williams and Wilkins, Baltimore, pp. 1104-1207.

Yamada, S. and Agata, N., 1999. Cloning nucleotide sequence analysis of B.t., B.t.k and their application to the detection of Bacillus cerus. Appl. environ. Microbiol., 65: 1483-1490.