Review Article

Novel Gene Pyramiding to Combat Rusts in Global Wheat Varieties against Prevalent Virulence: A Review

Yasir Ali1*, Muhammad Aslam Khan1, Muhammad Atiq1 and Muhammad Hussain2

1Department of Plant Pathology, University of Agriculture Faisalabad, Pakistan; 2Plant Pathology Research Institute, Ayub Agricultural Research Institute, Faisalabad, Pakistan.

Abstract | Epidemics caused by leaf, stripe and stem rust have significant threat to agro-ecosystems and worldwide food security. Semi-dwarf wheat varieties with major gene resistance could not continue for longer period due to emergence of new rust races. However, genotypes such as Inqilab-91, Bluebird, Kenya Plume and Hope developed in early part of green revolution retained their resistance for longer period due to presence of non-specific rust resistance genes. Until now, 187 rust resistance genes (80 leaf rust, 49 stripe rust, 58 stem rust) have been described from different wheat and durum cultivars and related local species using different molecular approaches. This review provides a detailed discussion of the different aspects for controlling three rust diseases caused by P. recondita Rob. exdesm f. sp. tritici , P. striiformis West. f. sp. tritici, P. graminis Pers. f. sp. tritici and the importance of race specific and non-specific rust resistance genes in in global wheat varieties. This knowledge will help as basis for plant pathologist, plant breeders and genetics to develop non-specific rust resistant wheat varieties through gene pyramiding or marker assisted breeding.


Received | January 18, 2018; Accepted |October 07, 2018; Published | November 16, 2018

*Correspondence | Yasir Ali, Department of Plant Pathology, University of Agriculture Faisalabad, Pakistan; Email: [email protected]

Citation | Ali, Y., M.A. Khan, M. Atiq and M. Hussain. 2018. Novel gene pyramiding to combat rusts in global wheat varieties against prevalent virulence: A review. Sarhad Journal of Agriculture, 34(4): 797-810.

DOI | http://dx.doi.org/10.17582/journal.sja/2018/34.4.797.810

Keywords | Breeding, Epidemics, Gene pyramiding, Virulence, Rust resistance



Introduction

Leaf, stripe and stem rusts are major diseases of wheat (Triticum aestivum L. and Triticum turgidum) causing severe epidemics worldwide. These pathogens are highly specific and significant patotypes occurs in their populations for virulence to a virulence against specific resistance genes. Appearance of novel rust races and their variant through recombination of their genetic material, migration, mutation followed by selection is also common (Brown, 2015). The phenomenon of the breakdown of major gene host resistance has led researchers to look for alternative management strategies. Mainly two approaches have been widely used for controlling rust diseases, genetic and chemical resistance. Genetic resistance further categorized as race specific and race non-specific resistance. Race-specific (vertical resistance) resistance is attained due to existence of major genes and can be easily detected at a seedling or adult plant stage while race non-specific resistance also known as horizontal resistance is accomplished through minor genes and remains effective to all prevalent pathotypes of pathogen and is expressed at adult plant stage (Singh, 1992).

Race specific resistance has been broadly used by numerous wheat improvement programs and easily overcome by the pathogen. However, such type of resistance is often defeated by the evolution of new highly virulent variant of the pathogen by single-step mutation or sexual recombination (Kolmer and Acevedo, 2016). Horizontal or race non-specific resistance provides long lasting durable resistance (Singh et al., 2005). Such type of resistance is most effective, economically safe and eliminates the need to use fungicides and reduce the cost of production (Oliver, 2014). Though, progress on breeding and other genetic approaches for non-specific resistance is slow, demanding pyramiding durable resistance genes into desirable genotypes. Until now, few non-specific resistance genes have been described and catalogued in wheat (Bansal et al., 2014).

Recent advances in molecular marker technology have created effective tools for solving such complex problems. For example, the utilization of polymerase chain response (PCR) based DNA robust markers has numerous advantages than conventional phenotypic trait selection for resistance (Todorovska et al., 2009). Breeding through marker assisted selection (MAS) has also been generally used to achieve partial resistance. For example, to facilitate breeding for race non-specific rust resistance against all three types of rust robust molecular markers are useful for producing resistant varieties, particularly in addition to the pyramiding several rust resistance genes. MAS can be used at seedling stage with multiple DNA robust markers to evaluate numerous genes simultaneously (Anderson et al., 2013).

The main goal of current review is to describe most recently developed approaches for rust resistance into wheat varieties. To achieve this, we collected current information on rust resistance genes (leaf, stripe and stem) including their types of resistance, primer sequence with base-pair and discuss their potential applications for producing non-specific resistance wheat varieties through MAS.

Breeding for rust resistance

Major genes were the 1st category of resistance genes that to be genetically defined and rapidly used in breeding strategies by plant breeders. Though, not long after these race specific resistance genes started to be utilized as a part of breeding schemes in the early to mid-twentieth century it became very clear that new harmful pathotypes would emerge that defeated these genes in new releasing wheat varieties within few years. The highly virulent pathotypes were either exists at a very low frequency in pre-existing pathogens populaces or were evolved later by changing their genetic make-up through mutation or sexual recombination. In other words, race specific (major genes) being used individually are not race non-specific in breeding strategies (Ellis et al., 2014). However, with high level of resistance, race specific genes have been utilized with great achievement to manage wheat stem rust in Australia, North America and other areas worldwide (Leonard and Szabo, 2005). Interestingly, compared with stem rust control, a race specific resistance gene has been failed to control yellow rust disease in various regions worldwide. In North America, Europe and Australia yellow rust lines of basic wheat cultivars indicate less genetic variation compare to stem rust genes (Ellis et al., 2014).

Many resistance genes had been transferred into novel wheat germplasm from its cultivated and wild species by interspecific hybridization to combat leaf, stripe and stem rust virulent races. For example, in Russia, in 1902 wide crosses were performed between collected wild and introduced population as a result Kavkaz, Aurora and Besostaja varieties were developed which remained under cultivation worldwide over a longer period of time (Lupton, 1987). In North America, Hope, Ceres, and Webster wheat varieties were released subsequently the early days of plant breeding which confer the both seedling and adult plant resistance. During 1965-1985, International Maize and wheat Improvement Centre have incorporated many rust resistance genes so called “alien genes” into wheat from its local and cultivated landraces through interspecific hybridization. Most of germplasm distributed during this era (1965-1985) contain Sr36, sr31, Sr6, Sr5, Sr30, Sr7a, Sr24, Sr7b, Sr17, Sr8a, Sr12, Sr10, Sr9g, Sr9d, Sr11, Sr9e, and Sr2 genes against stem rust resistance (Rajaram et al., 1988; Knot, 1988).

The importance of adult plant or race non-specific resistance gene Lr13 against leaf rust was perceive in the mid-1970, when it was transferred along with other genes into a large number of wheat cultivars. Some genotypes having Lr13 gene along with some other minor genes developed in Pakistan, Mexico and India when present individually does not give race non-species type resistance against leaf rust but in association with different genes showed high level of non-specific or durable resistance. Its occurrence with gene Lr34 in certain member from Bluebird succession provides longer resistance. Another case of non-specific resistance is variety Lyalpur-73 which though swapped in agriculture fields with the arrival of high rust resistant cultivars but even after 37 years of release until now have very high level of resistance in testing plots.

Adult plant or non-specific resistance genes give incomplete resistance with less pathogen growth and without hypersensitive response merely in adult plants and this is known as durable or slow rusting. Thus, such type of resistance is attained by wheat breeders in field instead of glasshouse. The masking of non-specific resistance by race specific gene with effective resistance phenotypes can prevent high level of non-specific resistance selection unless specific virulent variant of pathogen are utilized to produce high rust outbreaks. All such influences make breeding with non-specific resistance more complex rather by specific resistance genes. Though, the resistance showed by single non-specific resistance genes conferred varying level of durable resistance, it has been described that by combining some undefined partial resistance genes resistance near to immunity can be attained (Singh et al., 2014).

The best known non-specific resistance genes utilized as a part of wheat breeding are Lr34, a leaf, stripe and powdery mildew resistance gene and Sr2 provide resistance to stem rust. These Sr2 and Lr34 genes have been utilized for commercial wheat breeding programs for almost more than hundred years. Essentially either non-specific resistance genes on their own give suitable resistance levels under high rust outbreak and often non-specific resistance expression is prolonged in field to effectively maintain yield (Yildrim et al., 2012).

International Maize and Wheat Improvement Center (CIMMYT) researchers have supported and effectively adopted breeding for partial rust resistance for several years and use single back cross method (Singh et al., 2014). The germplasm developed during mid-1960s achieved resistance against stripe rust from Andean local genotypes which mad high level of rust resistance. The variety Anza was developed after crossing LR/N10B//3*ANE and cultivated in South Africa, New Zeeland, North Africa and Sudan. It was considered as non-specific resistance against stripe rust by Johnson (1988). Such type of resistance was recognized due to existence of Yr18 and widely developed in winter and spring wheat varieties (Singh et al., 1992). The genotypes released during early years of green revolution carried Yr18 gene. The Yr7 in association with Sr9g also presents in a number of winter and spring wheat varieties providing non-specific resistance. It is reported in many genotypes such as Pak-81 (Yr9, Yr7), Seri-82 (Yr9, Yr7, and Yr2), Pavon-76 (Yr29, Yr7, and Yr6), PBW-12, Barani-83, WL-2265 (Badebo et al., 1990). Varieties Pavon-76 and Veery having Yr7 had been released in many countries including Mexico, Morrocco, Pakistan, Iran, Nepal, Turkey, Yemen, Zambia, Brazil, Bangladesh, Egypt, India and China which show a wide use of Yr7 gene.

Evolution of new rust races

The widespread use of semi-dwarf wheat genotypes having major gene resistance results in the emergence of new high virulent races. A stripe rust race (Yr9) was first detected in East Africa during 1986 and consequently moved to South Asia and North Africa. Once it observed in Yemen during 1991 it took only 4 years to move field of south Asia (Singh et al., 2000a). On its way, it brought on significant grain losses in Turkey, Syria, Egypt, Iraq, Iran, Pakistan, and Afghanistan beyond one billion $. Similarly, another race of Puccinia striiformis (Yr27) evolution and its spread, adopted the similar pathway posed significant yield losses to wheat cultivation in Pakistan and India where main genotypes PBW-343 and Inqlab-91 were cultivated. During 2005, the wheat cultivation in North-Pakistan was mostly attacked Yr27 where the greater part of the range was under Inq-91 (Rehman et al., 2013).

The virulence’s in wheat cultivars with Sr6, Sr9b, Sr11 and Sr17 in Australia was observed by Watson (1958) for independent mutational changes occur in Puccinia graminis tritici. Though, the exact genetic mechanism of this process in Puccinia graminis is unknown, it is now believed that race advancement against resistant genotypes includes involvement of effectors that stop the recognition of signaling pathways from pattern associated recognition receptors (Dodds and Rathjen, 2010). It has also been shown that changes in host EDS1 gene increase the susceptibility to virulent pathogens (Falk et al., 1999). This demonstrates that pathogens’ effector based destruction of host pathogen associated molecular pattern (PAMP) induced resistance is not comprehensive due to apparent perfect host pathogen interactions which become more compatible because of host gene mutation (Ellis et al., 2014).

A new race of Ug99 of fungus Puccinia graminis was first identified in Uganda in 1998 that showed a significant danger to grain production. Based on North American Nomenclature System this race was named as TTKSK (Wanyera et al., 2006) that showed virulence to Sr31, Sr21, Sr24, Sr36 in Iran (2007), Yemen (2006), Sudan (2006), Ethiopia (2003) and in Kenya (2001). Other variants of this race TTKST (Sr24), TTTSK (Sr36), PTKST, TTKSP (Sr31, Sr21, Sr24), detected in Kenya and Ethopia in 2007 and TTKSF (Sr31, Sr21) is identified in Zimbabwe and South Africa in 2009 (Jin et al., 2008; Singh et al., 2011). Significantly, studies in Turkey and Egypt in recent years have failed to identify any of such destructive variants. In 2009, three Puccinia graminis strains were identified from Pakistan that clearly shown difference from TTKSK (Fetch et al., 2009 unpublished). In India a new race (Sr25) PKTSC have been identified (Jain et al., 2009). The identification of these harmful races frightened the wheat breeders that they should breed for partial or race non-specific resistance or combine two to three minor genes to increase the field life of wheat genotypes.

Monitoring of virulence pattern for rust resistance

Wheat rust pathogens surveillance, including virulence characterization through either pathotype (race) surveys or trap nurseries and assessment of rust incidence, has provided information and strategies in rust pathogen research and plant breeding. Based on recent survey in China, genes Yr41, Yr39, Yr36, Yr24/ Yr26, Yr18, Yr15, Yr10 and Yr5 as well as the advance lines having Yr16, Yr14, Yr13 and Yr12 are still effective and could be used in breeding techniques. Resistance genes Yr25, Yr22, Yr21, Yr20, Yr17, Yr9, Yr8, Yr7, Yr6, Yr4, Yr3, Yr2, and Y1 are ineffective against currently prevalent pathotypes (Wang et al., 2007). In several regions of the world including Australia, India, China and Pakistan virulence to these genes is recognized as race specific, but some genes including Yr15 and Yr5 were found resistant to all rust races in the USA which have been observed until now (Chen, 2007).

Flath and Bartles (2002) in 1998-1992 observed the various virulence’s of yellow rust to YR17, YR9, YR4, YR2, YR3, Su, YR1 and Sd genes which exhibited race non-specific resistance up to 1989. Afterward, in 1999-2000, rust outbreaks occurred and collapse resistance of YR8, YR17 including Yr9, and Yr17, correspondingly. The dominant resistant genes absent in Australia and Germany were YRA, YrSp, YR15, YR5 and YR10. The most common rust virulence’s were detected in Australia (8%) and Germany (34%) in which they enclosed a combined virulence to YR17, YR9, YR4, YR3, YR2, YR1, Su and Sd.

In Pakistan, Hussain et al. (2004) observed the leaf rust virulence in Kaghan and Faisalabad for five years which showed that at both places, resistance genes Lr33, Lr32, Lr26, Lr23, Lr22b, Lr20, Lr18, Lr16, Lr15, Lr14a, Lr13, Lr11, Lr10, Lr3, Lr3k, Lr3bg, and LrB were ineffective while, genes Lr37, Lr27, Lr36, Lr25, Lr19 and Lr24 were effective. Fayyaz et al. (2008) monitor leaf rust population during 2004-2006 at 5 different places and exhibited that lines with Lr genes Lr28, Lr19 and Lr9 were avirulent while Lr32, Lr30, Lr29, Lr26, Lr25, Lr24, Lr23, Lr21, Lr20, Lr18, Lr17, Lr16, Lr15, Lr14bg, Lr12, Lr11, Lr10, Lr3bg, Lr3ka, Lr3, Lr2a, Lr2b, Lr2c and Lr1 were virulent at most of the location. In Nawabshah and Karachi Lr35, Lr34, Lr22a and Lr13 demonstrated virulent pattern and partial virulence was detected in Lr37 and Lr36 at all places.

Rattu et al. (2009) reported the leaf rust virulence pattern from different places of Pakistan. The resistance genes Lr37, Lr33, Lr32, Lr30, Lr26, Lr25, Lr23, Lr18, Lr17, Lr15, Lr14a, Lr14b, Lr10, Lr11, Lr3, Lr3bg, Lr2a, Lr2c, LrB revealed great virulence incidences (75-100%) while, resistance genes Lr34, Lr28, Lr19and Lr9 provide effective resistance to leaf rust. Lr29, Lr24, Lr16, and Lr13 showed virulence frequency between 51 to 75 percent and the resistance genes Lr36 and Lr23 demonstrated virulence frequency ranging from 26 to 51 percent respectively. Bux et al. (2011) monitor the virulence analysis of Yr genes in CIMMYT tester lines under field conditions at various regions including Faisalabad, Sakrand, Quaid-i- Azam University and Pirsabak (KPK) and indicated that Yrsp, Yrcv, Yr26, Yr15, Yr10, Yr5 and Yr3 were found most effective while Yr27, Yr17, Yr9, Yr8, Yr7, Yr6, Yr2, YrA and association of Super Kauz (Yr27, Yr18, Yr9) and Opata (Yr18/Yr27) were susceptible. The gene Yr18 demonstrated slow to moderate level of rust resistance at all places.

Despite the progress that has been made through different surveys and in establishing the global wheat rust monitoring system (GCRMS) to date, many challenges remain. A global decline in the incidence of stripe, leaf and particularly stem rust over the last forty years attributes the widespread development of resistance genes through different breeding techniques and led to many countries abandoning these rusts surveillance and an alarming reduction in the global skill base in rust race analysis and general rust pathology.

Genetic basis of rust resistance

To date, more than 81 Lr genes (Roelf et al., 2002), 58 Sr (Haile et al., 2013) and more than 70 Yr resistance genes (Mclentosh et al., 2008) have been reported; most confer major genes with race specific resistance and some confer minor genes and indicated race non-specific resistance (Lin and Chin, 2009). A brief description of the detail of some of these leaf, stripe and stem rust resistance genes and their presence in existing global wheat varieties are described in Table1, Table2 and Table3 respectively.

Table 1: List of identified leaf rust resistance genes and presence in existing global wheat varieties.

Resistance genes Varieties Types of resistance Country References
Lr1, Lr2, Pavon-F76, Dollabard Specific resistance Mexico

Khan et al. 2013

Lr9 Aegilops umbellulata Specific resistance USA

Mclntosh et al. 2003

Lr11, Lr13, Lr34 Lyalpur-73, Bluebird Non-specific resistance Pakistan, Mexico

Mclontosh et al. 1995

Lr11, Lr12, Lerma rajo, pujab-81, Giza -164 Specific resistance Mexico, Paistan., Egypt

Prins et al. 2001

Lr14a, Lr14b Arz Specific resistance Lenanon

Mclntosh et al. 2003

Lr34+ Lr18+pm8 FKlein Castor Non-specific resistance Argentina

Lagudah et al. 2006

Lr67+Yr46 Brazilian wheat cultivar Specific resistance Brazil

Herrera-Foessel et al. 2012

Lr56+Yr38 Chinese spring wheat - China

Marais et al. 2010

Lr62+Yr42 Aegilops neglecta - California

Marais et al. 2009

 

Understanding the molecular basis for partial (durable) resistance to rust diseases is necessary for improving the efficiency of wheat breeding (Long et al., 2014). The incomplete (durable) resistance mainly depends upon slow rusting minor genes which express at adult plant stage. Work done at CIMMYT (Mexico) has showed that at least ten to twelve various types of genes are tangled in a group of CIMMYT wheat germplasm and by gathering four to five partial resistance genes an effective level resistance can be attained. However, 2-3 minor genes with partial resistance in a line/genotype demonstrate moderate level of rust resistance (Singh et al., 2005). A substantial number of partial resistance genes have been characterized; only Lr34/Yr18, Sr2/ Yr30 and Lr46/ Yr29 which are pleiotropic are given names and selected to exact chromosomal location (Martinez et al., 2001).

The genotypes having non-specific rust resistance retain their resistance level for longer period of time and space. Genotype Lyalpur-73 were included in mega varieties of Pakistan in 1970s to date, have effective level of rust resistance in tested plots. Though, the genotypes having race-specific resistance are short lived resistance and distorted frequently after four to five years of release. Varieties having durable resistance exhibit similar response to all prevailing rust races and their effective level of resistance endured in various environmental conditions. The yellow and leaf rust response of some genotypes having partial resistance is alike at Faisalabad-Pakistan and CIMMYT-Mexico. The race non-specific Frontana wheat variety which was released about fifty year ago, up till now has high level of resistance worldwide. There are rare cases in which resistance based on major genes have been continued for longer period of times. William et al. (2006) described six distinct chromosomal loci with race non-specific resistance against yellow and leaf rust in a genotype resulting from crosses of Pavon and Avocet S. The reputed characteristics recognized on chromosomal location 4BL, 6AL and 1BL affect resistance level of both leaf and yellow rust. The chromosomal location 6BL and 3BS have a sustainable effect against yellow rust. In another genotype, the chromosomal loci identified on distal area of 1BL provide effective level of resistance to yellow rust (Suenaga et al., 2003). In some other research studies, the alteration pleotropic to chromosomal location 4B association map have also been identified (Suenaga et al., 2003). Even Avocet S and Morocco have some kind of phylogenetic association that ensure race non-specific resistance that resulted in major delay in becoming entirely vulnerable (William et al., 2006).

The stem and yellow rust resistance genes Sr2/Yr30 are pleiotropic to each other (Singh et al., 2000b). Spielmayer et al. (2003) reported that a molecular marker Xgwm-533 (a microsatellite) is strongly linked to particular gene Sr2 that is being utilized in selection of genotypes in breeding technologies. In wheat breeding, still various resistance genes showing conflict to rust races have been recognized and are being used. In spring wheat grown in USA Lr34 has been widely used, Pathotypes of leaf rust with virulence to Lr34 had not been observed (Kolmer, 2009a). In US, Lr34 identified in soft red winter wheat is associated

Table 2: List of identified stripe rust resistance genes and presence in existing global wheat varieties.

Resistance genes Varieties Types of resistance Country References
Yr18, YrSulkirk(Yr27) Champigo-53, Inqilab 91 Non-specific resistanc Mexico, Pakistan

Mclentosh et al. 1995

Yr1 European cultivars Specific resistance Europe

Johnson et al. 1975

YrA Funo Specific resistance China Stibbs, 1985
Yr2 HeineseVII Non-specific resistance North America Line and Qayoun, 1991
Yr3 Danish 1 Specific resistance China Stibbs, 1985
Yr4 Hybrid46 Specific resistance India

Nagarajan et al. 1986

Lr18, Yr3с, Yr5, Yr9, Yr10, Yr15 and Yr17

Bezostaya Both specific and non-specific resistance Russia

Babyants et al. 2009

Yr6, Yr7, Yr18 Pavon F76 Non-specific resistance Mexico Mclntosh, 1992
Yr26 Chuannong 19 Non-specific resistance China

Luo et al. 2008

 

Table 3: List of identified stem rust resistance genes and presence in existing global wheat varieties.

Resistance genes Varieties Types of resistance Country References
Sr2, Sr6, Sr7b, Sr9d, Sr17 Hope Non-specific resistance USA

Mclontosh et al. 1995

Sr5, Sr9g, Sr21, Sr9e, Sr27 Marquis, Acme, Einkorn, Vernal, Triticale Specific-resistance Australasia Park and Wellings, 1992
Sr11, Sr8a, Sr16, Sr30 North America cultivars Specific-resistance North America Singh, 1991
Sr2, Sr6, Sr7a, Sr8a, Sr12, Sr17 Kenya Plume Non-specific resistance Kenya

Mclontosh et al. 1995

Sr13, Sr28, Sr30, Sr37 Indian Cultivars Specific-resistance India

Nargana et al. 1986

Sr13, Sr22, Khapli, Sebatel, Specific-resistance Ethopia,

Haile et al. 2013

Sr26 Eagle Specific-resistance Australia

Liu et al. 2010

Sr2 Bluesilver Non-specific resistance Pakistan

Mclontosh et al. 1995

Sr39+ Sr35 Canadian Cultivars Specific-resistance Canada

Gold et al. 1992; Niu et al. 2011

Sr58+ Sr46+ Yr29+Pm39 Pavon-76 Non-specific resistance Mexico

Long et al. 2014

 

to seedling resistance genes Lr2a, Lr9 and Lr26 which demonstrate an effective resistance level and adult plant resistance genes including Lr10, Lr11 Lr18 which exhibit moderate level of rust resistance (Kolmer et al., 2009b). Lr34 is closely linked to, powdery mildew resistance, barley yellow dewarf virus and leaf tip necrosis (Liang et al., 2006). The genetic linkage of Lr34 is linked to genotype Ardito and Mentana released in Italy during early nineteen century (Kolmer et al., 2008). The Lr34 was replicated and showed that Ltn1/Yr18/Lr34 has similar genetic characteristics and are linked to each other (Krattinger et al., 2009). Lr46/Yr29 the leaf and yellow rust resistance genes are also firmly pleiotropic (William et al., 2003). Suenaga et al. (2003) identified that molecular marker Xwmc44 is closely linked to Lr46/Yr29 which is located on chromosomal arm1BL. Its importance is alike Yr18/Lr34 gene which provides partial/non-specific resistance to plants rather than complete immunity. In the absence of Lr34 genotypes having Lr46 demonstrate long lasting resistance over control (Martinez et al., 2001). Without any necrotic or chlorotic effects, the plants with Lr34/Yr18 also reduce the spore production of the pathogen.

Gene pyramiding

Until now, discussion has dealt with major and minor gene resistance mostly individually but now we need to consider them together in terms of gene pyramids of both types of resistance genes either singly or in combination. A few however, not all major genes resistance act additively (Roelfs, 1988). For example, Sr26 and Sr24 both important for stem rust resistance, when present separately provide race specific resistance but in combination reaction is different as every gene alone. However, the use of pathogen races susceptible to Sr26 and resistant to Sr24 in pyramid association and vice versa demonstrated that each gene response individually (Roelf, 1988). Though whether the race specific and partial resistance genes show

Table 4: List of some triple rust resistance genes and their presence in existing wheat cultivars/varieties worldwide.

Varieties/Cultivars Leaf rust resistance Stripe rust resistance Stem rust resistance
Frontana

2-3 minor genes including Lr34

Yr18 and Yr9

Sr8a, Sr9b, Sr2 in various combination

Bluebird -

Yr6, YrA, and Yr18 minor gene

Sr5, Sr6, Sr8a including Sr2

Arina/Forno derivatives 3 minor genes including Lr34

3-4 minor genes including Yr18

SrFn, Sr minor genes

Lerma Rajo-64

Lr17a Lr17b minor genes in various Combinations Lr13, Lr17

Yra in combination Yr18

Sr2, Sr6, Sr7b, Sr9e
Sunco

4-6 minor genes including Yr18

Lr13, Lr24, 2-3 minor genes including Lr34, Lr46 in various combinations

Sr2, Sr24, Sr36, Sr30 in various combination

Pavon F76

Lr46, Lr10 minor genes

-

Sr2, Sr8a, Sr12, Sr30 including Sr58

Crankbrook

2 or more minor genes including Lr46

3-4 minor genes including Yr29

Sr2, Sr30

*Source: Mclntosh et al., 1995; Bariana et al., 2007

interaction or not, their individually response is the source of getting moderate level of resistance when resistant race specific genes are utilized in pyramid.

Many researchers use this technique to develop rust resistance to all three types of wheat rusts worldwide. Several genes pyramids became successful and provide good source of resistance against all rust diseases (Table 4), though few genes have rapidly been reduced their resistance. Rarely, such as Lr16, Lr13 and undesignated genes for leaf rust (Grama et al., 1984; Samborski and Dyck, 1962) Lr2a, Lr13, Lr16, Lr27, Lr31 and Lr34 seem to have an additive impact in combination (Ezzahiri and Roelfs, 1989; German and Kolmer, 1990; Singh and McIntoch, 1984).

Combination of some rust resistance genes i.e. the ‘Frontana complex’ for leaf rust, the ‘Sr2 complex’ for stem rust resistance, an association of Little Joss and Anza assortments for stripe rust, have demonstrated prolonged stability (Johnson, 1988; Rajaram et al., 1988; Roelfs, 1989). A special set of germplasm lines were developed in CIMMYT to carry two to four non-specific resistance genes against yellow/ stripe rust (Bariana et al., 2001). A few of these cultivars have race specific resistance to leaf rust, which do not exhibit resistant response in Mexico, but provide effective response against leaf rust of Australian wheat germplasm. Stem or black rust resistance generally depends on Sr2 or/and Sr30 genes. Occurrence of Lr34/Yr18 and Sr2 in these germplasms was identified through using genetic markers associated with these genes. These complexes provide high level of rust resistance in the developing new wheat elite lines at CIMMYT and worldwide. Such race non-specific resistance genes can be combined with some major genes to deliver genetic diversity (Roelfs et al., 1992).

Marker assisted selection (MAS)

MAS has been broadly used for selecting durable resistance in wheat germplasm to rust diseases; however, the mostly breeding schemes depend on phenotypic selection due to lack of DNA robust markers, high cost of reliable molecular DNA marker and high accuracy of phenotypic selection. Through using a robust molecular marker firmly linked with resistance genes Lr30, Lr26, Lr20, Lr14b, Lr10, Lr9, Lr3, Lr3ka and Lr1 (Anderson et al., 2013) were capable to identify and screen a greater number of fifty one varieties/cultivars to capably enhance the level of partial resistance. Closely linked markers give phenotype unbiased selection of associated gene in breeding population. Such molecular markers certify selection of a mark gene relying on the close genetic occurrence of the connected genotype.

The achievement of selection is reliant on the nearby chromosomal association and a particular marker over diverse genetic linkage. Firmly associated molecular DNA markers are accessible for numerous major and minor rust resistance genes. The list of some mostly used robust and approved DNA markers in Mexico, Pakistan and worldwide for leaf, stripe and stem rust resistance genes are illustrated in Table 5 together with their primer sequence, base pair, and the references.

In winter bread wheat, molecular DNA markers for Lr3 and some other assessable trait loci to stem, yellow

Table 5: List of robust DNA markers tightly linked with triple rust resistance genes, with their primer sequence, base pair, and the references.

Genes Marker Primer code Primer sequence (5' to 3') Base pair References
Lr9 J13-F

21F

21R

CCACACTACCCCAAAGAGACG

TCCTTTTATTCCGCACGCCGG

110

Schachermayr et al.

(1994)

Lr19-Sr25 GB

16F

18R

CAT CCT TGG GGA CCT C

CCA GCT CGC ATA CAT CCA

130

Cherukuri et al. (2003)

Lr21 D14

20F

20R

CGC TTT TAC CGA GAT TGG TC

CCA AAG AGC ATC CAT GGT GT

885 Huang and Gill, (2001)
Lr34/Yr18 Xbarc352

20F

21R

AGCTCTGCTTCACGAGGAAG

CTCCTCTTTATATCGCGTCCC

250

Roder et al. (1998)

Lr34/Yr18

Cssfr5

21F

21R

GTTGGTTAAGACTGGTGATGG

TGCTTGCTATTGCTGAATAGT

150

Lagudah et al. (2006)

Lr35-Sr39 Sr39

20F

18R

AGA GAG AGT AGA AGA GCT GC

AGA GAG AGA GCA TCC ACC

900

Gold et al. (1999)

Lr46/Yr29 Xwmc44

22F

22R

GGTCTTCTGGGCTTTGATCCTG

TGTTGCTAGGGACCCGTAGTGG

242 Somers and Isaac, (2004)
Lr47

PS10R

PS10L2

19F

19R

GCTGATGACCCTGACCGGT

GGGCAGGCGTTTATTCCAG

224

Helguera et al. (2000)

Yr1 stm673acag

24F

22R

TAACTCACAACACGTTCTGGTCGT

ACACACACACACACAGAGAGAG

120

Bansal et al. (2009)

Yr5 STS-7/8

18F

18R

GTACAATTCACCTAGAGT

GCAAGTTTTCTCCCTATT

439

Zhang et al. (2009)

Yr9 H20

21F

22R

GTTGGAAGGGAGCTCGAGCTG

GTTGGGCAGAAAGGTCGACATC

-

Liu et al. (2008)

Yr10 Yr10

20F

21R

TCAAAGACATCAAGAGCCGC

TGGCCTACATGAACTCTGGAT

543

Liu et al., (2010)

Yr15 gwm413

21F

19R

TGCTTGTCTAGATTGCTTGGG

GATCGTCTCGTCCTTGGCA

390

Murphy et al. (2009)

Yr29 bac17R

21F

21R

CCCATGCTGACATGGCCACAT

CTCTGCTCTTTAGTAGTTGCC

500

Rosewarne et al. (2006)

Yr46 gwm165

21F

20R

GGTGGGGTTGGGAAGACAACG

TGCAGTGGTCAGATGTTTCC

236

Herrera-Foessel et al.(2014)

Yr51 sun104

20F

20R

TGCTATGTGCGTGATGATGA

TTACATGCTCCAGCGACTTG

250

Randhawa et al. (2014)

Yr57 gwm389

21F

20R

ATCATGTCGATCTCCTTGACG

TGCCATGCACATTAGCAGAT

117

Randhawa et al. (2015)

YrSP dp269

18F

20R

CTGCTGTCACCGCTCTCC

AGTCACACGCCCTACTCTCC

343

Yin et al. (2009)

Sr2/yr30 gwm53

20F

20R

AAG GCG AAT CAA ACG GAA TA

GTT GCT TTA GGG GAA AAG CC

120

Spielmeyer et al. (2006)

Sr2/yr30 stm598tcac

20F

21R

GTTGCTTTAGGGGAAAAGCC

TCTCTCTCTCTCTCACACACAC

56

Hayden et al. (2004)

Sr2 csSr2

24F

28R

CAAGGGTTGCTAGGATTGGAAAAC

AGATAACTCTTATGATCTTACATTTTTCTG

172

Mago et al. (2002)

Sr22 Cfa2019

20F

20R

GACGAGCTAACTGCAGACCC

CTCAATCCTGATGCGGAGAT

234

Khan et al. (2005)

Sr24-Lr24 Sr24#12

19F

23R

CACCCGTGACATGCTCGTA

AACAGGAAATGAGCAACGATGT

500

Mago et al. (2005)

Sr26 Sr26#43

20F

21R

AATCGTCCACATTGGCTTCT

CGCAACAAAATCATGCACTA

270

Mago et al. (2005)

Sr31-Lr26-Yr9 Iag95

24F

24R

CTCTGTGGATAGTTACTTGATCGA

CCTAGAACATGCATGGCTGTTACA

1100

Mago et al. (2002)

Sr35 CFA2170

20F

20R

TGGCAAGTAACATGAACGGA

ATGTCATTCATGTTGCCCCT

190

Babiker et al. (2009)

and leaf rust were identified. Israeli x Fukuhokomugi wheat oligoculm cross and Japane CV with double haploid population were used for commercial cultivation. The results exhibited the certain genetic variation of genes which confer slightly effects to stripe rust resistance, and useful documentation of these microsatellite DNA marker are helpful for both combining such partial resistance genes and selecting wheat germplasm effectively (Suenaga et al., 2003). Molecular mapping of Lr46/ Yr29 were identified on chromosome 1B provides the durable resistance against both leaf and yellow rust (Willium et al., 2003). A set of molecular markers were used for genetic efficacy in breeding programs, two markers pleiotropic to Sr2 a stem rust resistance gene, several linked with chromosomal loci having Sr38/Lr37/Yr17 resistance gene, one for Lr28, two specified DNA markers for the associated genes Lr35/ Sr39. Gene Sr2, provides durable resistance to black rust and generally under field conditions (Sharp et al., 2001).

Conclusions and Recommendations

Information in regards to characteristics and distribution of rust resistance genes is useful for developing new wheat varieties with durable rust resistance. Gene pyramiding through MAS and the utilization of various molecular methodologies is necessary to combat partial rust resistance in wheat varieties. Combining information on race non-specific resistance varieties and their mechanism for controlling rust disease, which is the focus of this paper, is also important for the development of new disease-resistant varieties with high yielding capabilities. Overall, this work aims to support pathologists, plant breeders, and wheat researchers by increasing consideration of the recent state of the field of wheat research.

Authors Contributions

Yasir Ali: Conceptualize the main idea and wrote the article.

Muhammad Aslam Khan: Helped in conceptualize the main idea and supervised the entire work:

Muhammad Atiq and Muhammad Hussain: Helped in collection and management of data.

All authors read and approved the final manuscript.

References

Anderson, J.A., S. Chao and S. Liu. 2013. Molecular breeding using a major QTL for Fusarium head blight resistance in wheat. Crop Sci. 47: 112–19.

Bansal, U., H. Bariana, D. Wong, M. Randhawa, T. Wicker, M. Hayden and B. Keller. 2014. Molecular mapping of an adult plant stem rust resistance gene Sr56 in winter wheat cultivar Arina. Theor. Appl. Genet. 127: 1441–1448. https://doi.org/10.1007/s00122-014-2311-1

Babayants, O., L. Babayants and Chusovitina N. 2009. Yellow rust in the south of Ukraine and resistance of wheat varieties to it in the region. 12th Int Cereal Rusts and Powdery Mildews Conf, Antalya, Turkey, Abstract Book, October 13-16, p93.

Bansal, U.K., M.J. Hayden, B. Keller, C.R. Wellings, R.F. Park and H.S. Bariana. 2009. Relationship between wheat rust resistance genes Yr1 and Sr48 and a microsatellite marker. Plant Pathol. 58: 1039–1043. https://doi.org/10.1111/j.1365-3059.2009.02144.x

Bariana, H.S., M.J. Hayden, N.U. Ahmad, J.A. Bell, P.J. Sharp and R.A. McIntosh. 2001. Mapping of durable adult plant and seedling resistance to stripe and stem rust disease in wheat. Aust. J. Agric. Res. 52: 1247-1255. https://doi.org/10.1071/AR01040

Bariana, H.S., G.N. Brown, U.K. Bansal, H. Miah, G.E. Standen and M. Lu. 2007. Breeding triple rust resistant wheat cultivars for Australia using conventional and marker-assisted selection technologies. Aust. J. Agric. Res. 58: 576–587. https://doi.org/10.1071/AR07124

Bariana, H., U. Bansal, A. Schmidt, A. Lehmensiek, J. Kaur, H. Miah, N. Howes and C. McIntyre. 2010. Molecular mapping of adult plant stripe rust resistance in wheat and identification of pyramided QTL genotypes. Euphytica. 176: 251-260. https://doi.org/10.1007/s10681-010-0240-x

Babiker, E., A.M. Ibrahim, Y. Yen and J. Stein. 2009. Identification of a microsatellite marker associated with stem rust resistance gene Sr35 in wheat. Austr. J. crop sci. 3: 195.

Badebo, A., R.W. Stubbs, G. Van and G. Gebeyehu. 1990. Identification of resistance genes to Puccinia striiformis in seedlings of Ethiopian and CIMMYT bread wheat varieties and lines. Netherlands J. Pl. Pathol. 96: 199-210. https://doi.org/10.1007/BF01974257

Bux, H.M., Ashraf, X.M. Chen and A.S. Mumtaz. 2011. Effective genes for resistance to stripe rust and virulence of P. striiformis f.sp. tritici in Pakistan. Afr. J. Biotech. 10: 5489-5459.

Brown, J.K. 2015. Durable resistance of crops to disease: a darwinian perspective. Annu. Rev. Phytopathol. 53: 513–539. https://doi.org/10.1146/annurev-phyto-102313-045914

Chen, X.M. 2007. Challenges and solution for stripe rust control in the United States, Aust. J. Agric. Res. 58:648-655. https://doi.org/10.1071/AR07045

Cherukuri, D.P., S.K. Gupta and A. Charpe. 2003. Identification of a molecular marker linked to an Agropyron elongatum derived gene Lr19 for leaf rust resistance in wheat. Plant Breed. 122: 204–208. https://doi.org/10.1046/j.1439-0523.2003.00846.x

Falk, A., B.J. Feys, L.N. Frost, J.D.G. Jones, M.J. Daniels and J.E. Parker. 1999. EDS.1: An essential component of R gene-mediated reistance in Arabidopsis has homology to eukariotic lipases. Proc. Natl. Acad. Sci. 96: 3292-3297.

Dodds, P.N. and J.P. Rathjen. 2010. Plant immunity: towards an integrated view of plant–pathogen interactions. Nat. Rev. Genet. 11: 539-548. https://doi.org/10.1038/nrg2812

Ezzahiri, B. and A.P. Roelfs. 1989. Inheritance and expression of adult plant resistance to leaf rust in Era wheat. Pl. Dis. 73: 549-551. https://doi.org/10.1094/PD-73-0549

Ellis, J.G., E.S. Ladugah, W. Spielmeyer and P.N. Dodds. 2014. The past, present and future of breeding rust resistant Wheat. Frontiers Pl. Sci. 5: 1-14. https://doi.org/10.3389/fpls.2014.00641

Fyyaz, M., A.R. Rattu, I. Ahmad, M.A. Akhtar, A.A. Hakro and A. Mujeeb-Kazi. 2008. Current status of occurrence and distribution of wheat leaf rust virulence in Pakistan. Pak. J. Bot. 40(2): 887-895.

Flath K. and G. Bartles. 2002. Virulence situation in Austrian and german population of wheat yellow rust Arbeitstagun der pflanzenzuchter und saatgutkaufleute osterreichs gehalten vom 20-22, November 2001, Gumpenstein, Irdning, Austria. pp.51-60.

Fetch, T., Y. Jin, K. Nazari, R. Park, M. Prashar and Z. Pretorius. 2009. Race nomenclature systems: can we speak the same language? In: McIntosh R (ed) Proc Oral Papers and Posters, 2009. Technical Workshop, BGRI, Cd. Obregón, Sonora Mexico, pp. 61–64.

German, S.E. and J.A. Kolmer. 1990. Effect of Lr gene combinations on resistance to wheat leaf rust. Phytopathol. 79: 1216.

Gold, J., D. Harder, F. Townley-Smith, T. Aung and J. Procunier. 1999. Development of a molecular marker for rust resistance genes Sr39 and Lr35 in wheat breeding. Nat. Biotech. 2(1): 15.

Grama, A., Z.K. Gerechter-Amitai and C.H. Van Silthout. 1984. Additive gene action for resistance to Puccinia striiformis f. sp. tritici in triticum dicoccoides. Euphytica. 33: 281-287. https://doi.org/10.1007/BF00021123

Haile, J.K., K. Hammer., A. Badebo, R.P. Singh and M.S. Roder. 2013. Haplotype analysis of molecular markers linked to stem rust resistance genes in Ethiopian improved durum wheat varieties and tetraploid wheat landraces. Gene. Res. Crop. Evo. 60: 853-864. https://doi.org/10.1007/s10722-012-9880-0

Hayden, M.J., H. Kuchel and K.J. Chalmers. 2004. Sequence tagged microsetellites for the Xgwm533 locus provide new diagnostic markers to select for the presence of stem rust resistance gene Sr2 in bread wheat (Triticum aestivum L.). Theor. Appl. Gene. 109: 1641–1647. https://doi.org/10.1007/s00122-004-1787-5

Helguera, M., I.A. Khan and J. Dubcovsky. 2000. Development of PCR markers for wheat leaf rust resistance gene Lr47. Theor. Appl. Gene. 101:625–631. https://doi.org/10.1007/s001220051524

Herrera-Foessel, S.A., R.P. Singh, J. Huerta-Espino, G.M. Rosewarne, S.K. Periyannan, L. Viccars, V. Calvo-Salazar, C. Lan and E.S. Lagudah. 2012. Lr68: a new gene conferring slow rusting resistance to leaf rust in wheat. Theor. Appl. Gene. 124: 1475-1486. https://doi.org/10.1007/s00122-012-1802-1

Herrera-Foessel, S.A., R.P. Singh, M. Lillemo, J. Huerta-Espino, S. Bhavani, S. Singh, C. Lan, S.V. Calvo and Lagudah E.S. 2014. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat. Theor. Appl. Gene. 127: 781–789. https://doi.org/10.1007/s00122-013-2256-9

Huang, L. and B.S. Gill. 2001. An RGA like marker detects all known Lr21 leaf rust resistance gene family members in Aegilops taushii and wheat. Theor. Appl. Gene. 103: 1007–1013. https://doi.org/10.1007/s001220100701

Hussain, M., M. Kirmani and M. Haque. 2004. Pathotypes and man guided evolution of Puccinia striiformis West. f. sp. tritici in Pakistan. In Abstracts, Second Regional Yellow Rust Conference for Central and West Asia and North Africa. 22-26.

Jain, S.K., M. Prashar, S.C. Bhardwaj, S.B. Singh and Y.P. Sherma. 2009. Emergence of virulence to Sr25 of Puccinia graminis f. sp. tritici of wheat in India. Plant Dis. 93: 480. https://doi.org/10.1094/PDIS-93-8-0840B

Jin, Y., L.J. Sczabo, Z. Pretorius, R.P. Singh and T. Fetch. 2008. Detection of virulence to resistance gene Sr24 within race TTKS of Puccinia graminis f. sp. tritici. Plant Dis. 92: 923–926. https://doi.org/10.1094/PDIS-92-6-0923

Johnson, R. and C.N. Law. 1975. Genetic control of durable resistance to yellow rust (Puccinia striiformis) in the wheat cultivar Hybride de Bersee. Ann. Appl. Biol. 81: 385–391. https://doi.org/10.1111/j.1744-7348.1975.tb01654.x

Johnson, R. 1988. Durable resistance to yellow (stripe) rust in wheat and its implications in plant breeding. In: Breeding Strategies for Resistance to the Rusts of Wheat, pp: 63–75. Simmonds, N.W. and S. Rajaram (eds.). CIMMYT, Mexico.

Khan, R.R., H.S. Bariana, B.B. Dholakia, S.Y. Naik, M.D. Lagu, A.J. Rathjen, S. Bhavani and V. Gupta. 2005. Molecular mapping of stem rust and leaf rust resistance in wheat. Theor. Appl. Gene. 111:846–850. https://doi.org/10.1007/s00122-005-0005-4

Khan, M.H., A. Bukhari, Z.A. Dar and S.M. Rizvi. 2013. Status and strategies in breeding for rust resistance in wheat. Agri. Sci. 4: 292-297. https://doi.org/10.4236/as.2013.46042

Knott, D.R. 1988. Using polygenic resistance to breed for stem rust resistance in wheat. In: Breeding Strategies for Resistance to the Rusts of Wheat, pp: 39–47. Simmonds, N.W. and S. Rajaram (eds.). CIMMYT, Mexico.

Kolmer, J. and M. Acevedo. 2016. Genetically divergent types of the wheat leaf fungus Puccinia triticina in Ethiopia, a center of tetraploid wheat diversity. Phytopathol. 106: 380–385. https://doi.org/10.1094/PHYTO-10-15-0247-R

Krattinger, S.G., E.S. Lagudah and W. Spielmeyer. 2009. Aputative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Sci. 323: 1360–1363. https://doi.org/10.1126/science.1166453

Kolmer, J.A., R.P. Singh, D.F. Gravin, L. Vicaars, H.M. William, J.A. Huerta-Espino, F.C. Ogbonayya, H. Raman, S. Orford, H.S. Barianaand and E.S. Ladugha. 2008. Analysis of Lr 34/Yr18 rust resistance region in wheat germplasm. Crop sci. 48: 1841-1852. https://doi.org/10.2135/cropsci2007.08.0474

Kolmer, J.A. 2009a. Postulation of leaf rusts resistance genes in selected soft red winter wheat. Crop Sci. 43:1266-1276. https://doi.org/10.2135/cropsci2003.1266

Komler, J.A., X. Chen and Y. Jin. 2009b. Disease which challenge global wheat production –the wheat rusts. In: Carver BF (ed) wheat: Science and trade. Wiley Blackwell, IA, PP. 89-124.

Lagudah, E.S., H. Mcfadden, R.P. Singh, J. Heurta-Espino, H.S. Bariana and W. Spielmyer. 2006. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Gene. 114: 21–30. https://doi.org/10.1007/s00122-006-0406-z

Lin, F. and X.M. Chen. 2009. Quantitative trait loci for non-race-specific, high-temperature adult-plant resistance to stripe rust in wheat cultivar Express. Theor. Appl. Genet. 118: 631-642. https://doi.org/10.1007/s00122-008-0894-0

Line, R.F. and A. Qayoum. 1991. Virulence, aggressiveness, evolution and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-1987. Tech. Bull. No. 1788. (United States Department of Agriculture: Washington.).

Leonard, K. and L. Szabo. 2005. Stem rust of small grains and grasses caused by Puccinia graminis. Mol. Plant Pathol. 6:99–111. https://doi.org/10.1111/j.1364-3703.2005.00273.x

Liu, S., L.X. Yu, R.P. Singh, Y. Jin, M.E. Sorrells and J.A. Anderson. 2010. Diagnostic and co-dominant PCR markers for wheat stem rust resistance genes Sr25 and Sr26. Theor. Appl. Genet. 120: 691-697. https://doi.org/10.1007/s00122-009-1186-z

Liang, S.S., K. Savenaga, Z.H. He, Z.L. Wang, H.Y. Liu, D.S. Wang, R.P. Singh, P. Sourdille and Y.C. Xia. 2006. Quantitative trait loci mapping for adult plant resistance to powdery mildew in bread wheat. Phytopathol. 96: 784-789. https://doi.org/10.1094/PHYTO-96-0784

Long, X.Y., H. Barbier and N.M. Rouse. 2014. A consensus map for Ug99 stem rust resistance loci in wheat. Theor. Appl. Genet. 127: 1561–1581. https://doi.org/10.1007/s00122-014-2326-7

Luo, P.G., X.Y. Hu, Z.L. Ren, H.Y. Zhang, K. Shu and Z.J. Yang. 2008. Allelic analysis of stripe rust resistance genes on wheat chromosome 2BS. Genome. 51: 922-927. https://doi.org/10.1139/G08-079

Lupton, F.G.H. 1987. History of wheat breeding. In: Wheat Breeding, its Scientific Basis, pp: 51–70. Lupton, F.G.H. (ed.). Chapman and Hall, London. https://doi.org/10.1007/978-94-009-3131-2_3

Marais, F., A. Marais, B. McCallum and Z. Pretorius. 2009. Transfer of leaf rust and stripe rust resistance genes and from req. ex Bertol. to common wheat. Crop Sci. 49: 871-879. https://doi.org/10.2135/cropsci2008.06.0317

Marais, G., P. Badenhorst, A. Eksteen and Z. Pretorius. 2010. Reduction of Aegilops sharonensis chromatin associated with resistance genes Lr56 and Yr38 in wheat. Euphytica, 171: 15-22. https://doi.org/10.1007/s10681-009-9973-9

Martinez, F., Nicks, R.E., Singh, R.P. and Rubiales. 2001. Characterization of Lr-46, a gene conferring partial resistance to wheat leaf rust. Hereditas. 135: 111-114. https://doi.org/10.1111/j.1601-5223.2001.00111.x

Mago, R., H.S. Bariana, L.S. Dundas, W. Speilmeyer, G.J. Lawrence, A.J. Pryor and J.G. Ellis. 2005. Development of PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse wheat germplasm. Theor. Appl. Genet. 111: 496–504. https://doi.org/10.1007/s00122-005-2039-z

Mago, R., W. Speilmeyer, G.J. Lawrence, E.S. Lagudah, J.G. Ellis and A.J. Pryor. 2002. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat rye translocation lines. Theor. Appl. Genet. 104: 1317–1324. https://doi.org/10.1007/s00122-002-0879-3

McIntosh, R.A., K.M. Devos, J. Dubcovsky, W.J. Rogers, C.F. Morris, R. Appels, D.J. Somers and O.A. Anderson. 2008. Catalogue of gene symbols for wheat: 2008 supplement, http://www.shigen.nig.ac.jp/wheat/komugi/genes/symbolClassList.jsp.

McIntosh, R.A., Y, Yamazaki and K.M. Devos. 2003. Catalogue of gene symbols for wheat. In: Pogna NE Romano M Pogna A Galterio G, editors. Proceedings of the 10th International Wheat Genetics Symposium; 2003 Sep 1-6; Istituto Sperimentale per la Cerealicoltura; Paestum, Italy.

McIntosh, R.A. 1992. Close genetic linkage of genes conferring adult-plant resistance to leaf rust and stripe rust in wheat. Plant Pathol. 41: 523–527. https://doi.org/10.1111/j.1365-3059.1992.tb02450.x

McIntosh, R.A., C.R. Wellings and R.F. Park. 1995. Wheat Rusts: An Atlas of Resistant Genes. CSIRO Publication, Australia. https://doi.org/10.1007/978-94-011-0083-0

Murphy, L.R., D. Santra, K. Kidwell, G. Yan, X. Chen and K.G. Campbell. 2009. Linkage maps of wheat stripe rust resistance genes Yr5 and Yr15 for use in marker-assisted selection. Crop Sci. 49: 1786–1790. https://doi.org/10.2135/cropsci2008.10.0621

Nagarajan, S., S.K. Nayar, P. Bahadur and J. Kumar. 1986. ‘Wheat Pathology and Wheat Improvement.’ (Azad Hind Stores: Chandrigarh, India.)

Niu, Z., D.L. Klindworth, T.L. Friesen, S. Chao, Y. Jin, X. Cai and S.S. Xu. 2011. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering. Genetics. 187: 1011-1021. https://doi.org/10.1534/genetics.110.123588

Oliver, R.P. 2014. A reassessment of the risk of rust fungi developing resistance to fungicides. Pest Manage Sci 70(11): 1641–1645. https://doi.org/10.1002/ps.3767

Park, R.F. and C.R. Wellings. 1992. Pathogenic specialisation of wheat rusts in Australia and New Zealand in 1988 and 1989. Austr. Plant Pathol. 21: 61-69.

Prins, R., J.Z. Groenewald, G.F. Marais, J.W. Snape and R.M.D. Koebner. 2001. AFLP and STS tagging of Lr19, a gene conferring resistance to leaf rust in wheat. Theor. Appl. Genet. 103: 618–624. https://doi.org/10.1007/PL00002918

Ratu, A.R.I., M. Ahmad, M.A. Fayyaz, Akhtar, Irfan-ulhaque, M. Zakaria, S.N. Afzal. 2009. Puccinia tritivina cause leaf rust of wheat. Pak. J. Bot. 41: 1957-1964.

Randhawa, M., U. Bansal, M. Valarik, B. Klocova, J. Dolezel, H. Bariana. 2014. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat. Theor. Appl. Genet. 127: 317–324. https://doi.org/10.1007/s00122-013-2220-8

Randhawa, M., H. Bariana, R. Mago U and Bansal. 2015. Mapping of a new stripe rust resistance locus Yr57 on chromosome 3BS of wheat. Mol. Breed. 35: 65-73. https://doi.org/10.1007/s11032-015-0270-0

Rajaram, S., R.P. Singh and E. Torres. 1988. Current approaches in breeding wheat for rust resistance. In: Breeding Strategies for Resistance to Rusts of Wheat, pp: 101–118. Symmonds, N.W. and S. Rajaram (eds.). CIMMYT, Mexico D.F. Mexico.

Rehman, A.U., M. Sajjad, S. Khan N. Ahmad. 2013. Prospects of wheat breeding for durable resistance against brown, yellow and black rust fungi. Int. J. Agri. Bio. 15: 1209-1220.

Röder, M.S., K. Victor, W. Katja, P. Jens, T. Marie-Hélène, L. Philippe, W. Martin and A. Ganal. 1998. A microsatellite map of wheat. Genet. 149: 2007-2023.

Rosewarne, G.M., R.P. Singh, J. Huerta-Espino, H.M. William, S. Bouchet, S. Cloutier, E.S. Lagudah. 2006. Leaf tip necrosis, molecular markers and β1-proteasome subunits associated with the slow rusting resistance genes Lr46/Yr29. Theort. Appl. Genet. 112(3): 500-508. https://doi.org/10.1007/s00122-005-0153-6

Roelfs, A.P. and J.W. Martens. 1988. An international system of nomenclature for Puccinia graminis f. sp. tritici. Phytopathol. 78: 526-533. https://doi.org/10.1094/Phyto-78-526

Roelfs, A. 1989. Genetic control of phenotypes in wheat stem rust. Annu. Rev. Phytopathol. 26:351–367. https://doi.org/10.1146/annurev.py.26.090188.002031

Roelf, A.P., R.P. Singh and E.E. Saari. 1992. Rust diseases of wheat. Concepts and methods of disease management. CIMMYT, Mexico. pp.81.

Roelfs, A.P., M.E. Hughes and D.L. Long. 2002. Rust resistance genes in wheat lines and cultivars. U.S. Departtment of Agricultural Research Services, Cereal Division Lab. 2000. Online, Publication CDL–EP #006 (2000) Accessed 7 Nov 2002. Available from: http://www.ars.usda.gov/Main/docs.htm? docid=10103.

Samborski, D.J. and P.L. Dyck. 1962. Enhancement of resistance to Puccinia recondita by interactions of resistance genes in wheat. Can. J. Plant Pathol. 4: 152-156. https://doi.org/10.1080/07060668209501317

Schachermayr, G., H. Siedler and M.D. Gale. 1994. Identification and localization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theoret. Appl. Genet 88: 110–115. https://doi.org/10.1007/BF00222402

Sharp, P.J., S. Johnston, A.G. Brown, A.M. Mclntosh, M. Palloota, H.S. Carter, S. Bariana, E.E. Khatkar, S. Lagudah, R.P. Sing, M. Khairallah, R. Potter and M.J.K. Jones. 2001. Validation of molecular markers for wheat breedings. Aust. J. Agric. Res. 52: 1357-1366. https://doi.org/10.1071/AR01052

Singh, R.P., J. Huerta-Espino and H.M. William. 2005. Genetics and breeding for durable resistance to leaf and stripe rusts in wheat. Turk. J. Agric. 29: 121–127.

Singh, R.P. 1991. Pathogenicity variations of Puccinia recondita f. sp. tritici and P. graminis f. sp. tritici in wheat-growing areas of Mexico during 1988 and 1989. Plant Dis. 75: 790-794. https://doi.org/10.1094/PD-75-0790

Singh, R.P. 1992. Genetic association of leaf rust resistance gene Lr34 with adult plant resistance to stripe rust in bread wheat. Phytopathol. 82: 835–838. https://doi.org/10.1094/Phyto-82-835

Singh, R.P. and R.A. McIntosh. 1984. Genetics of resistance to Puccinia graminis f.sp. tritici and Puccinia recondita f.sp. tritici in Kenya Plume wheat. Euphytica. 35: 245-256. https://doi.org/10.1007/BF00028563

Singh, R.P., S. Herrera-Foessel, S. Huerta-Espino, S. Singh, C. Bhavani and B.R. Basnet. 2014. Progress towards genetics and breeding for minor genes based resistance to Ug99 and other rusts in CIMMYT high-yielding spring wheat. J. Int. Agric. 13: 255-261. https://doi.org/10.1016/S2095-3119(13)60649-8

Shepherd, K.W. and K.W. Finley. 1968. Breeding for general and/or specific plant disease resistance. Proceedings of the Third International Wheat Genetics Symposium; 1968 Aug 5-9; Canberra.

Singh, R.P., J. Huerta-Espino and S. Bhavani. 2011. Race nonspecific resistance to rust diseases in CIMMYT spring wheats. Euphyt.179: 175–186. https://doi.org/10.1007/s10681-010-0322-9

Singh, R.P., J. Huerta-Espino and S. Rajaram. 2000a. Achieving near-immunity to leaf and stripe rusts in wheat combining slow rust resistance genes. Acta. Phytopathal. Ento. Hung. 35: 133-139.

Singh, R.P., J.C. Nelson and M.E. Sorrells. 2000b. Mapping Yr28 and other genes for resistance to stripe rust in wheat. Crop Sci. 40: 1148-1155. https://doi.org/10.2135/cropsci2000.4041148x

Singh, R.P., J. Huerta-Espino and H.M. William. 2005. Genetics and breeding for durable resistance to leaf and stripe rusts in wheat. Turk. J. Agric. 29: 121-127.

Spielmeyer, W., P.J. Sharp and E.S. Lagudah. 2003. Identification and validation of markers linked to broad spectrum stem rust resistance gene Sr2 in wheat (Triticum aestivum L.). Crop Sci. 43: 333–336. https://doi.org/10.2135/cropsci2003.0333

Stubbs, R.W. 1985. Stripe rust. In ‘The Cereal Rusts’. Vol II. (Eds AP Roelfs and WR Bushnell.) pp. 61-101. (Academic Press: Orlando, Florida, USA.).

Somers, D.J. and P. Isaac. 2004. Detection of DNA Polymorphism, Genetic Diversity and Genotype Identification by using Microsatellites in Bread Wheat (Triticum aestivum L.). Int. J. Sci. and Engin. Res. 4: 2229-5518.

Suenaga, K., R.P. Singh, J. Huerta-Espino and M. William. 2003. Micro satellite markers for genes Lr34/Yr18 and other quantitative trait loci for leaf rust and stripe rust resistance in bread wheat. Phytopathol. 93: 881-890. https://doi.org/10.1094/PHYTO.2003.93.7.881

Todorovska, E., Christov, N. and S. Slavov. 2009. Biotic stress resistance in wheat breeding and genomic selection implications. Biotech. 23(4): 417–1426. https://doi.org/10.2478/V10133-009-0006-6

Wang, A.M., X.M. Chen and Z.H. He. 2007. Wheat stripe rust in China. Aust. J. Agric. Res. 58: 605-619.

Watson, I.A. 1958. The present status of breeding disease resistant wheats in Australia. Agri. Gaz NSW. 69: 630–660.

Wan, A.M., X.M. Chen, Z.H. He. 2007. Wheat stripe rust in China. Aust. J. Agric. Res. 58: 605-619. https://doi.org/10.1071/AR06142

Wanyera, R., M.G. Kinyua, Y. Jin and R.P. Singh. 2006. The spread of stem rust caused by Puccinia graminis f. sp. tritici, with virulence on Sr31 in wheat in Eastern. Afr. Plant Dis. 90: 113-117. https://doi.org/10.1094/PD-90-0113A

William, H.M., R.P. Singh, J. Huerta-Espino, S. Ortiz-Islas and D.H. Hoisington. 2003. Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust gene Yr29 in wheat. Phytopathol. 93: 153-159. https://doi.org/10.1094/PHYTO.2003.93.2.153

William, H.W., R.P. Singh and G. Palacious. 2006. Characterization of genetic loci conferring adult plant resistance to leaf and stripe rust in spring wheat. Genome. 49: 930-977. https://doi.org/10.1139/g06-052

Yildirim, K., B. Boylu, E. Atici, T. Kahraman and M.S. Akkaya. 2012. In turkish wheat cultivars the resistance allele of LR34 is ineffective against leaf rust. J. Pl. Dis. Protec. 119: 135–141. https://doi.org/10.1007/BF03356432

Zhang, P., R.A. McIntosh, S. Hoxha and C. Dong. 2009. Wheat stripe rust resistance genes Yr5 and Yr7 are allelic. Theor. Appl. Genet. 120: 25–29. https://doi.org/10.1007/s00122-009-1156-5