Molecular Characterization and Differential Expression of Two Prostaglandin E Synthase 2 Orthologs in Coilia nasus
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
1Fisheries College, Nanjing Agricultural University, Wuxi 214128, China
2Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi, Jiangsu, 214081, China
ABSTRACT
The estuarine tapertail anchovy (Coilia nasus) is a widely-distributed and commercially-important aquaculture species. In this study, two prostaglandin E synthase 2 (PTGES2) orthologs were identified. The full length ortholog PTGES2a was 1,575 bp and contained a 1,167-bp Open Reading Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino acids. The 5′ and 3′ untranslated regions were 402 bp and 326 bp, respectively. One polyadenylation signal (AATAAA) was present 14 nucleotides upstream of the poly(A) tail in both the PTGES2a and the PTGES2b gene. The full-length genomic DNA sequence of PTGES2a is 3,222 bp long, and composed of seven exons and six introns. The full-length genomic DNA sequence of PTGES2b is 1,908 bp long, and composed of six exons and five introns. PTGES2a was strongly expressed in the gills and liver while PTGES2b was strongly expressed in the gills and testis. Expression of both PTGES2a and PTGES2b decreased from stage III to stage V and PTGES2a was significantly more highly expressed than PTGES2b. In the spawning process, the expression of PTGES2a did not significantly change, remaining at a low level. In contrast, PTGES2b expression significantly increased during spawning. These results provide basic knowledge of the new PTGES2s of C. nasus.
Article Information
Received 01 April 2018
Revised 19 May 2018
Accepted 31 May 2018
Available online 30 January 2019
Authors’ Contribution
GX performed the experiments, analyzed the data, wrote the manuscript. FD, YW, YL and ZN prepared samples used in this study. PX conceived and designed the project.
Key words
Coilia nasus, Prostaglandin E synthase 2 gene, Gene expression.
DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.2.483.494
* Corresponding author: [email protected]
0030-9923/2019/0002-0483 $ 9.00/0
Copyright 2019 Zoological Society of Pakistan
Introduction
Prostaglandin E synthase 2 (PTGES2) is a membrane-associated enzyme, which catalyses the conversion of prostaglandin (PG) H2 to PGE2 (Mattila et al., 2009). This protein is thought to be targeted to the Golgi apparatus as well as the mitochondrion within the cell. Microsomal PTGES2 (mPTGES2) has been crystallized with the anti-inflammatory drug indomethacin (IMN) (Yamada et al., 2005). mPTGES2 exists as a dimer (Yamada et al., 2005), with its N-terminal attached to the lipid membrane and the two hydrophobic pockets connected to form a V shape and located at the bottom of a large cavity for IMN binding.
The PTGES2 protein functions as one step of the PG synthesis pathway, which forms a component of the overall lipid synthesis mechanism in the human body. The activity of PTGES2 is thought to be increased in the presence of sulfhydryl compounds, in particular dithiothreitol.
Model organisms have been used in the study of PTGES2 function. A conditional knockout mouse line (Miller et al., 2010) was generated as part of the International Knockout Mouse Consortium program—a high-throughput mutagenesis project to generate and distribute animal models of disease to interested scientists—at the Sanger Institute (Collins et al., 2007; Dolgin, 2011). Male and female animals underwent a standardized phenotypic screen to determine the effects of deletion (Van et al., 2011). Twenty-two tests were carried out on mutant mice, but no significant abnormalities were observed (Gerdin, 2010).
As reported in fish, PTGES2s are involved in female reproduction, especially in follicular development and ovulation (Sun et al., 2006). In zebrafish, recent studies have shown that PGE2 is involved in regulation of oocyte maturation,ovulation (Lister and Van der Kraak, 2008, 2009) and gonad differentiation (Pradhan and Olsson, 2014, Biol Reprod). In contrast, studies in goldfish (Carassius auratus) have shown that PGE2 stimulates testosterone production in testis in vitro, suggesting that PGE2 may be involved in the control of steroidogenesis in the goldfish testis (Wade and Van der Kraak, 1993; Wade et al., 1994; Jørgensen et al., 2010).
Estuarine tapertail anchovy (Coilia nasus, junior synonym C. ectenes) is widely distributed in the Yangtze River, the coastal waters of China, Korea, and the Ariake Sound of Japan (Jiang et al., 2012). It is a commercially important species due to its nutritional value and is regarded as a delicacy. However, excessive fishing and changes in aquatic ecology have almost caused the extinction of the species in the middle reaches of the Yangtze River (Zhang et al., 2005; Yang et al., 2017). The ovary development of C. nasus is population-asynchronous (Xu et al., 2016), in which development is synchronous within individuals, but asynchronous between different individuals within the same population. This results in a complex population structure, with fish with different stages of ovary development present in the pond at the same time. Spawning thus occurs over a long period in C. nasus.
Multiple transcript variants have been found for this gene, but no orthologs have been reported. In C. nasus, two PTGES2s were found in the ovarian transcriptome, and after validation by amplification, these two transcripts were demonstrated to come from different genome loci, which are PTGES2 orthologs. Consequently, in this study, using molecular cloning, sequencing and differential expression of the two PTGES2 genes from C. nasus, we evaluated the expression during ovary development and spawning.
Materials and Methods
Experimental animals
Coilia nasus were adapted to a 7.0 m × 5.0 m × 1.0 m aquarium with a water temperature of 24.5 ± 1.0°C, pH 7.8, and dissolved oxygen concentration of 9.2 ± 0.5 mg O2/L dechlorinated and aerated water. Fish were fed twice daily, at 7:00 AM and 5:00 PM. At the start of the experiments all fish appeared healthy.
Cloning and sequencing of C. nasus PTGES2a and PTGES2b
Total RNA of C. nasus ovary was purified using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and treated with RNase-free DNase (Promega, Madison, WI, USA). First-strand cDNA was synthesized from RNA using Moloney murine leukaemia reverse transcriptase (TaKaRa Bio Inc., Shiga, Japan). Fragments of the PTGES2a and PTGES2b genes were identified in the ovarian transcriptome data. Primers were designed based on the identified sequences, and then amplified from C. nasus ovarian cDNA using the primer pairs refer to Table I. The genomic DNA of the PTGES2a and PTGES2b genes was amplified from its genomic DNA using the primer pair as above. The resulting fragments were separated on a 1.0% agarose gel and purified using the Axygen DNA gel extraction kit (Axygen, Union City, CA, USA). The purified fragments were cloned into the pMD-18T vector (TaKaRa) by the TA cloning strategy and sequenced (BGI, Shenzhen, China). The 3′ ends of the PTGES2a and PTGES2b cDNA were obtained using the rapid amplification of cDNA ends (RACE) approach (Zhuan Dao, Wuhan, China).
Table I.- Sequences of primers used in this study.
|
Primer |
Sequence |
Usage |
|
PTGES2a-1 |
GATGGATGGACTACAAGCATTTGACGA |
3'RACE |
|
PTGES2a-2 |
GAGAACACCAAGATCAAGCCCTGG |
3'RACE |
|
PTGES2b-1 |
CCATGCAGAAGGTGATCCGGGAGC |
3'RACE |
|
PTGES2b-2 |
ACTGATGATTTCAGCGCTGTGGA |
3'RACE |
|
153S |
AGGCACTGGGTGATGTTGAATGAG |
Forward primer for PTGES2b genomic DNA |
|
154S |
GGTTCCAGTAAAGTTCCCATTCTTGTTA |
Forward primer for PTGES2b genomic DNA |
|
155A |
TCATCAAATGCCTGTAGCCCCTC |
Reverse primer for PTGES2b genomic DNA |
|
156A |
GAAGAAGAACATTGTAAACGCTCCCAC |
Reverse primer for PTGES2b genomic DNA |
|
157S |
GCCAGGGTGATGGGATGTGC |
Forward primer for PTGES2a genomic DNA |
|
158S |
TTCTACCCACCAGCAACTCAACGA |
Forward primer for PTGES2a genomic DNA |
|
159A |
GGGCGTGCGGTAGACATTCG |
Reverse primer for PTGES2a genomic DNA |
|
160A |
CATAAACTTCCTGTGCTTGCCCA |
Reverse primer for PTGES2a genomic DNA |
|
167S |
TGATGTTGAATGAGATAGCCCTTGA |
Forward primer for PTGES2b RT-qPCR |
|
167A |
AAAAGCCAGTCATCTGCCCAA |
Reverse primer for PTGES2b RT-qPCR |
|
168S |
CATGCGGAAGGAAATTAAGTGGT |
Forward primer for PTGES2a RT-qPCR |
|
168A |
GTCGTTGAGTTGCTGGTGGGT |
Reverse primer for PTGES2a RT-qPCR |
|
42S |
TGATTGGGACTGGGGATTGAA |
Forward primer for 18sRNA RT-qPCR |
|
42A |
TAGCGACGGGCGGTGTGT |
Reverse primer for 18sRNA RT-qPCR |
Table II.- GenBank accession numbers of PTGES2 used in this study.
|
Protein |
Accession No. |
|
Homo sapiens PTGES2 |
13376617 |
|
Pan troglodytes PTGES2 |
350537055 |
|
Macaca mulatta PTGES2 isoform 2 |
297271234 |
|
Mus musculus PTGES2 |
260763900 |
|
Rattus norvegicus PTGES2 |
157822395 |
|
Danio rerio PTGES2 |
41053638 |
|
Salmo salar PTGES2 |
XP_013998234.1 |
|
Cynoglossus semilaevis PTGES2 isoform X2 |
XP_008333868.1 |
|
Cynoglossus semilaevis PTGES2 |
XP_008333867.1 |
|
Xiphophorus maculatus PTGES2 |
XP_014326022.1 |
|
Fundulus heteroclitus PTGES2 |
XP_012720762.1 |
|
Cyprinodon variegatus PTGES2 |
XP_015224766.1 |
|
Kryptolebias marmoratus PTGES2 |
XP_017283273.1 |
|
Poecilia formosa PTGES2 |
XP_007547493.1 |
|
Stegastes partitus PTGES2 |
XP_008285271.1 |
|
Austrofundulus limnaeus PTGES2 |
XP_013870069.1 |
|
Scleropages formosus PTGES2 |
KPP67828.1 |
|
Callorhinchus milii PTGES2 |
AFK11574.1 |
|
Salmo salar PTGES2 isoform X2 |
XP_014027157.1 |
|
Clupea harengus PTGES2 |
XP_012673252.1 |
|
Salmo salar PTGES2 isoform X1 |
XP_014027156.1 |
|
Sinocyclocheilus rhinocerous PTGES2 |
XP_016372450.1 |
|
Sinocyclocheilus anshuiensis PTGES2 |
XP_016315128.1 |
|
Sinocyclocheilus graham PTGES2 |
XP_016147256.1 |
|
Oreochromis niloticus PTGES2 |
XP_005451551.1 |
|
Pundamilia nyererei PTGES2 isoform X1 |
XP_005730632.1 |
|
Oreochromis niloticus PTGES2 |
XP_005451550.1 |
|
Neolamprologus brichardi PTGES2 |
XP_006797764.1 |
|
Pundamilia nyererei PTGES2 isoform X2 |
XP_005730633.1 |
|
Maylandia zebra PTGES2 |
XP_004555760.1 |
|
Haplochromis burtoni PTGES2 isoform X1 |
XP_005949007.1 |
|
Haplochromis burtoni PTGES2 isoform X2 |
XP_005949008.1 |
|
Nothobranchius furzeri PTGES2 isoform X1 |
XP_015815743.1 |
|
Nothobranchius furzeri PTGES2 isoform X2 |
XP_015815744.1 |
|
Larimichthys crocea PTGES2 |
XP_010748983.1 |
|
Takifugu rubripes PTGES2 |
XP_003974720.1 |
|
Astyanax mexicanus PTGES2 |
XP_007235931.1 |
Analysis of nucleotide and amino acid sequences
The nucleotide and predicted amino acid sequences of PTGES2a and PTGES2b were analyzed using DNA figures software (http://www.bio-soft.net/sms/index.html). The similarity of PTGES2s from C. nasus to PTGES2s from other organisms was analysed using the BLASTP search program (http://www.ncbi.nlm.nih.gov/blast). The domain structures were predicted using the SMART program (http://smart.embl-heidelberg.de/). The amino acid sequence was compared with those of PTGES2s from other species using CLUSTALX 1.83 (http://www.ebi.ac.uk/clustalW/) and GeneDoc (http://www.nrbsc.org/gfx/genedoc/). The phylogenetic tree was constructed using MEGA 3.1 (http://megasoftware.net; Table II).
mRNA expression profiles of PTGES2s in different tissues
For tissue distribution analysis of PTGES2s, total RNA was extracted from the gill, liver, spleen, kidney, head kidney, brain, ovary, testis and intestine from healthy C. nasus using TRIzol Reagent (Invitrogen). Samples of each tissue were obtained from five individuals and analyzed in triplicate to control for inter-individual differences.
First-strand cDNA was synthesized using the ReverTra Ace® qPCR RT kit (Toyobo, Japan), and Real Time - quantitative Polymerase Chain Reaction (RT-qPCR) was employed to detect the PTGES2s expression profiles using 18sRNA as the reference gene. The RT-qPCR primers as that in Table I, which shared similar Tm values and were designed to amplify fragments of 103 bp, 97 bp and 114 bp, respectively. Before the RT-qPCR, the primers efficiency for these genes have been validated. RT-qPCR was performed on the ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) using 2× SYBR green real-time PCR mix (TaKaRa). PCR amplification was performed using the following cycling parameters: 94°C for 2 min; followed by 40 cycles of 15 s at 94°C, 15 s at 60°C, and 45 s at 72°C. The expression of target genes was calculated as relative fold-changes with the 2−ΔΔCT method.
mRNA expression profiles of PTGES2s in ovary development and ovulation
Three 60.0 m × 20.0 m × 2.0 m ponds were each stocked with 1,000 juvenile C. nasus. The fish were acclimatised to the ponds for approximately 3 years before the experiments. The stocking density was 37.5 g/m2, and 71.0% of the fish survived until the end of the experiment. Seventy fish in each pond were euthanized to examine and analyse ovarian development. Ovaries of stage III, stage IV and stage V were removed, placed in liquid nitrogen, and stored at -80°C for subsequent analysis. The female fish used in current study were analyzed using histology (HE section) and scanning electron microscopy to determine stage III, IV, and V (Xu et al., 2016). The mean length (± standard error) was 286.76 ± 12.24 mm and the mean mass was 101.83 ± 12.82 g for all fish (n = 26) sampled in this experiment.
Another 70 sexually mature female and male fish were placed together into spawning ponds, and sampled at 0, 0.5, 8, and 16 h, five female fish at each sample point. First-strand cDNA synthesis and RT-qPCR were then carried out as described above. Samples of each tissue were obtained from five individuals and analyzed in triplicate to control for inter-individual differences.
Results
Cloning and sequence characterization of the PTGES2a and PTGES2b genes
The full length PTGES2a was 1,575 bp long and contained a 1,167-bp ORF that encoded a protein of 388 amino acids (Fig. 1). The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino acids (Fig. 2). The 5′ and 3′ untranslated regions were 402 bp and 326 bp, respectively. One polyadenylation signal (AATAAA) was present 14 nucleotides upstream of the poly(A) tail in both PTGES2a and PTGES2b genes (NCBI accession number: KY132103 and KY132104).
The PTGES2a gene is composed of seven exons and six introns. The full-length genomic DNA sequence of PTGES2b is 1,908 bp long. It is composed of six exons and five introns. All exon/intron junctions conform to the splicing consensus sequence (GT-donor/AG-acceptor) rule.
The PTGES2a protein was predicted to contain an SMR domain, a GST-N3 domain, a glutaredoxin domain, a leucine-rich repeat domain and a GST-C3 domain (Fig. 1). The PTGES2b protein was predicted to contain a glutaredoxin domain, a leucine-rich repeat domain and GST-C3 domain (Fig. 2).
Homology analysis of PTGES2s
The phylogenetic tree of the PTGES2s proteins consists of two major branches: PTGES from Homo sapiens, Macaca mulatta, Pan troglodytes, Mus musculus, Rattus norvegicus, Salmo salar isoform X1, S. salar isoform X2, Stegastes partitus, Fundulus heteroclitus, Oreochromis niloticus isoform X2, Larimicthys crocea, Astrofundulus limnaeus, Clupea harengus, Takifugu rubripes, Danio. rerio, Scleropages formosus, Sinocyclocheilus anshuiensis, Sinocyclocheilus grahami, Sinocyclocheilus rhinocerous, Nothobranchius furzeri isoform X1, Oreochromis niloticus isoform X1, Pundamilia nyererei isoform X2, Haplochromis burtoni isoform X2, Neolamprologus brichardi, Maylandia zebra, Callorhinchus milii, Astyanax mexicanus, Pundamilia nyererei isoform X1, H. burtoni isoform X1, N. furzeri isoform X2 clustered into the PTGES2a like subgroup, while PTGES from Cynoglossus semilaevis isform X2, Xiphophorus maculates, C. semilaevis isoform X1 and Cyprinodon variegates clustered into the PTGES2b subgroup (Fig. 3).
In order to compare the PTGES2a and PTGES2b sequence, multiple alignments were created using CLUSTALX. Identity of the PTGES2a deduced amino acid sequence was observed with those of homologs from other species: S. anshuiensis (72.2%), S. grahami (71.4%) and S. rhinocerous (72.0%). The PTGES2b deduced amino acid sequence showed identity with those of homologs from other species: C. semilaevis isoform X2 (53.3%), X. maculates (51.2%), C. semilaevis isoform X1 (52.9%) and C. variegates (51.2%). The similarity between PTGES2a and PTGES2b was 50.4%. There was no SMR domain or GST-N3 domain in PTGES2b (Fig. 4).
The three-dimensional structures of PTGES2a and PTGES2b are shown in Figure 5. The differences between the PTGES2a and PTGES2b structures were in the SMR and GST-N3 domains, which are involved in attachment to the lipid membrane, and are missing in PTGES2b.
Tissue expression profiles of PTGES2a and PTGES2b
The mRNA expression profiles of PTGES2a and PTGES2b transcripts were assessed in different tissues by RT-qPCR using 18sRNA as the reference gene. In healthy fish, PTGES2a was strongly expressed in the gills and liver, while expression was comparatively higher in the intestine, testis and muscle, and lower in the brain, spleen, head kidney, kidney and heart (Fig. 6A). PTGES2b was strongly expressed in the gills and testis, comparatively higher in the brain, liver, intestine and kidney, and lower in the spleen, head kidney, heart and muscle (Fig. 6A).
PTGES2a and PTGES2b responses to ovary development and spawning
The RT-qPCR results revealed that expression of PTGES2a gradually decreased from stage III to stage V, which showed 10.9- and 2.5-fold decreases compared to stage III. PTGES2b also decreased from stage III to stage V, which exhibited 4.9- and 3.2-fold decreases compared to stage III. Moreover, the expression of PTGES2a was significantly higher than that of PTGES2b (Fig. 6B, P<0.05).
In the spawning process, the expression of PTGES2a did not show any significant changes, remaining at low expression levels. In contrast, the expression of PTGES2b significantly increased during the spawning process, showing a 1.2-, 1.8- and 156.2-fold increase in expression after 0.5, 8 and 16 h of stimulation compared to controls (Fig. 6C).
Discussion
In this study, based on the ovary transcriptome data, two PTGES2-like sequences were identified and then the complete sequences were obtained by RACE. As recorded in GenBank, many species of fish expressed PTGES2 isoforms. In order to determine whether these two sequences were PTGES2 isoforms or orthologs, the genomic DNA sequences were amplified in the genome. The results showed that the two PTGES2 cDNAs were not isoforms, but rather they were orthologs. Consequently these genes were named PTGES2a and PTGES2b.
Most of the reported sequences showed greater similarity to PTGES2a; only those of C. semilaevis isoform X2, X. maculates, C. semilaevis isoform X1 and C. variegates were similar to PTGES2b (Fig. 3). When their secondary structure was compared, the results showed that the SMR domain and the GST-N3 domain were only found in PTGES2a (Fig. 4). The SMR domain is an approximately 90-residue which is a hydrophobic domain. This domain could assist the protein associated with the Golgi membrane (Murakami et al., 2003; Moreira and Philippe, 1999), so missing this domain make PTGES2b cannot bind to membrane. As a result, PTGES2b could be a cytosolic protein, while PTGES2a is a membrane associated protein. In eukaryotes, GST domains are often contained in glutathione S-transferases (GSTs), which participate in the detoxification of reactive electrophillic compounds by catalysing their conjugation to glutathione (Morgenstern, 2005; Josephy, 2010). The GST domain is also found in S-crystallins from squid, and proteins with no known GST activity, such as the eukaryotic elongation factors 1-gamma and the HSP26 family of stress-related proteins, which include auxin-regulated proteins in plants and stringent starvation proteins in Escherichia coli (Armstrong, 1997; Eaton and Bammler, 1999; Galina-Polekhina et al., 2001). A mutagenesis study indicates that Cys110-X-X- Cys110 in GST-N3 domain is essential for the enzymatic activity, missing this domain could decrease the enzymatic activity in Bos taurus (Tanikawa et al., 2002). But its activity could activated by various SH-reducing reagents, such as dithiothreitol, GSH and β- mercaptoethanol (Watanabe et al., 2003). In summary, the protein structure indicates that PTGES2a could bind to membrane, and its activity is independent SH-reducing reagents. While PTGES2b is a cytosolic protein and its activity is dependent on SH-reducing reagents. As the reported in human, PGE2 synthesized by cytosolic PTGES2 tended to act on reproductive processes (Murakami and Kudo, 2006), so we speculate that PTGES2b in Coilia nasus may be highly expressed in reproductive tissue.
Consistent with our sequence analysis result, PTGES2a was found to be highly expressed in the gills and liver, but PTGES2b was strongly expressed in the gills and testis. Moreover, the expression of the two genes showed significant differences in the gills, brain, liver, intestine, kidney, muscle and testis. Previous reported studies have revealed that PTGES2 is highly expressed in the brain and liver of Mus musculus and Homo sapiens (Toshiya et al., 1987; Kosaka et al., 1994; Tanikawa et al., 2002; Yang et al., 2006). The pattern of PTGES2a in this study was more consistent with this finding.
Ovary development can be defined as an oocyte maturation process. In this process, a set of nuclear, cytoplasmic and molecular changes occur that enables the oocyte to be fertilized normally (Kane, 2003; Gilchrist and Thompson, 2007). Prostaglandins are biologically-active lipid mediators that are involved in the regulation of many reproductive events such as ovulation, corpus luteum regression, implantation and establishment of pregnancy (Karim and Hillier, 1979). The key regulatory step in PG biosynthesis is the enzymatic conversion of the fatty acid precursor by PG endoperoxide synthase, PTGS1 and PTGS2, into PGG. This is then reduced to an unstable endoperoxide intermediate, PGH, and sequentially metabolized by cell-specific isomerases (PGE synthases (PTGES) or PGF synthases (PTGFS)) to produce PGE or PGF, respectively (Wang and Dey, 2005). Then PGE2 mediates oocyte maturation and even subsequent early embryo development. In this study, expression of PTGES2a and PTGES2b was highest in stage III, then gradually declined in stage IV, and decreased to its lowest level in stage V. This result is consistent with that in cattle. The reported study also revealed the dynamics of PTGS2 gene expression during oocyte maturation. Basal expression of PTGS2 stayed at a high level during early oocyte development, then declined during the middle oocyte development stage and remained unchanged at the oocyte stage (Marei et al., 2014). These results suggest that PTGES2a may play a more important role in the early stage of oocyte development.
In the ovulation process, there is no significant change in the expression of PTGES2a, but the expression of PTGES2b is significantly increased. These results suggest that there are some functional differences between PTGES2a and PTGES2b in the ovulation process. As mentioned above, PTGES2a and PTGES2b both play important roles in early oocyte development, but PTGES2b also takes part in ovulation; however this issue requires further study.
Acknowledgments
This work was supported by a grant from the Special Fund of the Chinese Central Government for Basic Scientific Research Operations in Commonwealth Research Institutes (2017JBFM14), the Three New Projects of Agricultural Aquaculture Program of Jiangsu Province (D2015-14), and the Jiangsu Province Scientific and Technological Achievements special fund project (BA2015167).
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Armstrong, R.N., 1997. Structure, catalytic mechanism, and evolution of the glutathione transferases. Chem. Res. Toxicol., 10: 2-18. https://doi.org/10.1021/tx960072x
Collins, F.S., Rossant, J. and Wurst, W., 2007. A mouse for all reasons. Cell, 128: 9-13. https://doi.org/10.1016/j.cell.2006.12.018
Dolgin, E., 2011. Mouse library set to be knockout. Nature, 474: 262-263. https://doi.org/10.1038/474262a
Eaton, D.L. and Bammler, T.K., 1999. Concise review of the glutathione S-transferases and their significance to toxicology. Toxicol. Sci., 49: 156-164. https://doi.org/10.1093/toxsci/49.2.156
Galina, P., Philip, G.B., Anneke, C.B. and Michael, W.P., 2001. Crystal structure of maleylacetoacetate isomerase/glutathione transferase zeta reveals the molecular basis for its remarkable catalytic promiscuity. Biochemistry, 40: 1567-1576. https://doi.org/10.1021/bi002249z
Gerdin, A.K., 2010. The sanger mouse genetics programme: High throughput characterisation of knockout mice. Acta Ophthalmol., 89: 10-20. https://doi.org/10.1111/j.1755-3768.2010.4142.x
Gilchrist, R.B. and Thompson, J.G., 2007. Oocyte maturation: Emerging concepts and technologies to improve developmental potential in vitro. Theriogenology, 67: 6-15. https://doi.org/10.1016/j.theriogenology.2006.09.027
Jørgensen, A., Nielsen, J.E., Nielsen, B.F., Morthorst, J.E., Bjerregaard, P. and Leffers, H., 2010. Expression of prostaglandin synthases (pgds and pges) during zebrafish gonadal differentiation. Comp. Biochem. Physiol. Part A: Mol. Integr. Physiol., 157: 102-108. https://doi.org/10.1016/j.cbpa.2010.03.014
Jiang, T., Yang, J., Liu, H. and Shen, X.Q., 2012. Life history of Coilia nasus from the Yellow Sea inferred from otolith Sr:Ca ratios. Environ. Biol. Fish., 95: 503-508. https://doi.org/10.1007/s10641-012-0066-6
Josephy, P.D., 2010. Genetic variations in human glutathione transferase enzymes: Significance for pharmacology and toxicology. Human Genom. Proteom., 2010: 876940-876940. https://doi.org/10.4061/2010/876940
Kane, M.T., 2003. A review of in vitro gamete maturation and embryo culture and potential impact on future animal biotechnology. Anim. Reprod. Sci., 79: 171-190. https://doi.org/10.1016/S0378-4320(03)00164-7
Karim, S.M. and Hillier, K., 1979. Prostaglandins in the control of animal and human reproduction. Br. med. Bull., 35: 173-180. https://doi.org/10.1093/oxfordjournals.bmb.a071566
Kosaka, T., Miyata, A., Ihara, H., Hara, S., Sugimoto, T., Takeda, O., Takahashi, E. and Tanabe, T., 1994. Characterization of the human gene (PTGS2) encoding prostaglandin-endoperoxide synthase 2. Eur. J. Biochem., 221: 889-897. https://doi.org/10.1111/j.1432-1033.1994.tb18804.x
Lister, A.L. and van der Kraak, G.J., 2008. An investigation into the role of prostaglandins in zebrafish oocyte maturation and ovulation. Gen. Comp. Endocrinol., 159: 46-57. https://doi.org/10.1016/j.ygcen.2008.07.017
Lister, A.L. and van der Kraak, G.J., 2009. Regulation of prostaglandin synthesis in ovaries of sexually-mature zebrafish (Danio rerio). Mol. Reprod. Develop., 76: 1064-1075. https://doi.org/10.1002/mrd.21072
Marei, W.F., Abayasekara, D.R., Wathes, D.C. and Fouladinashta, A.A., 2014. Role of PTGS2-generated PGE2 during gonadotrophin-induced bovine oocyte maturation and cumulus cell expansion. Reprod. Biomed. Online, 28: 388-400. https://doi.org/10.1016/j.rbmo.2013.11.005
Mattila, S., Tuominen, H., Koivukangas, J. and Stenbäck, F., 2009. The terminal prostaglandin synthases mPGES-1, mPGES-2, and cPGES are all overexpressed in human gliomas. Neuropathology, 29: 156-165. https://doi.org/10.1111/j.1440-1789.2008.00963.x
Miller, F.P., Vandome, A.F. and Mcbrewster, J., 2010. International knockout mouse consortium. Alphascript Publishing.
Moreira, D. and Philippe, H., 1999. SMR: A bacterial and eukaryotic homologue of the C-terminal region of the MutS2 family. Trends Biochem. Sci., 24: 298-300. https://doi.org/10.1016/S0968-0004(99)01419-X
Morgenstern, R., 2005. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol., 45: 383-402.
Murakami, M., Nakashima, K., Kamei, D., Masuda, S., Ishikawa, Y., Ishii, T., Ohmiya, Y., Watanabe, K. and Kudo, I., 2003. Cellular prostaglandin E2 production by membranebound prostaglandin E synthase-2 via both cyclooxygenases-1 and -2. J. biol. Chem., 278: 37937-37947. https://doi.org/10.1074/jbc.M305108200
Pradhan, A. and Olsson, P.E., 2014. Juvenile ovary to testis transition in zebrafish involves inhibition of Ptges1. Biol. Reprod., 91: 1-15. https://doi.org/10.1095/biolreprod.114.119016
Sun, T., Deng, W.B., Diao, H.L., Ni, H., Bai, Y.Y., Ma, X.H., Xu, L.B. and Yang, Z.M., 2006. Differential expression and regulation of prostaglandin E synthases in the mouse ovary during sexual maturation and luteal development. J. Endocrinol., 189: 89-101. https://doi.org/10.1677/joe.1.06147
Tanikawa, N., Ohmiya, Y., Ohkubo, H., Hashimoto, K., Kangawa, K., Kojima, M., Ito, S. and Watanabe, K., 2002. Identification and characterization of a novel type of membrane-associated prostaglandin E synthase. Biochem. biophys. Res. Commun., 291: 884-889. https://doi.org/10.1006/bbrc.2002.6531
Toshiya, O., Mayumi, U. and Shuh, N., 1987. Purification and properties of prostaglandin H-E isomerase from the cytosol of human brain: Identification as anionic forms of glutathione S transferase. J. Neurochem., 48: 900-909. https://doi.org/10.1111/j.1471-4159.1987.tb05602.x
Vander W.L., White, J.K., Adams, D.J. and Logan, D.W., 2011. The mouse genetics toolkit: Revealing function and mechanism. Genome Biol., 12: 224. https://doi.org/10.1186/gb-2011-12-6-224
Wade, M.G. and van der Kraak, G., 1993. Arachidonic acid and prostaglandin E2 stimulate testosterone production by goldfish testis in vitro. Gen. Comp. Endocrinol., 90: 109-118. https://doi.org/10.1006/gcen.1993.1065
Wade, M.G., van der Kraak, G., Gerrits, M.F. and Ballantyne, J.S., 1994. Release and steroidogenic actions of polyunsaturated fatty acids in the goldfish testis. Biol. Reprod., 51: 131-139. https://doi.org/10.1095/biolreprod51.1.131
Wang, H. and Dey, S.K., 2005. Lipid signaling in embryo implantation. Prostagl. Other Lipid Mediat., 77: 84-102. https://doi.org/10.1016/j.prostaglandins.2004.09.013
Watanabe, K.H., Niwa, H., Tanikawa, N., Koda, N., Ito, S. and Ohmiya, Y., 2003. Essential 110Cys in active site of membrane-associated prostaglandin E synthase-2. Biochem. biophys. Res. Commun., 306: 577-581. https://doi.org/10.1016/S0006-291X(03)01025-8
Xu, G., Du, F., Li, Y., Nie, Z. and Xu, P., 2016. Integrated application of transcriptomics and metabolomics yields insights into population-asynchronous ovary development in Coilia nasus. Scient. Rep., 6: 31835. https://doi.org/10.1038/srep31835
Yamada, T., Komoto, J., Watanabe, K., Ohmiya, Y. and Takusagawa, F., 2005. Crystal structure and possible catalytic mechanism of microsomal prostaglandin E synthase type 2 (mPGES-2). J. mol. Biol., 348: 1163-1176. https://doi.org/10.1016/j.jmb.2005.03.035
Yang, G., Chen, L., Zhang, Y., Zhang, X., Wu, J., Li, S., Wei, M., Zhang, Z., Breyer, M.D. and Guan, Y., 2006. Expression of mouse membrane-associated prostaglandin E2 synthase-2 (mPGES-2) along the urogenital tract. Biochim. biophys. Acta, 1761: 1459-1468. https://doi.org/10.1016/j.bbalip.2006.06.018
Yang, S., Du, F. and Xu, P., 2017. Characterization, tissue-specific and developmental stage expression of somatostatin in Coilia nasus. Pakistan. J. Zool., 49: 243-250. https://doi.org/10.17582/journal.pjz/2017.49.1.243.250
Zhang, M., Xu, D., Liu, K. and Shi, W., 2005. Studies on biological characteristics and change of resource of Coilia nasus Schlegel in the lower reaches of the Yangtze River. Resour. Environ. Yangtze Basin, 14: 693-698.