The Phylogenetic Relationships among Some Common Species of Amblyseiinae (Acari: Phytoseiidae) in China Orchard Based on the Mitochondrial CO1 Gene
Zhiwen Zou, Jianfei Xi, Fen Chen, Rui Xu, Tianrong Xin and Bin Xia*
College of Life Science, Nanchang University, Nanchang 330031, China
ABSTRACT
Amblyseiinae is the largest subfamily in Phytoseiidae, with more than 1,500 nominal species. However, the relationships of this subfamily was confused. In order to improve the classification system of Amblyseiinae, the mitochondrial CO1 gene sequence of seven Amblyseiinae species, collected from four provinces of China, were sequenced, and another seven Amblyseiinae species mt CO1 gene sequenced were download from GenBank. And the phylogenetic relationship between the Amblyseiinae genus and the subspecies was studied. The results showed that four species of Kampimodromus and two species of Euseius clustered into two different branches, but the branch of 8 species of Amblyseius and Neoseiulus was chaotic. It indicated that the species of Neoseiulus and Amblyseius should be assigned carefully. The results could not only reveal its phylogenetic relationship and provide molecular evidence for the evolution, but also provide a better way to identify phytoseiid species in citrus.
Article Information
Received 28 November 2017
Revised 01 March 2018
Accepted 24 April 2018
Available online 11 March 2019
Authors’ Contribution
BX designed the study. ZZ and JX carried out experiments and drafted the manuscript. FC and RX helped in sequencing. TX revised the manuscript.
Key words
Amblyseiinae mites, Mitochondrial CO1 gene, Phylogenetic relationships, Geographical populations, Classification system.
DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.2.763.772
* Corresponding author: [email protected]
0030-9923/2019/0002-0763 $ 9.00/0
Copyright 2019 Zoological Society of Pakistan
Introduction
China is an important source area of citrus, with many cultivars, such as Citrus unshiu, C. kinokuni, C. junos, C. ichangensis, C. sinensis, etc., being native to Southern China. Citrus are widely cultivated along the Jiangxi province, making it the largest producer of citrus in China (Ammerman et al., 1965).
Due to the rapid propagation and strong adaptability, agricultural pest mites have been a serious threat to citrus fruit, decreasing the quality and yield of crops (Xin, 1988). However, the widespread use of synthetic chemicals to control these arthropod pests indirectly results in death for a large number of their natural enemies. This diminishes the success of natural enemies as a natural means of population suppression for harmful mite pests.
Amblyseiinae (Acari: Phytoseiidae) (Krantz, 1978) often lives with predatory mites and phytophagous spider mites, eriophyoid, tarsonemid, aphids, coccid, and so on. It is one of the common natural enemies of harmful mites, and widely used as biological control agents (Wu et al., 2009; Xu et al., 2010). The artificial breeding and industrial production of some phytoseiid mites (such as Phytoseiulus persimilis Athias-Henriot, Neoseiulus fallacis Garman, Neoseiulus cucumeris Oudemans, Neoseiulus barkeri Hughes, Amblyseius eharai Amitai et Swirski, etc.) has been achieved (Mailloux et al., 2010). However, the phylogenetic system of phytoseiid has not been perfected, and the classification system of phytoseiini mites, especially the subfamily Amblyseiinae, is still unclear.
Amblyseiinae is the largest subfamily in Phytoseiidae, with more than 1,500 nominal species. The first described species of Phytoseiidae was Zercon obtusus Koch (Koch, 1839), which was named with Amblyseius obtusus. Amblyseius was first established as a genus in 1914, but was not initially accepted by many scholars (Berlese, 1914). Oudemans (1936) placed those species originally described by Berlese (1914) into Tyohlodromus. Vitzthum (1941) built the classification system of phytoseiini mites. Since that, Phytoseiini taxonomists confirmed Amblyseius and placed the species have setae Z2, Z4, Z1, S2, S4 and S5 short/minute, approximately subequal into this genus. Later, the subfamily Amblyseiinae was first built in 1961 and included 19 genera (Muma, 1961). This divided Phytoseiidae into 3 subfamilies: Phytoseiinae, Typhlodrominae and Amblyseiinae (Chant and McMurtry, 1994). A series of detailed reviews about Amblyseiinae (Chant and McMurtry, 2003a, b, 2004a, b, 2005a, b, c, 2006a, b) emerged from 2003 to 2006, which cataloged and/or described 1,499 species in 61 genera and 9 tribes.
Sequences of multiple genes or genomes have been used in phylogenetic studies in recent years and provided insights into the higher-level relationships in insects (Misof et al., 2014). Mitochondrial genomes, usually 16 kb in size with 37 genes for animals (Boore, 1999; Guo et al., 2017), have been shown to be a useful marker for inferring higher-level phylogeny (Bourguignon et al., 2015; Li et al., 2015).
In the past decade, the phylogeny of various mite groups has been studied using molecular markers such as mitochondrial (mt) gene (Dabert, et al., 2010), mt genome (Chen et al., 2014; Gu et al., 2014) and nuclear gene sequences (Kreipe et al., 2015; Pepato and Klimov, 2015). In this study, in order to improve the classification system of Amblyseiinae, the mitochondrial CO1 gene sequence of seven Amblyseiinae species, collected from four provinces of China, were sequenced. In addition, the phylogenetic relationship between the Amblyseiinae genus and the subspecies was studied. The results could not only reveal its phylogenetic relationship and provide molecular evidence for the evolution, but also provide a better way to identify phytoseiid species in citrus.
Materials and methods
Sample collection and identification
Seventeen geographic populations in Amblyseiinae were collected from Jiangxi, Guangdong, Hunan province, and Shanghai city, respectively (Table I; Fig. 1). Samples of each site were mounted as vouchers, using modified Berlese medium (Amrine and Manson, 1996) for morphological checking with a Zeiss A2 (microphoto camera AxioCam MRc) microscope. All of the specimens and vouchers were deposited in Department of Ecology, Nanchang University, China. Other samples were preserved in 70% ethanol at -20°C until DNA extraction.
Table I.- Sampled taxa for sequenced mt CO1 gene.
|
Families |
Genus |
Species |
Location |
Host |
Code |
|
Amblyseiinae |
Amblyseius |
A. eharai |
Nanchang, Jiangxi |
Citrus |
AE1 |
|
Xingan, Jiangxi |
Tangerine |
AE2 |
|||
|
Taihe, Jiangxi |
Kumquat |
AE3 |
|||
|
Yongxiu, Jiangxi |
Citrus |
AE4 |
|||
|
Guangzhou, Guangdong |
Citrus |
AE5 |
|||
|
Shanghai |
Citrus |
AE6 |
|||
|
Changsha, Hunan |
Citrus |
AE7 |
|||
|
Sihui, Guangzhou |
Citrus |
AE8 |
|||
|
Euseius |
E. nicholsi |
Nanchang, Jiangxi |
Citrus |
EN1 |
|
|
Changsha, Hunan |
Citrus |
EN2 |
|||
|
Guangzhou, Guangdong |
Citrus |
EN3 |
|||
|
A. orientalis |
Nanchang, Jiangxi |
Citrus |
AO1 |
||
|
Xingan, Jiangxi |
Chinese honey orange |
AO2 |
|||
|
N. cucumeris |
Guangzhou, Guangdong |
Citrus |
NC |
||
|
Scapulaseius |
S. asiaticus |
Nanxiong, Guangdong |
Osmanthus fragrans |
SA |
|
|
A. tsugawai |
Jing 'an, Jiangxi |
Citrus |
AT |
||
|
Neoseiulus |
N. barkeri |
Ganzhou, Jiangxi |
Navel orange |
NB |
Data collection
The mt genome sequences of seven species of Amblyseiinae and one outgroup species were retrieved from GenBank (Table II). The dataset includes four Kampimodromus, three Neoseiulus, and one Euseius mite species. The Metaseiulus occidentalis was used as outgroup.
Table II.- Sequences data for mt CO1 gene of some Amblyseiinae from GenBank.
|
Families / Genus |
Species |
Accession |
Code |
|
|
Amblyseiinae |
||||
|
Kampimodromus |
K. corylosus |
EF372610 |
KC |
|
|
K. aberrans |
EF372606 |
KA |
||
|
K. langei |
EF372609 |
KL |
||
|
K. ericinus |
EF372607 |
KE |
||
|
Neoseiulus |
N. womersleyi |
AB500133 |
NW |
|
|
N. californicus |
AB500131 |
NCA |
||
|
Euseius |
E. finlandicus |
FJ404592 |
EF |
|
|
Phytoseiinae |
||||
|
Metaseiulus |
M.occidentalis |
EF221760 |
MO |
|
DNA extraction, gene amplification and sequencing
The total DNA was extracted from a single adult mite using the improved Chelex-100 (Walsh et al., 1991). A 453-bp fragment of COI was initially amplified by PCR with the primer pair (Navajas et al., 1996), 5’- TGATTTTTTGGTCACCCAGAAG -3’ and 5’-TACAGCTCCTATAGATAAAAC -3’, then sequenced on an Illumina Hiseq 2000 platform at the Beijing Genomics Institute, Beijing.
Short PCRs were performed in 25-μL reactions containing: 2.5 μL of 10 × Buffer (Mg 2+ Free), 2.5 μL of MgCl2 (25mmol/L), 1.0 μL of dNTPs Mixture (10mmol/L), 1.0 μL of each primer(10mmol/L), 0.4 μL of Taq DNA polymerase (5U/μL), 5.0 μL of template DNA, and 11.6 μL water. PCR cycling conditions were: 5 min denaturation at 95 °C; 30 cycles of 1 min denaturation at 95 °C, 45 s annealing at 45 °C and 1 min extension at 72 °C; 5 min final extension at 72 °C; and then held at 4 °C. After amplification, 5 μL of the PCR reaction was analyzed by electrophoresis on a 1% agarose gel and visualized by GelRed staining. The PCR product was purified, then the strand of the amplified fragments CO1 were sequenced by Beijing Tiangen, Beijing.
Sequence and phylogenetic analyses
The DNAStar (Lasergene, v.7.1.0) was used for editing and assembling the raw data into sequence contigs. The fragment gene of mt CO1, was identified by BLASTn searches of NCBI based on highly conserved sequence motifs. Sequences obtained and cited from others published data were aligned using CLUSTAL W and numbers or parsimony-informative sites were calculated using MEGA5 software (Thompson et al., 1994). The base composition, nucleotide differences, transformation and transversion, genetic distance, etc. of the sequence were analyzed. All of the above analyses of the CO1 sequences were conducted using MEGA version 5 software (Tamura et al., 2011).
Phylogenetic analysis using the CO1 DNA fragment data was conducted using the Bayesian tree estimate methods and the Maximum likelihood (ML) method with 1,000 bootstrap replicates. Sequences for Metaseiulus occidentalis was used as a single outgroup. Maximum likelihood (ML) trees of the mt DNA genes was constructed with Paup* (v.4. ob.10; Swofford, 2002). The default parameters were used and the confidence values of the ML tree were evaluated via a bootstrap test with 1000 iterations (Felsenstein, 1985). Nodes supported by bootstrap values (BSP) ≥ 70% were considered strongly supported (Hillis and Bull, 1993). The Bayesian inference (BI) analysis using MrBayes version 3.12 (Ronquist and Huelsenbeck, 2003) was conducted using phylogeny. The dataset was run for 3 million generations, with tree sampled every 100 generations. After 2.5 million generations, the average standard deviation was below 0.01 in most Bayesian trees. The consensus tree was edited with FigTree1.4.0. Nodes supported by posterior probabilities (BPP) P 95% were considered strongly supported.
Results
mt CO1 gene sequence
The CO1 sequence of seven species in Amblyseiinae were sequenced in this study. All sequences were 453 bp long. The base compositions are shown in Tables III and IV. In the 17 geographic populations, average content of T (42.4%) is the most abundant. C content is the lowest (13.4.0%), and T content of SA (45.9%) is the highest while that of NB is the lowest (37.1%). C content ranges from 18.3% (NB) to 18.7% (NC). A+T content is higher than 70% within 8 AE geographic populations (AE1~AE8), and is less than 70% in the others, which shows a difference in different geographic populations.
Sequence variable sites
The 242 conservative sites, 211 variable sites and 173 parsimony informative sites were detected in the CO1 gene fragment of 14 species in Amblyseiinae, while 262 conservative sites, 191 variable sites and 150 parsimony informative sites were detected in 7 species of this study.
There were 411 conservative sites, 42 variable sites and 9 parsimony informative sites, among 8 geographic populations of AE (AE1 ~ AE8); 427 conservative sites, 26 variable sites and no parsimony informative site for the three geographic populations of EN (EN1~EN3); 443 conservative sites, 10 variable sites and no parsimony informative site detected for 2 geographic populations of AO.
Table III.- The content of COI gene of seven species in Amblyseiinae.
|
Species* |
COI |
|||||
|
T/% |
C/% |
A/% |
G/% |
A+T/% |
Total |
|
|
AE1 |
41.3 |
15.0 |
29.8 |
13.9 |
71.1 |
453.0 |
|
AE2 |
41.7 |
14.6 |
30.2 |
13.5 |
71.9 |
453.0 |
|
AE3 |
41.3 |
15.0 |
30.0 |
13.7 |
71.3 |
453.0 |
|
AE4 |
41.9 |
14.3 |
30.0 |
13.7 |
71.9 |
453.0 |
|
AE5 |
41.5 |
13.9 |
30.7 |
13.9 |
72.2 |
453.0 |
|
AE6 |
41.9 |
14.3 |
30.2 |
13.5 |
72.1 |
453.0 |
|
AE7 |
41.9 |
14.3 |
29.6 |
14.1 |
71.5 |
453.0 |
|
AE8 |
41.5 |
13.9 |
29.8 |
14.8 |
71.6 |
453.0 |
|
EN1 |
43.3 |
11.9 |
26.0 |
18.8 |
69.3 |
453.0 |
|
EN2 |
44.2 |
11.5 |
25.4 |
19.0 |
69.6 |
453.0 |
|
EN3 |
42.8 |
12.4 |
26.0 |
18.8 |
68.8 |
453.0 |
|
AO1 |
43.0 |
11.5 |
26.0 |
19.4 |
69.0 |
453.0 |
|
AO2 |
42.8 |
11.7 |
26.0 |
19.4 |
68.8 |
453.0 |
|
NC |
44.2 |
11.3 |
25.4 |
19.2 |
69.6 |
453.0 |
|
SA |
45.9 |
11.7 |
23.6 |
18.8 |
69.5 |
453.0 |
|
AT |
43.3 |
13.2 |
26.3 |
17.2 |
69.6 |
453.0 |
|
NB |
37.1 |
18.3 |
29.8 |
14.8 |
66.9 |
453.0 |
|
Avg. |
42.4 |
13.4 |
27.8 |
16.4 |
70.2 |
453.0 |
*For full names of species, see Table I and II.
Table IV.- Nucleotides composition of COI gene partial sequences of the 17 populations in Amblyseiinae.
|
Species |
First base frequency (%) |
Second base frequency (%) |
Third base frequency (%) |
||||||||||||
|
T-1 |
C-1 |
A-1 |
G-1 |
Pos#1 |
T-2 |
C-2 |
A-2 |
G-2 |
Pos#2 |
T-3 |
C-3 |
A-3 |
G-3 |
Pos#3 |
|
|
AE1 |
37 |
10.5 |
32.9 |
19.7 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
43 |
13.9 |
40.4 |
2.6 |
151.0 |
|
AE2 |
37 |
10.5 |
32.9 |
19.7 |
152.0 |
44 |
20.7 |
16.7 |
18.7 |
150.0 |
44 |
12.6 |
41.1 |
2.0 |
151.0 |
|
AE3 |
37 |
10.5 |
32.9 |
19.7 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
43 |
13.9 |
41.1 |
2.0 |
151.0 |
|
AE4 |
38 |
9.9 |
32.9 |
19.7 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
44 |
12.6 |
41.1 |
2.0 |
151.0 |
|
AE5 |
39 |
8.6 |
32.2 |
20.4 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
42 |
12.6 |
43.7 |
2.0 |
151.0 |
|
AE6 |
38 |
9.9 |
32.9 |
19.7 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
44 |
12.6 |
41.7 |
1.3 |
151.0 |
|
AE7 |
38 |
9.2 |
32.2 |
20.4 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
44 |
13.2 |
40.4 |
2.6 |
151.0 |
|
AE8 |
39 |
8.6 |
32.2 |
20.4 |
152.0 |
44 |
20.7 |
16.0 |
19.3 |
150.0 |
42 |
12.6 |
43.7 |
2.0 |
151.0 |
|
EN1 |
33 |
9.9 |
31.6 |
25.7 |
152.0 |
43 |
21.3 |
15.3 |
20.0 |
150.0 |
54 |
4.6 |
31.1 |
10.6 |
151.0 |
|
EN2 |
35 |
7.9 |
31.6 |
25.7 |
152.0 |
43 |
21.3 |
15.3 |
20.0 |
150.0 |
54 |
5.3 |
29.1 |
11.3 |
151.0 |
|
EN3 |
34 |
8.6 |
31.6 |
25.7 |
152.0 |
43 |
21.3 |
15.3 |
20.0 |
150.0 |
51 |
7.3 |
31.1 |
10.6 |
151.0 |
|
AO1 |
34 |
8.6 |
32.2 |
25.0 |
152.0 |
44 |
20.7 |
14.7 |
20.7 |
150.0 |
51 |
5.3 |
31.1 |
12.6 |
151.0 |
|
AO2 |
34 |
8.6 |
32.2 |
25.0 |
152.0 |
43 |
21.3 |
14.7 |
20.7 |
150.0 |
51 |
5.3 |
31.1 |
12.6 |
151.0 |
|
NC |
36 |
7.2 |
28.9 |
28.3 |
152.0 |
44 |
20.7 |
15.3 |
20.0 |
150.0 |
53 |
6.0 |
31.8 |
9.3 |
151.0 |
|
SA |
35 |
10.5 |
28.9 |
25.7 |
152.0 |
45 |
20.0 |
15.3 |
20.0 |
150.0 |
58 |
4.6 |
26.5 |
10.6 |
151.0 |
|
AT |
36 |
7.9 |
31.6 |
24.3 |
152.0 |
44 |
21.3 |
16.0 |
18.7 |
150.0 |
50 |
10.6 |
31.1 |
8.6 |
151.0 |
|
NB |
27 |
15.1 |
36.2 |
21.7 |
152.0 |
43 |
21.3 |
16.7 |
18.7 |
150.0 |
41 |
18.5 |
36.4 |
4.0 |
151.0 |
|
Avg. |
35 |
9.6 |
32.1 |
22.9 |
152.0 |
44 |
20.9 |
15.7 |
19.6 |
150.0 |
48 |
9.9 |
35.6 |
6.5 |
151.0 |
*For full names of species, see Table I and II.
Genetic distance analysis
Genetic distance is shown in Table V. The results indicated that the intraspecific genetic distance ranged from 0.003 to 0.116 in 8 geographical populations of AE, of which had the smallest genetic distance was between AE2 and AE3, and AE2 and AE4, whereas the largest was between AE7 and AE8.
The intraspecific genetic distance ranged from 0.016 to 0.062 in 3 geographical populations of EN, of which the smallest genetic distance was between EN1 and EN3 and the largest one between EN2 and EN3. The intraspecific genetic distance between 2 geographical populations of AO was 0.015. The interspecific genetic distance between KC and KE was the smallest (0.119), whereas the largest was 0.429 between NCA and NW.
Phylogenetic tree
Figures 2 and 3 shoe that the topological structure of phylogenetic trees constructed based on the two different phylogenetic analyses are the same. Samples of Neoseiulus, Amblyseius, Scapulaseius, Kampimodromus and Euseius are isolated from the outgroup Metaseiulus occidentalis (statistical value is 0.98). Likewise, N. barkeri and N. womersleyi were recovered separate from the other taxa (statistical value is 0.59).
Table V.- Pairwise distances and transition/transversion (above the diagonal) based on COI gene.
Four species of Kampimodromus and two species of Euseius are clustered into two different branches. KC and KE, KL and KA had close genetic relationship in Kampimodromus, whereas SA had close genetic relationship with Neoseiulus and Amblyseius.
The branch of 8 species of Amblyseius and Neoseiulus was chaotic, in which NB clustered into a branch with NW and isolated with others. AT and NCA clustered into a branch firstly and then gathered together with AO. NC had close genetic relationship with SA. It was the same for the branch conditions of the phylogenetic trees constructed by ML analysis and BI analysis, the trend was generally consistent.
It could be known from the branch of 5 genera of ingroup that the geographic populations of AE (AE1~AE8), EN (EN1~EN3) and AO (AO1 and AO2) clustered into a clade, respectively. As the phylogenetic tree constructed based on 2 different methods revealed that within EN, EN1 had closer phylogenetic relationships with EN3 compared with the EN2. The phylogenetic relationship within 8 geographical population of AE, AE2, AE3 and AE4 are close in Jiangxi province.They are also close between AE5 and AE8 in Guangdong province.
Discussion and Conclusion
The different geographical populations of A. eharai, E. nicholsi and A. orientalis were showed a certain degree of genetic differentiation. Based on the genetic distances and phylogenetic trees, the phylogenetic relationships between the populations agreed with their geographic distribution. Many studies have shown that geologic diversity will result in significant genetic variation among different populations, especially in populations of Amblyseiinae, that lack strong migratory ability (Ma et al., 2010; Meng, 2008).
The precise identification in Phytoseiidae is difficult due to little effective morphological features required to distinguish the closely related species. Therefore, there is not a perfect classification system to date for the family, subfamily, or genus in Phytoseiidae which is recognized by most taxonomists (Athias-Henriot, 1977, 1978; Tsolakis et al., 2012).
Four species of Kampimodromus in this study have been clustered into one branch, as well as two species of Euseius, which fit their morphological system. The adscription of the classification of Amblyseius and Neoseiulus has, however, been confusing for a long time. The genera were erected in 1914 and 1948, respectively, but the researchers took a long time to accept these within the taxonomic community. Moreover, there were some taxonomists that had different opinions on the classification. Neoseiulus was topically merged into Amblyseius or another genus (Muma, 1961; Wainsstein, 1962; Schicha, 1987), but after the 1990s, Amblyseius and Neoseiulus were treated as two independent genera and eventually (Moraes et al., 2004) divided into different subtribes, Neoseiulini (Chant and McMurtry, 2003a) and Amblyseiini (Chant and McMurtry, 2004). Wu et al. (2010) did not adopt this system and instead divided Amblyseius into two subgenera, Amblyseius and Neoseiulus, respectively. For instance, N. barkeri was merged into Amblyseius (Wu, 1980a), then recombined with Neoseiulus (Wu, 1986). However, it was regarded as a member of two genera by different scholars at the same time (Chant and McMurtry, 2003; Wu et al., 2009). N. cucumeris was also rearranged several times, which was firstly placed into Amblyseius (Chant, 1959), then was divided into Typhlodromopsis (Muma, 1961), but later was replaced in Neoseiulus in 1986 (Moraes et al., 1986). A. tsugawai and A. orientalis followed the same process, from Amblyseius (Amblyseiinae) to Typhlodromus (Typhlodrominae) (Hirschmann, 1962), and then shifted back to Amblyseius again (Chant and McMurtry, 1994; Moraes et al., 1986). S. asiaticus was grouped with Typhlodromus (Evans, 1953), then to Amblyseius and Neoseiulus, and ultimately to Scapulaseius (Wu, 1980b; Wu et al., 2010). Similar to their complex morphological taxonomic relationship, the molecular evolutionary relationship was also unclear in the present paper. They did not cluster into single group. A. tsugawai, A. orientalis, S. asiaticus, N. cucumeris and N. californicus were clustered with three Euseius species, while N. womersleyi, N. barkeri and A. eharai were far away with other phytoseiid mites. Judging from our results, the species of Neoseiulus and Amblyseius should be assigned carefully. In fact, the two genera were differentiated only based on whether the length of Z5 seta was longer than the half width of dorsal plate or not (Wu et al., 2009). More molecular data would be helpful to distinguish the two genera.
Acknowledgement
The research was funded by the National Natural Science Foundation of China (31860601, 31460553), Natural Science Foundation of Jiangxi Province (20151BAB204016 and 20161BBF60066), funds from Jiangxi Food and Drug Administration (2017YX19) and Foundations from the Administration of Science and Technology in Nanchang City to Zhiwen Zou (2010NYZZ037, 2013HZCG008). We would like to thank Dr. Alexandra G Duffy (Brigham Young University, USA) for her support and comments on writing.
Statement of conflict of interest
Authors have declared no conflict of interest.
References
Ammerman, C.B., Hendrickson, R., Hall, G.M., Easley, J.F. and Loggins, P.E., 1965. The nutritive value of various fractions of citrus pulp and the effect of drying temperature on the nutritive value of citrus pulp. Proc. Fla. State Hort. Soc., 78: 307.
Amrine, J. and Manson, D., 1996. Preparation, mounting and descriptive study of eriophyoid mites. World Crop Pests, 6: 383-396. https://doi.org/10.1016/S1572-4379(96)80023-6
Athias-Henriot, C., 1977. Nouvelles notes sur les Amblyseiini III. Sur le genre Cydnodromus: Redéfinition, composition [Parasitiformes, Phytoseiidae]. BioControl, 22: 61-73.
Athias-Henriot, C., 1978. Définition deDictyonotus nov. gen., avec description de deux espèces nouvelles de France méridionale [Gamasides, Phytoseiidae]. Entomophaga, 23: 189-194. https://doi.org/10.1007/BF02371727
Boore, J.L., 1999. Animal mitochondrial genomes. Nucl. Acids Res., 27: 1767-1780. https://doi.org/10.1093/nar/27.8.1767
Bourguignon, T., Lo, N., Cameron, S.L., Šobotník, J., Hayashi, Y., Shigenobu, S., Watanabe, D., Roisin, Y., Miura, T. and Evans, T.A., 2015. The evolutionary history of termites as inferred from 66 mitochondrial genomes. Mol. Biol. Evolut., 32: 406-421. https://doi.org/10.1093/molbev/msu308
Chant, D.A., 1959. Phytoseiid mites (Acarina: Phytoseiidae). Mem. entomol. Soc. Canada, 91(S12): 5-166. https://doi.org/10.4039/entm9112fv
Chant, D.A. and McMurtry, J.A., 1994. A review of the subfamilies Phytoseiinae and Typhlodrominae (Acari: Phytoseiidae). Int. J. Acarol., 20: 223-310. https://doi.org/10.1080/01647959408684022
Chant, D.A. and Mcmurtry, J.A., 2003a. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part I. Neoseiulini new tribe. Int. J. Acarol., 29: 3-46. https://doi.org/10.1080/01647950308684319
Chant, D.A. and Mcmurtry, J.A., 2003b. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part II. The tribe Kampimodromini Kolodochka. Int. J. Acarol., 29: 179-224. https://doi.org/10.1080/01647950308684331
Chant, D.A. and Mcmurtry, J.A., 2004a. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part III. the tribe Amblyseiini Wainstein, subtribe Amblyseiina n. subtribe. Int. J. Acarol., 30: 171-228. https://doi.org/10.1080/01647950408684399
Chant, D.A. and Mcmurtry, J.A., 2004b. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): part IV. Tribe Amblyseiini Wainstein, subtribe Arrenoseiina Chant and McMurtry. Int. J. Acarol., 30: 291-312. https://doi.org/10.1080/01647950408684388
Chant, D.A. and Mcmurtry, J.A., 2005a. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part V. The tribe Amblyseiini Wainstein: Subtribe Proprioseiopsina Chant and McMurtry. Int. J. Acarol., 31: 3-22. https://doi.org/10.1080/01647950508684424
Chant, D.A. and Mcmurtry, J.A., 2005b. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part VI. The tribe Euseiini n. tribe, subtribes Typhlodromalina n. subtribe, Euseiina n. subtribe, and Ricoseiina n. subtribe. Int. J. Acarol., 31: 187-224. https://doi.org/10.1080/01647950508683673
Chant, D.A. and Mcmurtry, J.A., 2005c. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part VII. Typhlodromipsini n. tribe. Int. J. Acarol., 31: 315-340. https://doi.org/10.1080/01647950508684412
Chant, D.A. and Mcmurtry, J.A., 2006a. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part VIII. The tribes Macroseiini Chant, Denmark and Baker, Phytoseiulini, n. tribe, Afroseiulini, n. tribe, and Indoseiulini Ehara and Amano. Int. J. Acarol., 32: 13-25. https://doi.org/10.1080/01647950608684439
Chant, D.A. and Mcmurtry, J.A., 2006b. A review of the subfamily Amblyseiinae Muma (Acari: Phytoseiidae): Part IX. An overview. Int. J. Acarol., 32: 125-152. https://doi.org/10.1080/01647950608684453
Chen, D.S., Jin, P.Y., Zhang, K.J., Ding, X.L., Yang, S.X., Ju, J.F., Zhao, J.Y. and Hong, X.Y., 2014. The complete mitochondrial genomes of six species of Tetranychus provide insights into the phylogeny and evolution of spider mites. PLoS One, 9: e110625. https://doi.org/10.1371/journal.pone.0110625
Dabert, M., Witalinski, W., Kazmierski, A., Olszanowski, Z. and Dabert, J., 2010. Molecular phylogeny of acariform mites (Acari, Arachnida): Strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol. Phylogen. Evolut., 56: 222-241. https://doi.org/10.1016/j.ympev.2009.12.020
De Moraes, G.J., McMurtry, J.A., Denmark, H.A. and Campos, C.B., 2004. A revised catalog of the mite family Phytoseiidae. Zootaxa, 434: 1-494. https://doi.org/10.11646/zootaxa.434.1.1
Ehara, S., 1958. Three predatory mites of the genus Typhlodromus from Japan (Phytoseiidae). Annot. Zool. Japan, 31: 53-57.
Evans, G.O., 1953. On some mites of the genus Typhlodromus Scheuten, 1857, from S.E. Asia. Annls. Mag. Nat. Hist., 6: 449-467. https://doi.org/10.1080/00222935308654444
Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39: 783-791. https://doi.org/10.2307/2408678
Gu, X.B., Liu, G.H., Song, H.Q., Liu, T.Y., Yang G.Y. and Zhu, X.Q., 2014. The complete mitochondrial genome of the scab mite Psoroptes cuniculi (Arthropoda: Arachnida) provides insights into Acari phylogeny. Parasites Vectors, 7: 340. https://doi.org/10.1186/1756-3305-7-340
Guo, B.Y., Yu, C., Zhang, C., Lv, Z.M., Xu, K.D., Ping, H.L. and Shi, H.L., 2017. Characterization of complete mitochondrial genome and phylogeny of Sepia lycidas (Sepioidea, Sepiidae). Pakistan J. Zool., 50: 1497-1508. http://dx.doi.org/10.17582/journal.pjz/2018.50.4.1497.1508
Hillis, D.M. and Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System. Biol., 42: 182-192. https://doi.org/10.1093/sysbio/42.2.182
Hirschmann, W., 1962. Gangystematik der parasitiformes. Teil 1. Rumpfberhaarung und Ruckenflachen. Acarologie Schritenreihe fur Vergeichende Milbenkunde. Hirschmann, Furth/Bay, pp. 1-20.
Klompen, H., Lekveishvili, M. and Black, W.C., 2007. Phylogeny of parasitiform mites (Acari) based on rRNA. Mol. Phylogen. Evolut., 43: 936-951. https://doi.org/10.1016/j.ympev.2006.10.024
Krantz, G.W. and Walter, D.E. (eds.), 2009. A manual of acarology, 3rd edition. Texas Tech University Press.
Kreipe, V., Corral-Hernández, E., Scheu, S., Schaefer, I. and Maraun, M., 2015. Phylogeny and species delineation in European species of the genus Steganacarus (Acari, Oribatida) using mitochondrial and nuclear markers. Exp. appl. Acarol., 66: 173-186. https://doi.org/10.1007/s10493-015-9905-4
Li, H., Shao, R., Song, N., Song, F., Jiang, P., Li, Z. and Cai, W., 2015. Higher-level phylogeny of paraneopteran insects inferred from mitochondrial genome sequences. Scient. Rep., 5: 8527. https://doi.org/10.1038/srep08527
Ma, J., Li, T., Long, W.M., An, W.W., Guo, Y.P. and Ma, E.B., 2010. Genetic diversity of different geographical populations of oxya chinensis based on aflp analysis. Yi Chuan, 32: 163-169. https://doi.org/10.3724/SP.J.1005.2010.00163
Mailloux, J., Le Bellec, F., Kreiter, S., Tixier, M.S. and Dubois, P., 2010. Influence of ground cover management on diversity and density of phytoseiid mites (Acari: Phytoseiidae) in Guadeloupean citrus orchards. Exp. appl. Acarol., 52: 275-290. https://doi.org/10.1007/s10493-010-9367-7
Meng, X., 2008. Population genetic structure of Chilo suppresalisa (Walker) (Lepidoptera: Crambidae) in China inferred from microsatellile markers and mt DNA gene sequence. Zhejiang Univerist, Zhejiang, Hangzhou.
Misof, B., Liu, S., Meusemann, K., Peters, R.S., Donath, A., Mayer, C., Frandsen, P. B., Ware, J., Flouri, T. and Beutel, R.G., 2014. Phylogenomics resolves the timing and pattern of insect evolution. Science, 346: 763-767. https://doi.org/10.1126/science.1257570
Moraes, G.J.D., Mcmurtry J.A. and Denmark, H.A., 1986. A catalog of the mite family Phytoseiidae. References to taxonomy, synonymy, distribution and habitat. Empresa Brasileira de Pesquisa Agropecuaria, Bras’ilia.
Muma, M.H., 1961. Subfamilies, genera, and species of Phytoseiidae (Acarina: Mesostigmata). Bull. Fla. State Mus. Biol. Sci., 5: 267-302.
Murrell, A., Dobson, S.J., Walter, D.E., Campbell, N.J., Shao, R. and Barker, S.C., 2005. Relationships among the three major lineages of the Acari (Arthropoda: Arachnida) inferred from small subunit rRNA: Paraphyly of the Parasitiformes with respect to the Opilioacariformes and relative rates of nucleotide substitution. Inverteb. System., 19: 383-389. https://doi.org/10.1071/IS05027
Navajas, M., Gutierrez, J., Lagnel, J. and Boursot, P., 1996. Mitochondrial cytochrome oxidase I in tetranychid mites: a comparison between molecular phylogeny and changes of morphological and life history traits. Bull. entomol. Res., 86: 407-417. https://doi.org/10.1017/S0007485300034994
Oudemans, A., 1936. Neues über Anystidae (Acari). Arch. Naturgesch., 5: 364-446.
Pepato, A. and Klimov, P., 2015. Origin and higher-level diversification of acariform mites-evidence from nuclear ribosomal genes, extensive taxon sampling, and secondary structure alignment. BMC Evolut. Biol., 15: 178. https://doi.org/10.1186/s12862-015-0458-2
Ronquist, F. and Huelsenbeck, J.P., 2003 MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Schicha, E., 1987. Phytoseiidae of Australia and neighboring areas. Indira Publishing House, Bhopal, India.
Song, H., Sheffield, N.C., Cameron, S.L., Miller, K.B. and Whiting, M.F., 2010. When phylogenetic assumptions are violated: base compositional heterogeneity and among-site rate variation in beetle mitochondrial phylogenomics. System. Ent., 35: 429-448. https://doi.org/10.1111/j.1365-3113.2009.00517.x
Swofford, D.L., 2002. Paup: Phylogenetic analysis using parsimony (and other methods) 4.0. B5.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S., 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evolut., 28: 2731-2739. https://doi.org/10.1093/molbev/msr121
Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22: 4673-4680. https://doi.org/10.1093/nar/22.22.4673
Tsolakis, H., Tixier, M.S., Kreiter, S. and Ragusa, S., 2012. The concept of genus within the family Phytoseiidae (Acari: Parasitiformes): Historical review and phylogenetic analyses of the genus Neoseiulus Hughes. Zool. J. Linn. Soc., 165: 253-273. https://doi.org/10.1111/j.1096-3642.2011.00809.x
Vitzthum, H.G., 1941. Acarina in Bronn’s Klassen und Ordnungen des Tierreichs 5. Akad. Verlag, M.B.H., Leipzing, pp. 764-768.
Wainstein, B.A., 1962. Revision du genre Typhlodromus Sceuten, 1857 et systematique de la familie des Phytoseiidae (Berlese, 1916) (Acarina: Parasitiformes). Acarologia, 4: 5-30.
Walsh, P.S., Metzger, D.A. and Higuchi, R., 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques, 10: 506-513.
Wei, S.J., Li, Q., Achterberg, K. and Chen, X.X., 2014. Two mitochondrial genomes from the families Bethylidae and Mutillidae: Independent rearrangement of protein-coding genes and higher-level phylogeny of the Hymenoptera. Mol. phylogen. Evolut., 77: 1-10. https://doi.org/10.1016/j.ympev.2014.03.023
Wu, W.N., 1980a. A new species of the genus Phytoseius (Acarina: Phytoseiidae). Zool. Res., 1: 243-246.
Wu, W.N., 1980b. Notes on the genus Amblyseius Berlese from China (Acarina: Phytoseiidae). Nat. Enem. Insects, 2: 39-50.
Wu, W.N., 1986. A new species and a new record of Amblyseius from Fujian (Acarina: Phytoseiidae). Wuyi Sci. J., 6: 121-124.
Wu, W.N., Liang, L.R., Fang, X.D. and Ou, J.F., 2010. Phytoseiidae (Acari: Mesostigmata) of China: A review of progress, with a checklist. Progr. Chinese Acarol. Zoosymp., 4: 288-315.
Wu, W.N. and Ou, J.F., 2001. The obtusus species group of the genus Amblyseius (Acari: Phytoseiidae), with descriptions of two new species in China. System. appl. Acarol., 6: 101-108. https://doi.org/10.11158/saa.6.1.13
Wu, W.N., Ou, J.F. and Huang, J.L., 2009. Fauna sinica, invertebrate, Vol. 47, Arachnida, Acari, Phytoseiidae. China Press, Kuala Lumpur, Malaysia.
Xin, J.L., 1988. Agricultural acarology. Agriculture Press, Beijing, pp. 465.
Xu, X.N., Jiang, X.H. and Wang, E.D., 2010. Application of phytoseiid mites in China and an analysis of its problems. Zoosymposia, 4: 316-328.