Evidence of Brucella abortus in Non-Preferred Caprine and Ovine Hosts by Real-time PCR Assay
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
1Department of Pathology, University of Veterinary and Animal Sciences, Lahore
2Department of Parasitology, University of Veterinary and Animal Sciences, Lahore
3Department of Clinical Medicine and Surgery, University of Veterinary and Animal Sciences, Lahore
4Department of Microbiology, University of Veterinary and Animal Sciences, Lahore
5Veterinary Research Institute, Livestock and Dairy Development Department, Lahore
ABSTRACT
The present study was conducted in Sheikhupura and Kasur districts for molecular based confirmation of B. abortus in both sheep and goats. Brucellosis in sheep and goats is caused by B. ovis and B. melitensis, respectively but B. abortus (causative agent of bovine) may cross the species barrier to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than molecular assay which could confirm the particular species circulating in ruminants. In this study 960 and 471 serum samples of goats and sheep were collected, respectively. After screening with Rose Bengal test (RBT), all seropositive samples were subjected to real-time PCR assay. RBT confirmed the seroprevalences of 19.32% ± 0.289 and 12.29% ± 0.0105 brucellosis in sheep and goats, respectively and real-time PCR confirmed the B. abortus in 74 samples (62.71% ± 0.044) out of 118 seropositive samples in goats while 63 samples (69.23% ± 0.048) out of 91 seropositive samples of sheep. The presence of B. abortus in small ruminants could be due to mixed farming of small and large ruminants, sharing of same pasture, presence of reservoirs host in a farm, which might be the main risk factors for cross-infection of Brucella species in their non-specific hosts. B. abortus could be identified as causative agent of caprine and ovine brucellosis in Pakistan. Results of this study can be used for the development of effective eradication and control strategies for brucellosis in small ruminants.
Article Information
Received 12 August 2018
Revised 30 Setember 2018
Accepted 05 October 2018
Available online 22 March 2109
Authors’ Contributions
ZIC designed the study. MZS performed the experimental work and wrote the manuscript. RA and AA supervised the study. MIR helped in data analysis. MY and BAS helped in sample collection. MAM helped in samples screening.
Key words
Brucella abortus, Goat, Real-time PCR, RBPT, Sheep.
DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.3.sc3
* Corresponding author: [email protected]
0030-9923/2019/0003-1187 $ 9.00/0
Copyright 2019 Zoological Society of Pakistan
Brucellosis is an important zoonotic disease which is prevalent in both human and ruminants. Eradication and control of the disease is imperative for public health. But from last few years its prevalence is increasing day by day (Ali et al., 2015). Brucellosis has been eradicated in developed countries but it is still prevalent in tropical and developing countries (Pappas et al., 2006). It is also prevalent in Pakistan (Ahmad et al., 2017). In tropical areas where no strict biosafety measures are monitored, mix farming and same housing of small and large ruminants may lead to cross transmission of Brucella species to their non-preferred host which might complicate the control measure of brucellosis. There are eleven reported species of Brucella. Each specie has its preferred host. In past host specificity of Brucella pathogen has been recognized for phenotype isolates. But due to mix farming, sharing of same pasture of small and large ruminants, mixed livestock shelters, presence of reservoirs host in a farm, and uncontrolled animals movements may lead to cross infection of Brucella species in their non-preferred hosts. Eco-plasticity and polypathogenicity enables the Brucella to cross the species barrier. This transmission called as inter-species transmission which is the main barrier for control and eradication of brucellosis (Ali et al., 2015). Even dogs on farm can act as carrier of brucellosis in farm (Baek et al., 2003). Not only dogs but wild animals, cats and Chinese water deer can be a carrier of B. abortus (Truong et al., 2011). Avian species have also been reported for brucellosis (Mushi et al., 2008). Antibodies of Brucella pathogen were detected in poultry birds maintained at seropositive farm (Cadmus et al., 2010). The control and eradication of brucellosis is mostly based on strict enforcement of test and slaughter policy, movement control, sanitation and vaccination but cross species transmission can be a reason of vaccination failure (Akhtar et al., 2017). The projects on detection of prevalent species of Brucella in small and large ruminants, reservoirs host, fomites and wild life species are essential for effective implementation of control and eradication strategies (Muendo et al., 2012). It is important to inspect the Brucella from its outside non preferred host species in field condition. It is also imperative need of time to find out the interspecies transmission of Brucella which may occur naturally and cause clinical disease in non-preferred hosts. The present study was designed to find out the seroprevalences of brucellosis in small ruminants and detection of B. abortus in both sheep and goats by real-time PCR assay.
Materials and methods
Blood samples were collected from 471 sheep and 960 goats using a convenient sampling procedure from Kasur (Latitude: 31.0896° N, Longitude: 74.1240° E) and Sheikhupura (Latitude: 31.6243° N, Longitude: 74.1240° E) because these areas have been reported for brucellosis (Ahmed et al., 2017). The small ruminants of theses herds were also having mixed farming, sharing of pasture, same housing, history of abortion and close contact with seropositive large ruminants. The blood samples were collected in a vacutainer without anticoagulant then serum was separated and stored at -20°C.
All samples were serologically screened through Rose Bengal antigen obtained from Veterinary Research Institute Lahore (Baloch et al., 2017). All seropositive samples were used for DNA by ExgeneTM Blood SV-mini Kit (GeneALL® Biotechnology Co. Ltd, Songpa-gu, Korea) according to manufacturer’s instruction. Genomic samples were stored after quantification at -20°C till further investigation .
Genomic amplification was performed by using prepared Real-AmpTM SYBR qPCR master mix (Cat# 801-020, GeneALL® Biotechnology Co. Ltd, Songpa-gu, Korea). A reaction mixture of 20µL containing 4µL of master mix, 0.5µL (500nmol) of each species specific primers (Newby et al., 2003) forward: 5ʹ CCATTGAAGTCTGGCGAGC 3ʹ and reverse: 5ʹ CGATGCGAGAAAACATTGACCG 3ʹ, 1µL of DNA and 14µL of nuclease free water were used for amplification. The cycle threshold (Ct-value) below 40 was considered as positive. A reference strain of B. abortus (BA-544) obtained from Veterinary Research Institute (VRI) Lahore, Pakistan was used as positive control. Amplification of desired DNA was done in 96-well microplate (Thermo Fischer Scientific Inc., Waltham, USA) using a 7500 Real Time PCR System, Thermo cycler system of ABI. Initial denaturation at 94°C for 10 min followed by 40 cycles of each consisting denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec and extension at 72°C for 10 sec. Final extension was done at 72°C for 3 min. Double stranded PCR product was detected by fluorescent dye associated with SYBR green-I at each extension step. An amplification curve of PCR product was analyzed and recorded through computerized software.
Data was analyzed risk estimation of odds ratio (95% CI: confidence interval) by using Statistical Package for Social Science (SPSS for Windows version 20, SPSS Inc., Chicago, IL, USA). Standard error sample proportion of standard deviation was calculated by using SEP formula as given. SEP = Square root [P (1 – P)/ n].
Results and Discussion
Through RBPT it was found out that, 118 (12.29% ± 0.0105) samples of goats out of 960 and 91 (19.32% ± 0.289) serum samples of sheep out of 471 were seropositive. After quantitative PCR, the PCR product size of B. abortus was found to be 156bp which confirmed that 74 samples (62.71% ± 0.044) out of 118 seropositive samples in goats and 63 samples (69.23% ± 0.048) out of 91 seropositive samples of sheep had B. abortus.
The present study was conducted in Sheikhupura and Kasur districts because the disease is prevalent not only in ruminants but soil is also niche for Brucella infection (Ahmed et al., 2017). Previously B. abortus biovar-1 was detected in 86% blood samples and 64% milk samples of goats by PCR assay (Leal-Klevezas et al., 2000). In Nigeria an abortion due to B. abortus was confirmed in ewes. The same biovar of Brucella was isolated from cattle which were kept in close contact with sheep, confirmed the cross-species transmission (Ocholi et al., 2005). Junaidu et al. (2010) used the serum samples of goats after slaughtering. They found out 12.03% samples positive for B. abortus. It was due to grazing habit in Nigeria where cattle graze with sheep and goats. In Egypt, despite eradication program of brucellosis, the disease was endemic in animals. The study revealed the cross-species infection of B. abortus from cattle to non-preferred host. Close farming could be the risk factor for continuous presence of brucellosis among cattle, buffalo, sheep and goats (Wareth et al., 2015). Previously, a study was conducted in Pakistan, in which all the seropositive serum samples of small ruminants were positive for B. abortus by real-time PCR but none of the B. melitensis was detected. B. abortus was identified as a causative agent for abortion in small ruminants (Ali et al., 2015). There could be number of risk factors which might have role in cross infection of species. These risk factors should be analyzed for effective planning. In a country like Pakistan where no strict biosafety measures are present, this could be the main reason of control failure. Mixed farming could be the reason of transmission of B. abortus to small ruminants where both small and large animals share the same pasture. Animals may secrete the infection (Samad et al., 2018). Brucella could survive in soil and other fomites (Ahmed et al., 2017). Same housing and herd presence of seropositive animals in mix farming system could play a role in transmission (Ali et al., 2015). Ectoparasites have been recently investigated as responsible for Brucella transmission. Ticks, mites and lice have also role in Brucella transmission (Wang et al., 2018). These ectoparasites with fomites, water and soil should be included in investigation of cross transmission of Brucella species. Due to cross infection of Brucella species in their non-preferred host brucellosis is increasing day by day. Abortion due to B. abortus in small ruminants cannot be identified on serogical basis. The serological based screening may lead to misleading planning for control program. Species specific identification of Brucella is significant in control measures (Shahzad et al., 2017). Early and accurate detection of Brucella species and its biovar/ biotype are fundamental for the control and eradication of brucellosis.
Conclusion
Little attentions was paid to inter-species transmission in previous studies. In the present study we used the molecular assay for confirmation of B. abortus in sheep and goats. It can be concluded that B. abortus could be a problem of small ruminants.
Acknowledgments
The research project was funded by European Union funded project of PLCIP/PITCO and Higher Education Commission of Pakistan (PIN No. 213-53245-2AV2-034) in collaboration with Veterinary Research Institute Lahore, Livestock and Dairy Development Department, Government of Punjab, Pakistan.
Statement of conflict of interest
There is no conflict of authors of this paper.
References
Ahmad, T., Khan, I., Razzaq, S., Khan, S.H. and Akhtar, R., 2017. Pakistan J. Zool., 49: 1123-1126. https://doi.org/10.17582/journal.pjz/2017.49.3.sc5
Ahmed, R., Muhammad, K., Rabbani, M. and Khan, M.S., 2017. Pakistan J. Zool., 49: 1739-1748. https://doi.org/10.17582/journal.pjz/2017.49.5.1739.1748
Ali, S., Akhter, S., Neubauer, H., Melzer, F., Khan, I., Ali, Q. and Irfan, M., 2015. J. Infect. Devel. Ctries., 9: 470-475. https://doi.org/10.3855/jidc.5110
Akhtar, R., Anwar, M., Khan, I., El-Adawy, H., Aslam, A., Mustafa, G., Rehmani, S., Saleem, M. and Naz, S., 2017. Pak. Vet. J., 37: 372-374.
Baek, B., Lim, C., Rahman, M., Kim, C.H., Oluoch, A. and Kakoma, I., 2003. Can. J. Vet. Res., 67: 312-314.
Baloch, A.S., Rasheed, A., Rind, R., Sahito, J.K., Buriro, R., Ayoob, M.F. and Dewani, P., 2017. Pakistan J. Zool., 49: 367-369. http://dx.doi.org/10.17582/journal.pjz/2017.49.1.sc5
Cadmus, S., Adesokan, H., Oluwayelu, D., Idris, A. and Stack, J., 2010. Anim. Hlth. Prod., 58: 382-384.
Junaidu, A., Daneji, A., Salihu, M., Magaji, A., Tambuwal, F., Abubakar, M. and Nawawi, H., 2010. Curr. Res. J. biol. Sci., 2: 275-277.
Leal-Klevezas, D.S., Martı́nez-Vázquez, I.O., Garcı́a-Cantú, J., López-Merino, A. and Martı́nez-Soriano, J.P., 2000. Vet. Microbiol., 75: 91-97. https://doi.org/10.1016/S0378-1135(00)00200-5
Muendo, E.N., Mbatha, P.M., Macharia, J., Abdoel, T.H., Janszen, P.V., Pastoor, R. and Smits, H.L., 2012. Trop. Anim. Hlth. Prod., 44: 17-20. https://doi.org/10.1007/s11250-011-9899-9
Mushi, E., Binta, M., Basupang, K. and Samakabadi, E., 2008. J. Anim. Vet. Adv., 7: 1610-1612.
Newby, D.T., Hadfield, T. and Roberto, F.F., 2003. Appl. environ. Microbiol., 69: 4753-4759. https://doi.org/10.1128/AEM.69.8.4753-4759.2003
Ocholi, R., Kwaga, J., Ajogi, I. and Bale, J., 2005. Rev. Scient. Tech. Off. Int. Epizoot., 24: 973-979. https://doi.org/10.20506/rst.24.3.1627
Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L. and Tsianos, E.V., 2006. Lancet Infect. Dis., 6: 91-99. https://doi.org/10.1016/S1473-3099(06)70382-6
Samad, A., Abbas, F., Ahmad, Z., Pokryrshko, O. and Asmat, T.M., 2018. Pakistan J. Zool., 50: 1597-1600. http://dx.doi.org/10.17582/journal.pjz/2018.50.4.sc17
Shahzad, A., Neubauer, H., Melzer, F., Khan, I., Akhter, S., Jamil, T. and Umar, S., 2017. Pakistan J. Zool., 49: 1111-1114. https://doi.org/10.17582/journal.pjz/2017.49.3.sc2
Truong, L.Q., Kim, J.T., Yoon, B.I., Her, M., Jung, S.C. and Hahn, T.W., 2011. J. Vet. med. Sci., 73: 1597-1601. https://doi.org/10.1292/jvms.11-0222
Wang, Q., Zhao, S., Wureli, H., Xie, S., Chen, C., Wei, Q., Cui, B., Tu, C. and Wang, Y., 2018. Ticks Tick-Borne Dis., 9: 1045-1048.
Wareth, G., Melzer, F., Tomaso, H., Roesler, U. and Neubauer, H., 2015. BMC Res. Notes, 8: 212. https://doi.org/10.1186/s13104-015-1173-1