Reliable Scarless Fusion of Genes through Overlap Extension PCR to Develop Chimeric Genes
Iram Gull*, Muhammad Shahbaz Aslam, Imran Tipu, Roohi Mushtaq and Muhammad Amin Athar
Institute of Biochemistry and Biotechnoloy, Quaid-i-Azam Campus, University of the Punjab, 54590, Lahore
ABSTRACT
Overlap extension PCR is used to make versatile chimeric gene products. However, the results of this technique are not always reliable due to inefficient overlapping of the sequences especially those derived from authenticated native sequences. Certain forbidden sequences do appear at junction of spliced genes whenever efficiency of gene fusion is improved by inserting GC rich sequences. In this study, reliable scar-less gene fusion with the insertion of sequence of choice at junction sites has been described by optimization of various parameters of overlap extension PCR. The fusion of IFNα2b gene to the gene of human latency associated protein with insertion of HCV NS3 protease cleavage site at splicing junction is reported.
Article Information
Received 19 July 2018
Revised 30 August 2018
Accepted 08 October 2018
Available online 30 May 2019
Authors’ Contributions
IG, MSA, IT and RM performed the experiments and wrote the manuscript. MAA designed the study and critical review the manuscript.
Key words
Scarless, Gene fusion, Overlap extension PCR, Chimeric genes, Reliable.
DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.4.1561.1567
* Corresponding author: [email protected]
0030-9923/2019/0004-1561 $ 9.00/0
Copyright 2019 Zoological Society of Pakistan
Introduction
Splicing of genes or DNA fragments is of great importance in the field of molecular biology and biotechnology. It is used for structural and functional analysis of proteins (Elleuche et al., 2011; Henness and Broom-Smith, 1993; Aslam et al., 2018), for studying the effect of different regulatory sequences on gene expression (Haoug et al., 2004; Nemetz et al., 2002), for protein purification (Waugh, 2005), for targeted drug delivery (Lu et al., 2014), removal of introns from genes (Mitani et al., 2004; Mergulhao et al., 1999), tagging of reporter/marker gene (Hobert, 2002; Siegel and Isacoff, 1997) and for many other purposes. The conventional methods of gene fusion rely on restriction enzymes and subsequent ligation that introduce undesired sequences at the junction of spliced genes (Lu, 2005). Alternatively, overlap extension PCR is a useful procedure where genes can be spliced directly or by inserting sequence of choice at splicing point (Horton et al., 2013). Specially designed overlapping primers incorporating the changes are the backbone of procedure. However, this method is not considered as method of immediate choice as the results are not always reliable, especially when the overlapping sequences are derived from natural gene sequences to be spliced (Cha-aim et al., 2012). The success of splicing by overlap extension (SOE) depends upon the efficient gene fusion after annealing of overlapping sequences. Different strategies can be employed to improve the efficiency of SOE PCR such as optimizing the length of overlapping primers, use of poly GC rich overlap sequences (Cha-aim et al., 2009) or controlling the PCR reaction by optimizing different parameters (Bryksin and Matsumura, 2010). To avoid the complexities of various modifications of overlap extension PCR, inventors of overlap extension PCR suggest that following all the intermediate steps of basic overlap extension PCR protocol, efficiency and accuracy of ultimately generated product can be maximized (Heckman and Pease, 2007).
In case, where a specific sequence has to be inserted at junction of spliced gene, option of poly GC overlapping sequence is considered unreliable. Nonetheless, fusion through G/C stretches improves gene fusion but likewise the restriction enzyme digestion-DNA ligation, fusion through G/C stretches leave scars of unwanted sequences at junction site. For reliable scar less fusion without any forbidden sequences, the efficiency of fusion has been improved in the present study by controlling the PCR conditions.
In the present study, various parameters of splicing by overlap extension PCR has been optimized to efficiently develop chimeric gene products (IFNα2b-NS3-LAP and LAP-NS3-IFNα2b) by splicing interferon alpha 2b (IFNα2b) gene with latency associated protein (LAP) gene of human transforming growth factor β (TGFβ) in both orientations with the insertion of hepatitis C virus (HCV) NS3 protease cleavage site at splicing junction. In addition overlap primer walk PCR (OPW-PCR) was also performed to introduce Tag sequences at 5’ end of chimeric gene products. To our knowledge, these novel chimeric gene products have not been developed so far.
Materials and methods
The list of primers used for chimeric genes development by SOE-PCR and OPW-PCR is given in Table I. The primers were designed manually and analyzed by free online program ‘’Oligocalculator’’. The IFNα2b-NS3-LAP chimeric gene was developed by using chimeric primers (F3, F230, F227, F224, F221, F218, F215) and non-chimeric primers (F1 and F4). Whereas, for the development of LAP-NS3-IFNα2b chimeric gene, F3/ and F2/21 primer were used as chimeric while F1/ and F4/ were used as non-chimeric primer pair. The primers F5, F5/, F6, F4 and F4/ were used in OPW-PCR. F4 and F4/ primers had restriction site of XhoI whereas F6 primer had XbaI restriction site.
IFNα2b and LAP genes were amplified from the plasmids pIFN and pLAP respectively containing IFNα2b and LAP genes.
SOE-PCR was performed in two steps (Fig. 1). In the first step, IFNα2b was amplified from pIFN plasmid using primer pairs F1/ F230, F1/F227, F1/F224, F1/F221, F1/F218, F1/F215 while LAP gene was amplified using F3 and F4 primer from pLAP plasmid. The reaction mixture of PCR was prepared using 0.2 mM dNTPs, 0.5µM of each primer, 2 mM MgSO4, 50 ng of plasmid DNA as template, 2.5 U of Pfu DNA polymerase and 1X Pfu buffer (50 mM KCl, 10 mM Tris-Cl pH 8.0, 1.5 mM MgSO4) and subjected to the 35 cycles of denaturation at 95 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C (1 min for IFNα2b; 2 min for LAP) followed by final extension of 7 min at 72 °C. Another PCR reaction was also performed under similar reaction conditions except using F1//F2/21 primer pair for amplification of LAP gene and F3//F4/ primer pair for amplification of IFNα2b. The amplicons were analyzed by 1 % agarose gel electrophoresis and purified using Thermoscientific Gel Extraction Kit following the protocol of manufacturer. The purified amplicons were quantified using nanodrop.
In the second step, first10 cycles of SOE-PCR were performed in reaction mixture without adding primers to the reaction mixture and containing equimolar concentration (0.8 pmoles-0.00625 pmoles) of purified IFNα2b and LAP amplicon from 1st step of PCR as template, 0.2 mM dNTPs, 2 mM MgSO4, 2.5 U of Pfu DNA polymerase and 1X Pfu buffer (50 mM KCl, 10 mM Tris-Cl pH 8.0, 1.5 mM MgSO4) under conditions of denaturation at 95 °C for 1 min, annealing at 45 °C-60 °C for 1 min and extension at 72 °C for 3 min. After 10 cycles of each reaction, primer pairs F1/F4 and F1//F4/ were added in respective reaction vials for amplification of IFN-NS3-LAP and LAP-NS3-IFN chimeric gene products respectively and further subjected to 30 cycles of denaturation at 95 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 3 min followed by final extension at 72 °C for 7 min.
Table I.- List of primers used for overlap extension PCR and OPW-PCR.
|
Name |
Sequence |
GC % of overlapping region |
|
F1 |
5’ TGTGACTTGCCACAAACTCACTCCTTGGGTTCC 3’ |
- |
|
F230 |
5’GTAGGACATAGAACAACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
37 |
|
F227 |
5’ GGACATAGAACAACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
37 |
|
F224 |
5’ CATAGAACAACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
33 |
|
F221 |
5’ AGAACAACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
33 |
|
F218 |
5’ ACAACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
33 |
|
F215 |
5’ ACAAACAACATCTTCCTCCTTGGATCTCAAGGACT 3’ |
33 |
|
F3 |
5’ GAAGATGTTGTTTGTTGTTCTATGTCCTACTTGTCTACTTGTAAGACTAT 3’ |
37-33 |
|
F4 |
5’ GTTCTAGATTACCTCCTATGACGGGAAGATTGCAAATGTTGGGCT 3’ |
- |
|
F1’ |
5’TTGTCTACTTGTAAGACTATTGATATGGAATTGGTTAAGAGAAAGAGA ATTGAAG 3’ |
- |
|
F2’21 |
5’ AGAACAACAAACAACATCTTCCCTCCTATGACGGGAAGATTG 3’ |
33 |
|
F3’ |
5’GAAGATGTTGTTTGTTGTTCTATGTCCTACTGTGACTTGCCACAAACTCA 3’ |
33 |
|
F4’ |
5’ GCCTTCTAGATTACTCCTTGGATCTCAAGGACTCTTGCAAGTTGGTAG 3’ |
- |
|
F5 |
5’ CACCACGGATCCGATGATGATGATAAGTGTGACTTGCCACAAACTCA 3’ |
48 |
|
F5’ |
5’ CACCACGGATCCGATGATGATGATAAG TTGTCTACTTGTAAGACTATT GATATG 3’ |
48 |
|
F6 |
5’ GCCTCGAGAAAAGACACCACCACCACCACCACGGATCCGATGATGAT 3’ |
52 |
Underlined portions indicate the overlapping regions.
In order to introduce the additional sequences (His-Tag, Glycine-Serine spacer and Enterokinase cleavage site) at the 5’ end of the each chimeric product, overlap primer walk PCR (OPW-PCR) was performed (Fig. 2). In 1st round of PCR, SOE-PCR products (templates) were amplified to introduce enterokinase cleavage site and Gly-Ser spacer by using primer pair F5/F4 and F5//F4/. In the 2nd round of PCR, OPW-PCR products of 1st round were amplified to introduce His-Tag, Kex2 cleavage site and XhoI site by using primer pair F6/F4 and F6/F4/ for IFN-NS3-LAP and LAP-NS3-IFN chimeric genes, respectively. The reaction was performed using 0.5 µM of each primer along with 0.2 mM dNTPs, 100 ng of template (for step 1 gene product of SOE-PCR; for step 2 gene product of 1st step of OPW-PCR), 2 mM MgSO4, 2.5 U of Pfu DNA polymerase and 1X Pfu buffer (50 mM KCl, 10 mM Tris-Cl pH 8.0, 1.5 mM MgSO4). Each reaction was performed for 35 cycles under the following conditions: denaturation at 95 °C for 1 min, annealing at 62 °C for 1 min and extension at 72 °C for 4 min followed by final extension at 72 °C for 7 min.
Results and discussion
In this study, a simple procedure of overlap extension PCR was used to fuse human IFNα2b gene to the LAP gene of human TGFβ in both orientations along with insertion of HCV NS3 protease cleavage site sequence at the splicing junction of genes.
For splicing of genes and insertion of HCV NS3 cleavage site sequence simultaneously, chimeric primers (F230, F227, F224, F221, F218, F215, F3, F2/,F3/) along with non-chimeric primers were used in first step of SOE-PCR. Chimeric primers have anchoring sequence (20 nts) at 3’ end (derived from the template gene) and flanking sequence having HCV NS3 protease cleavage site sequence ranging from 30 nts (F230, F/2) to 15 nts (F215) at 5’ end. Using Pfu
DNA polymerase in the 1st step of SOE-PCR, IFNα2b gene (495 bp) was amplified by primer pairs F1/F230, F1/F227, F1/F224, F1/F221, F1/F218 and F1/F215 whereas F3/F4 primer pair was used to amplify LAP gene (747bp). This PCR amplification introduced overhangs of 30-15 nts of HCV NS3 protease cleavage site sequence at 3’ end of IFNα2b gene (525-510 bp) by F2(30-15) primers and 30 nts overhang at 5’ end of LAP gene (785 bp) by F3 primer (Fig. 4A). F2(30-15) primers refer to the length of 5’ flanking sequence sharing the overlapping region with F3 primer ranging from 30 nucleotides to the 15 nucleotides. At this step, it is very critical to use the DNA polymerase which has low error rate, high fidelity and proofreading activity as addition or substitution of a single nucleotide at 3’ end of the overlapping regions of genes results in complete failure of splicing. In the first 10 cycles of second step of SOE-PCR, purified IFNα2b and LAP gene from 1st step with various equimolar concentrations (0.8 pmoles-0.00625 pmoles) were used without addition of any primer for amplification of full length chimeric gene (1.280 kb) with insertion of 30 nucleotide of HCV NS3 protease cleavage site sequence (IFNα2b-NS3-LAP). The 3’ ends of antisense strand of IFNα2b and sense strand of LAP had overlapping region of maximum length 30 nucleotides to minimum length of 15 nucleotides. The efficiently overlapped region resulted in extension from 3’ end of each strand and synthesize full length chimeric gene (Fig. 3). In our case, overlapping region of at least 21 nucleotides with 33% GC content resulted in successful fusion of 516 bp IFNα2b gene to 785 bp LAP gene with insertion of 30 nucleotide HCV NS3 protease cleavage site sequence to develop 1.280 kb chimeric gene product (IFNα2b-NS3-LAP) (Figs. 3, 4C). Purity of template, concentration of template, annealing temperature of overlapping region and number of nucleotides in overlapping region are important factors at 2nd step that affect the efficient overlapping and further success of procedure. Long overlapping sequences can be selected but as the length increase, the chances for the presence of palindromic sequences may also increase that can reduce the efficient overlapping by developing the secondary structures (Cha-aim et al., 2009). High GC content in overlapping region improves base pairing during annealing step. In this study efficient base pairing with as minimum as 33% GC content in overlapping region resulted in successful fusion of genes. In case of overlapping regions derived from native sequences, GC content of the overlapping region can be increased by using the narrow window of codon redundancy i.e. by selecting the codons of required amino acid with more G/C contents. The same strategy can also be applied to avoid palindromic sequences if present in overlapping region without any change in the amino acid sequence of protein.
The annealing temperature of first 10 cycles was also optimized to ensure efficient and accurate overlapping. Although the calculated annealing temperature of the overlapping region was 44 °C, annealing at 58 °C showed a clear sharp band of chimeric gene product. Annealing temperatures < 58 °C resulted in non-specific amplifications as wells while no amplification at all at annealing temperatures > 58 °C (Fig. 4C). The results corroborates with the studies of Heckman and Pease (2007) and Cha-aim et al. (2009) who reported that higher annealing temperatures increase the efficiency and accuracy of the PCR while low annealing temperatures result in amplification of artifact products. It was also observed that increase in annealing time at high annealing temperature further improves the chances of precise annealing. It is important to mention that increase in annealing time, from 30 sec to 2 min, was effective in getting the specific PCR product (Fig. 4C). Wurch et al. (1998) extended annealing time to 25 minutes to improve overlapping between 24 bp region but in our study 2 min annealing time was sufficient for successful overlapping of 21 bp region. To further improve the efficiency of SOE-PCR, minimum equimolar concentration of genes required for fusion was also optimized. With overlap of 21 nucleotides, 1.280 kb chimeric gene was successfully amplified by decreasing the equimolar concentration of genes to 0.0125 pmoles. Below this concentration, no amplification was observed (Fig. 4D). Hence, it is established that minimum 0.0125 pmoles of each gene are required to perform SOE-PCR regardless of how much is available. After 10 cycles, non-chimeric primers (F1/F4) were added in reaction vials and chimeric product (1.280 kb) was successfully amplified.
In parallel experiment, for development of chimeric gene product in opposite direction (LAP-NS3-IFNα2b), same procedure and conditions were followed except amplification of LAP and IFNα2b genes with F1//F2/(21) and F3//F4/ primers respectively in 1st step while F1//F4/ primer pair in second step of SOE-PCR (Fig. 4B).
Additional sequences at 5’ end of chimeric genes were introduced by overlap primer walk PCR (OPW-PCR). In 1st round of PCR, F5/F4 and F5//F4/ primer pairs while in 2nd round of PCR F6/F4 and F6/F4/ primer pairs were used for IFNα2b-NS3-LAP and LAP-NS3-IFNα2b chimeric genes, respectively to introduce enterokinase cleavage site (DDDDK), glycine-serine spacer, six amino acid His-Tag, two amino acid Kex2 protease cleavage site and XhoI restriction enzyme site in stepwise manner (Fig. 4E, F). Primer F5 and F5/ had 20 nts and 24 nts region respectively complementary to the templates along with 5’ overhangs of 27 nts that share overlapping region of 21 nts with F6 plasmid. F4 and F4/ primers introduced XbaI restriction enzyme site at 3’ end of chimeric genes. Chimeric genes, restricted with XbaI and XhoI restriction enzymes were ligated with the linearized pPICZαA plasmid restricted with the same enzymes and the recombinant plasmids were cloned in E. coli DH5α cells.
Conclusions
Using overlap extension PCR, a novel chimeric gene was constructed in both orientations (IFNα2b-NS3-LAP and LAP-NS3-IFNα2b) with insertion of HCV NS3 protease cleavage site by the overlap of only 21 bp (33% GC content) using as low as 0.0125 pmoles of each template. In addition, by overlap primer walk PCR, 45 nucleotide sequence was introduced at 5’ end of chimeric genes. Using 2 steps of SOE-PCR and primer walk PCR two novel chimeric genes can be constructed and cloned just within one week. The accuracy and successful splicing the genes with insertion of desired sequences depends on: 1) the precise designing of overlapping primers, 2) purification of SOE-PCR product of step #1, 3) minimal required equimolar concentration of templates, 4) use of DNA polymerase high fidelity, 5) length of overlapping region between splicing genes, 6) GC content of overlapping region and 7) annealing temperature of overlapping region. Keeping these parameters in mind, the simple technique of SOE-PCR can be used with high rate of success to make versatile scarless chimeric genes along with insertional mutagenesis to introduce any sequence of choice and length at desirable position.
Acknowledgements
This research work was funded by the University of the Punjab.
Statement of conflict of interest
The authors declare that they have no competing interests.
References
Aslam, M.S., Gull, I., Abbas, Z. and Athar, M.A., 2018. Soluble expression of IFN [alpha] 2-T [alpha] 1 fusion protein in Escherichia coli by N-terminal SUMO fusion and its anti-proliferative activity. Pakistan J. Zool., 50: 1413-1419.
Bryksin, A.V. and Matsumura, I., 2010. Overlap extension PCR cloning: A simple and reliable way to create recombinant plasmids. Biotechniques, 48: 463-465. https://doi.org/10.2144/000113418
Cha-aim, K., Fukunaga, T., Hoshida, H. and Akada, R., 2009. Reliable fusion PCR mediated by GC-rich overlap sequences. Gene, 434: 43-49. https://doi.org/10.1016/j.gene.2008.12.014
Cha-aim, K., Hoshida, H., Fukunaga, T., and Akada, R., 2012. Fusion PCR via novel overlap sequences. Methods Mol. Biol., 852: 97-110. https://doi.org/10.1007/978-1-61779-564-0_8
Elleuche, S., Piascheck, H. and Antranikian, G., 2011. Fusion of the OsmC domain from esterase EstO confers thermostability to the cold active xylanase Xyn8 from Pseudoalteromonas arctica. Extremophiles, 15: 311-317. https://doi.org/10.1007/s00792-011-0361-8
Heckman, K.L. and Pease, L.R., 2007. Gene splicing and mutagenesis by PCR- driven overlap extension. Nature Protocols, 2: 924-932. https://doi.org/10.1038/nprot.2007.132
Hennessey, E.S. and Broome-Smith, J.K., 1993. Gene fusion techniques for determining membrane protein topology. Curr. Opin. Struct. Biol., 3: 524-531. https://doi.org/10.1016/0959-440X(93)90078-Y
Hoaug, V., Bini, E., Dixit, V., Drozda, M. and Blum, P., 2004. The role of cis-acting sequences governing catabolite repression control of lacS expression in the archaeon Sulfolobus solfataricus. Genetics, 167: 1563-1572. https://doi.org/10.1534/genetics.103.024380
Hobert, O., 2002. PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. Biotechniques, 32: 728-730. https://doi.org/10.2144/02324bm01
Horton, R.M., Cai, Z., Ho, S.N. and Pease, L.R., 2013. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques, 54: 129-133.
Lu, Q., 2005. Seamless cloning and gene fusion. Trends Biotechnol., 23: 199-206. https://doi.org/10.1016/j.tibtech.2005.02.008
Lu, X., Jin, X., Huang, Y., Wang, J., Shen, J., Chu, F., Mei, H., Ma, Y. and Zhu, J., 2014. Construction of a novel liver targeting fusion interferon by incorporation of a plasmodium region I-Plus peptide. BioMed Res. Int., 2014: 261631. https://doi.org/10.1155/2014/261631
Mergulhao, F.J.M., Kelly, A.G., Monteiro, G.A., Taipa, M.A. and Cabral, J.M.S., 1999. Troubleshooting in gene splicing by overlap extension. Mol. Biotechnol., 12: 285-287.
Mitani, Y., Nakayama, T., Harbers, M. and Hayashizaki, Y., 2004. Aptamer-dependent full length cDNA synthesis by overlap extension PCR. Biotechniques, 37: 124-129. https://doi.org/10.2144/04371DD02
Nemetz, C., Wessner, S., Schweizer, R., Watzele, M., Metzler, T., Mutter, W. and Buchberger, B., 2002. RTS: rapid protein expression directly from PCR fragments. Biochemica, 2: 22-24.
Siegel, M.S. and Isacoff, E.Y., 1997. A genetically encoded optical probe of membrane voltage. Neuron, 19: 735-741. https://doi.org/10.1016/S0896-6273(00)80955-1
Waugh, D.S., 2005. Making the most affinity tags. Trends Biotechnol., 23: 316-320. https://doi.org/10.1016/j.tibtech.2005.03.012
Wurch, T., Lestienne, F. and Pauwels, P.J., 1998. A modified overlap extension PCR method to create chimeric genes in the absence of restriction enzymes. Biotechnol. Tech., 12: 653-657. https://doi.org/10.1023/A:1008848517221