Distribution of Phenotypic and Genotypic Antibiotic Resistance in E. coli Isolates along the Production and Supply Chain of Pork around Hubei Province of China
Sher Bahadar Khan1,2,*, Zou Geng1, Cheng Yu-ting1, Asad Sultan3, Mumtaz Ali4,5, Irshad Ahmad6 and Rui Zhou1
1Key Lab of Agriculture Microbiology, Huazhong Agriculture University, Hubei, China
2Department of Animal Health, The University of Agriculture, Peshawar, Pakistan
3Department of Poultry Sciences, The University of Agriculture, Peshawar, Pakistan
4Department of Livestock and dairy development, Peshawar, Pakistan
5University of Veterinary and Animal Sciences, Lahore, Pakistan
6Khyber Medical University, Peshawar, Pakistan
ABSTRACT
Using MacConkey agar, E. coli were isolated from 285 samples including 125 tonsil swabs (4-6 weeks old healthy pigs from 5 farms), 80 tissue samples from different slaughter houses (20 each intestine, liver, meat and kidney), and 80 samples from super- and wet-markets (each 20 meat and liver) collected both in summer and winter. Isolates were tested for 15 antibiotics (CRO, AMX, GEN, STR, TET, CHL, CLR, LVX, OFX, GAT, CIP, SXT, AMP, LIN and AZM) according to the disc diffusion method and antibiotic resistant genes {tet(A), tet(B), tet(C), strA/strB, aadA, aac(3)IV), aadB, sul1, sul2 and sul3, blaCMY-2, blaTEM and blaSHV} using mPCR. Resistance for LIN was the highest in overall (96.3%, 77/80) isolates as well as from pig farms (100%, 20/20) and different markets (100%, 20/20, 85%, 17/20). Resistance for other antibiotics such as AMX, TET, AMP and SXT was found 82.5% (66/80), 63.7% (51/80), 58.7% (47/80) and 50% (40/80), respectively. The most prevalent ARGs in the isolates recovered from pig farms was blaTEM (100%, 20/20), followed by blaCMY-2 (80%, 16/20), tetA and tetB (60%, 12/20) and tetC (50%, 10/20). E. coli became more and more diverse along the PSCP with group B2 being the most prevalent. Besides multiple drug resistance, they share many traits with the human pathogenic isolates based on virulence gene contents that may pose a potential threat to public health.
Article Information
Received 12 Septembeer 2018
Revised 15 December 2018
Accepted 27 January 2019
Available online 30 May 2019
Authors’ Contribution
RZ designed the project. ZG and CYT collected and processed the samples. SBK, AS, MA and IA performed the experiments and wrote the manuscript.
Key words
Antibiotics, Drug resistance, E. coli, Pathogenic isolates, Virulence.
DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.4.1569.1574
* Corresponding author: [email protected]
0030-9923/2019/0004-1569 $ 9.00/0
Copyright 2019 Zoological Society of Pakistan
Introduction
An increase in the antimicrobial resistance of E. coli is a worldwide public health concern which is mainly associated with merciless use of antibiotics (Foley and Lynne, 2008; Geimba et al., 2004). Unnecessary and extensive application of antimicrobials in animal feed and veterinary practice have led towards antimicrobial resistance in all bacterial pathogens in general and in E. coli in particular (Jiu et al., 2016). Multiple drug resistance (MDR) has been developed in these bacterial pathogens including E. coli that may be a great challenge to the world after infection. Every year, 25000 deaths in European Uninon and 23000 deaths in US have reported due to MDR bacteria (Jessica et al., 2015). This resistance against antimicrobials is due to different factors including transfer of plasmids, transposons and antimicrobial resistant genes. Clinically E. coli is divided into three types, commensals, diarrheagenic and extra intestinal pathogenic E. coli (ExPEC) (Khan et al., 2016). ExPEC are those strains that cause infections outside the intestine such urinary tract infection (UTI), septicemia and meningitis in new born babies (Clermont et al., 2011; Johnson et al., 2005a, b). There are four phylogenetic groups of E. coli (A, B1, B2 and D) (Khan et al., 2016). ExPEC mainly belong to group B2 with lesser extent to D while commensals belong to group A and B1. Keeping in view the importance of ExPEC, we carried out this population biological study of E. coli to investigate phylogenetic grouping, distribution of virulence genes, antibiotic resistance and antibiotic resistant genes along the PSCP.
Materials and Methods
Samples
A total of 285 samples were collected in this study. From the pig production system we collected 125 tonsil swabs from 4-6 weeks old clinically healthy pigs from different herds of five intensive pig farms located in Ezhou, Xiantou and Qianjiang of Hubei province (25 tonsil swabs from each farm). Tonsil swab was taken by scraping the tonsil surface thrice with a sterile bamboo tongue-spatula after gently opening the pig mouth with a mouth gag, and immediately put into a sterile plastic tube and transported to laboratory. From the pork supply chain, 160 samples were purchased from different markets located in Yichang and Wuhan of Hubei province, including 80 samples from different slaughter houses (20 each meat, liver, intestine and kidney), 80 samples from different wet and super markets (20 each meat and liver) in both summer and winter. Samples were collected in sterile plastic bags and subjected to laboratory for bacterial isolation.
Bacterial isolation
Upon arrival to the laboratory, tonsil swabs were immediately washed with 0.5 ml PBS, and 0.1 ml of them was inoculated on MacConkey agar plate. Out of 200 g meat or tissue samples, 50 g was cut into small pieces and mixed with 450 ml of BHI in a homogenizer (250 Watt, Type MJ-25BM05A, Guangdong Midea Electrical Appliance Co., Ltd., Foshan, China) for 2 min. One ml of homogenized sample was mixed with 9 ml of BHI and incubated at 37°C for 24 h. 0.5 ml of the culture was then inoculated on MacConkey agar plate. The plates were incubated at 37°C for 24 h. Typical lactose fermenting, pink colonies (one colony/sample) were selected for further analysis. E. coli was confirmed using standard bacteriological biochemical tests using an API 20E system (bioMerieux, France).
Extraction of DNA
Genomic DNA was extracted from the isolates using E.Z.Nce.A bacterial DNA kit (Omega Bio-Tek, USA).
Antimicrobial susceptibility testing (AST)
The antimicrobial susceptibility of E. coli isolates was determined for 15 antimicrobials according to the disc diffusion method using Muller-Hinton agar (MHA, Qingdao hopebio technology Co., China). Interpretation of the results followed the recommendations of the Clinical and Laboratory Standards Institute (CLSI), the European Committee on Antimicrobial Susceptibility Testing (EUCAST) (Gilani et al., 2008). Antimicrobial susceptibility testing was performed for the following antimicrobial agents (antimicrobial abbreviations and breakpoints are shown in parenthesis): Ceftriaxone (CRO, 30 μg), Amoxicillin (AMX, 20 μg), Gentamycin (GEN, 10 μg), Streptomycin (STR, 10 μg), Tetracycline (TET, 30 μg), Chloramphenicol (CHL, 30 μg), Clarithromycin (CLR, 15 μg), Levofloxacin (LVX, 5 μg), Ofloxacin (OFX, 5 μg), Gatifloxacin (GAT, 5 μg), Ciprofloxacin (CIP, 5 μg), Suphamethoxazole+Trimethpram (SXT, 25 μg), Ampicillin (AMP, 10 μg), Lincomycin (LIN, 2 μg) and Azithromycin (AZM, 15 μg) (Table I). Isolates showing resistance to at least three antimicrobial agents belonging to different antimicrobial classes were considered multidrug resistance (MDR) strains.
Table I.- Antibiotics discs, their concentration and size of zone of inhibition.
|
S. No |
Antibiotics |
Disc content |
Zone of inhibition (millimeter) |
||
|
S |
I |
R |
|||
|
1. |
CRO |
30 µg |
> 23 |
20-22 |
<19 |
|
2. |
AMX |
20 µg |
>17 |
14-16 |
<13 |
|
3. |
GEN |
10 µg |
>15 |
13-14 |
<12 |
|
4. |
STR |
10 µg |
>15 |
12-14 |
<11 |
|
5. |
TET |
30 µg |
>15 |
12-14 |
<11 |
|
6. |
CHL |
30 µg |
>18 |
13-17 |
<12 |
|
7. |
CLR |
15 µg |
>18 |
14-17 |
<13 |
|
8. |
LVX |
5 µg |
>31 |
21-30 |
<20 |
|
9. |
OFX |
5 µg |
>31 |
21-30 |
<20 |
|
10. |
GAT |
5µg |
>18 |
15-17 |
<14 |
|
11. |
CIP |
5 µg |
>31 |
21-30 |
<20 |
|
12. |
SXT |
25 µg |
>16 |
11-15 |
<10 |
|
13. |
AMP |
10 µg |
>17 |
14-16 |
<13 |
|
14. |
LIN |
2 µg |
>21 |
16-20 |
<15 |
|
15. |
AZM |
15 µg |
>18 |
14-17 |
<13 |
CRO, Ceftriaxone; AMX, Amoxicillin; GEN, Gentamycin; STR, Strptomycin; TET, Tetracyclin; CHL, Chloramphenicol; CLR, Clarithromycin; LVX, Levofloxacin; OFX, Ofloxacin; GAT, Gatifolxacin; CIP, Ciprofloxacin; SXT, Sulphamethoxazole+Trimethoprim; AMP, Ampicillin; LIN, Lincomycin; AZM, Azithromycin; S, sensitive; I, intermediate; R, resistance.
Detection of antibiotic resistance genes
A set of multiplex PCRs was used for identifying major resistance genes following the procedure as previously described (Kozak et al., 2009). The major genes conferring resistance for tetracycline [tet(A), tet(B), tet(C)], streptomycin (strA/strB, aadA and (aac(3)IV), gentamycin (aac(3)IV, aadB), sulfonamides (sul1, sul2 and sul3), and b-lactamases (blaCMY-2, blaTEM, blaSHV) were targeted. Primers and multiplex PCRs conditions used for detection of antibiotic resistance genes are given in the Table II. Multiplex PCR 1 was done using the following thermal cycling conditions: one cycle consisting of 15 min at 95°C, 30 cycles consisting of 1 min at 95°C, 1 min at 66°C, and 1 min at 72°C, and one cycle consisting of 10 min at 72°C. Multiplex PCR 2 and 3 were done using the following thermal cycling conditions:
Table II.- Primers and conditions used for antibiotic resistance genes.
|
PCR |
Gene |
Primer |
Sequence |
Final conc. of primer (M) |
Annealing temp (°C) |
Product size (bp) |
|
1 |
sul1 |
sul1-Fb |
CGGCGTGGGCTACCTGAACG |
0.2 |
66 |
433 |
|
sul1-Bb |
GCCGATCGCGTGAAGTTCCG |
0.2 |
||||
|
1 |
Sul2 |
sulII-Lc |
CGGCATCGTCAACATAACCT |
0.3 |
66 |
721 |
|
sulII-Rc |
TGTGCGGATGAAGTCAGCTC |
0.3 |
||||
|
1 |
Sul3 |
sul3-GKa-Fd |
CAACGGAAGTGGGCGTTGTGGA |
0.2 |
66 |
244 |
|
sul3-GKa-Rd |
GCTGCACCAATTCGCTGAACG |
0.2 |
||||
|
2 |
tet (A) |
TetA-Lc |
GGCGGTCTTCTTCATCATGC |
0.1 |
63 |
502 |
|
TetA-Rc |
CGGCAGGCAGAGCAAGTAGA |
0.1 |
||||
|
2 |
tet (B) |
TetBGK-F2m |
CGCCCAGTGCTGTTGTTGTC |
0.2 |
63 |
173 |
|
TetBGK-R2m |
CGCGTTGAGAAGCTGAGGTG |
0.2 |
||||
|
2 |
tet (C) |
TetC-Lc |
GCTGTAGGCATAGGCTTGGT |
0.5 |
63 |
888 |
|
TetC-Rc |
GCCGGAAGCGAGAAGAATCA |
0.5 |
||||
|
3 |
aadA |
4Fe |
GTGGATGGCGGCCTGAAGCC |
0.1 |
63 |
525 |
|
4Re |
AATGCCCAGTCGGCAGCG |
0.1 |
||||
|
3 |
strA/strB |
strA-Ff |
ATGGTGGACCCTAAAACTCT |
0.4 |
63 |
893 |
|
strB-Rf |
CGTCTAGGATCGAGACAAAG |
0.4 |
||||
|
3 |
aac(3)IV |
aac4-Lg |
TGCTGGTCCACAGCTCCTTC |
0.2 |
63 |
653 |
|
aac4-Rg |
CGGATGCAGGAAGATCAA |
0.2 |
||||
|
4 |
aadB |
aadB-Li |
GAGGAGTTGGACTATGGATT |
0.2 |
55 |
208 |
|
aadB-Ri |
CTTCATCGGCATAGTAAAAG |
0.2 |
||||
|
5 |
blaTM |
GKTEMFd |
TTAACTGGCGAACTACTTAC |
0.2 |
55 |
247 |
|
GKTEMRd |
GTCTATTTCGTTCATCCATA |
0.2 |
||||
|
5 |
blaSHV |
SHV-Fj |
AGGATTGACTGCCTTTTTG |
0.4 |
55 |
393 |
|
SHV-Rj |
ATTTGCTGATTTCGCTCG |
0.4 |
||||
|
5 |
blaCMY-2 |
CMYFd |
GACAGCCTCTTTCTCCACA |
0.2 |
55 |
1000 |
|
CMYRd |
GGACACGAAGGCTACGTA |
0.2 |
Table III.- Antibiotic resistance in E. coli Isolates along PSCP.
|
Anti- biotics |
No. of E. coli isolates resistant |
||||
|
Total (%) |
PF (%) |
SH (%) |
WM (%) |
SM (%) |
|
|
n=80 |
n=20 |
||||
|
LIN |
77(96.25) |
20(100) |
20(100) |
20(100) |
17(85) |
|
AMX |
66(82.5) |
19(95) |
19(95) |
16(80) |
12(60) |
|
TET |
51(63.75) |
13(65) |
18(90) |
11(55) |
9(45) |
|
AMP |
47(58.75) |
13(65) |
14(70) |
9(45) |
11(55) |
|
SXT |
40(50) |
8(40) |
16(80) |
8(40) |
8(40) |
|
CHL |
39(48.75) |
12(60) |
13(65) |
8(40) |
6(30) |
|
CLR |
29(36.25) |
11(55) |
4(20) |
10(50) |
4(20) |
|
STR |
20(25) |
5(25) |
6(30) |
6(30) |
3(15) |
|
GEN |
14(17.5) |
2(10) |
6(30) |
2(10) |
4(20) |
|
OFX |
12(15) |
1(5) |
7(35) |
3(15) |
1(5) |
|
CIP |
12(15) |
1(5) |
6(30) |
3(15) |
2(10) |
|
LFX |
10(12.5) |
1(5) |
6(30) |
2(10) |
1(5) |
|
AZM |
7(8.75) |
3(15) |
1(5) |
0(0) |
3(15) |
|
CRO |
5(6.25) |
0(0) |
4(20) |
0(0) |
1(5) |
|
GAT |
3(3.75) |
0(0) |
0(0) |
2(10) |
1(5) |
PF, pig farms; SH, slaughter house; WM, wet market; SM, super market. For abbreviations of antibiotics, see Table I.
one cycle consisting of 15 min at 94°C, 30 cycles consisting of 1 min at 94°C, 1 min at 63°C, and 1 min at 72°C, and one cycle consisting of 10 min at 72°C. Multiplex PCR 4 and 5 were done using the following thermal cycling conditions: one cycle consisting of 15 min at 94°C, 30 cycles consisting of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, and one cycle consisting of 10 min at 72°C.
Results
Antibiotic resistance
Antimicrobial resistance patterns were different according to origin of E. coli isolates. Resistance for LIN was the highest in overall (96.3%, 77/80) isolates as well as from pig farms (100%, 20/20) and different markets (100%, 20/20, 85%, 17/20) (Table III). Resistance for other antibiotics such as AMX, TET, AMP and SXT was found 82.5% (66/80), 63.7% (51/80), 58.7% (47/80) and 50% (40/80), respectively. Resistance for GAT and CRO was found the lowest in all the isolates. Resistance for other antibiotics was found different in the isolates obtained from the pig farms and different markets. Multiple antibiotic resistance was found (85%, 68/80) in over all isolates, being higher in the isolates from pig farms and slaughter houses (95%, 19/20) followed by super (85%, 17/20) and wet (75%, 15/20) as shown in Figure 1.
Antibiotic resistance genes (ARGs)
The prevalence of ARGs in E. coli isolates varied by origin of isolates and was higher in isolates from Slaughter houses (56.6% isolates) and pig farms (35.8% of isolates), which is consistent with the phenotypic data (Table III). The PCR results of ARGs are shown in Figures 1 and 2. Overall, the most common ARG was blaTEM (98.7%, 79/80), followed by tetA(58.7%, 47/80), tetB(55%, 44/80) and blaCMY-2 (52.5%, 42/80) (Table IV). The most prevalent ARGs in the isolates recovered from pig farms was blaTEM (100%, 20/20), followed by blaCMY-2 (80%, 16/20), tetA and tetB (60%, 12/20) and tetC (50%, 10/20). The isolates recovered from slaughter houses were also found different in ARGs as they possess higher prevalence of blaTEM (100%, 20/20), blaSHV (90%, 18/20), sulI (80%, 16/20), tet(A)(75%,15/20) and tet(B) (70%, 14/20). Likewise, the isolates from wet markets were higher in blaTEM (100%) followed by (55%, 11/20), tetA (50%, 10/20) and blaSHV and sulI (35%, 7/20). While the isolates from super market were higher in blaTEM (95%, 19/20) followed by tetA and tetC (50%, 10/20), and blaCMY-2and sulI (40%, 8/20). Interestingly all the isolates recovered from super market were found positive for blaTEM (100%).
Table IV.- Antibiotic resistant genes (ARGs) in E. coli isolates along PSCP.
|
ARGs |
Total (%) |
PF (%) |
SH (%) |
WM (%) |
SM (%) |
|
n=80 |
n=20 |
||||
|
tetA |
47 (58.75) |
12(60) |
15(75) |
10 (50) |
10(50) |
|
tetB |
44 (55) |
12 (60) |
14(70) |
11(55) |
7 (35) |
|
tetC |
30 (37.5) |
10 (50) |
6 (30) |
4 (20) |
10(50) |
|
aadA |
21 (26.25) |
5 (25) |
6 (30) |
4 (20) |
6 (30) |
|
strA/strB |
17 (21.25) |
5 (25) |
4 (20) |
4(20) |
4 (20) |
|
aac(3)IV |
6 (7.5) |
1 (5) |
1 (5) |
3 (15) |
1 (5) |
|
blaTEM |
79 (98.7) |
20 (100) |
20 (100) |
20 (100) |
19 (95) |
|
blaSHV |
18 (22.5) |
3(15) |
3 (15) |
7 (35) |
5 (25) |
|
blaCMY-2 |
42 (52.5) |
16(80) |
18 (90) |
0 (0) |
8(40) |
|
Sul1 |
39 (48.75) |
8 (40) |
16 (80) |
7 (35) |
8 (40) |
|
Sul2 |
18 (22.5) |
3 (15) |
7 (35) |
3(15) |
5(25) |
|
Sul3 |
37 (46.25) |
8 (40) |
16 (80) |
8 (40) |
5(25) |
|
aaddB |
2 (2.5) |
0(0) |
0(0) |
1 (5) |
1 (5) |
PF, pig farms; SH, slaughter house; WM, wet market; SM, super market.
Discussion
Because of intensive pig farming and vast supply chain in China, special attention needs to be given to pathogenic bacteria including E. coli (Cai et al., 2005; Normile, 2005). The ExPEC often belong to phylogenetic groups B2 and D (Clermont et al., 2000). These groups include potent human ExPEC isolates causing UTI, bacteremia and meningitis. UTI is one of the most common bacterial infections among women. It is primarily caused by ExPEC from the patient’s own fecal flora (Tan et al., 2011). The external sources of the ExPEC in humans are unknown. Pigs and pork meat may serve as a potential source. An increase in the antimicrobial resistance in bacterial pathogens including E. coli is a worldwide public health concern which is mainly associated with merciless use of antibiotics in production animals, and their subsequent transmission to human through animal food and food products (Foley and Lynne, 2008; Geimba et al., 2004). There are a variety of mechanisms through which these pathogens get resistance and among them ARGs is the most important. As for as antibiotic resistance is concerned, our study revealed that E. coli isolates along the PSCP are highly resistant for LIN (96.3%, 77/80) followed by AMX (82.5%, 66/80), TET (63.7%, 51/80), AMP (58.7% , 47/80) and SXT (50%, 40/80). Resistance for GAT (3.75%, 3/80) and CRO (6.25%, 5/80) was found the lowest in all the isolates. The isolates also revealed high MDR (85%, 68/80) along the PSCP. The prevalence of ARGs in E. coli isolates varied by origin of isolates and was higher in isolates from slaughter houses (56.6% isolates) and pig farms (35.8% of isolates), which is consistent with the phenotypic data. Overall, the most common resistance genes were blaTEM (98.7%, 79/80), followed by tetA (58.7%, 47/80), tetB (55%, 44/80) and blaCMY-2 (52.5%, 42/80). Different studies have described different antibiotic resistance in E. coli isolates. In one of the Canadian study, E. coli isolates from pork have been found high resistance for TET (31.5%) followed Sulfisoxazole (24.4%), AMP and STR (12.2%) and Kanamycin (9.8%) while among the ARGs, the most prevalent was tet (A) (24.4%) followed by aadA (22%), blaTEM (14.6%), tetB (12.2%), sul1, sul3 and strA/B (9.8%). E. coli isolates from diseased pigs from Guandong province have been found to have high multiple drug resistance (89%), and the highest resistance was found for sulphamethoxazole (95%), followed by tetracyclin (94%), chloramphenicol (89%) and streptomycin (84%) (Wang et al., 2010). Another study conducted in Shangdong province of China describing the spread of extended spectrum beta-lactamase (ESBL) resistance producing E. coli isolates from pigs to environment. These ESBL were found resistant to multiple drugs besides carrying both CTX-M and TEM resistant genes. These isolates from both pig farms and environment were found to carry the same CTM-X genes which is a clear indication of their transmission from farms to environment (Gao et al., 2015). Similarly, E. coli isolates from chicken in Western China have revealed high resistance trend for nalidix acid and ciprofloxacin, and decreasing resistance trend for gentamycin. About 49.8% isolates were resistant to more than eight antibiotics. Among the ARGs, tetA, tetB and blaTEM were constantly over 89.9% while aac3-II was 28.6% (Wang, 2013). A recent study on E. coli isolates from apparently healthy pigs in Japan have revealed high resistance for oxytetrayclin (62.4%) followed by dihydrosterptomycin (44.8%), trimethoprim (28.8%), Ampicilin (24.8%) and Chloramphenicol (20.8%). Our findings regarding antibiotic resistance and distribution of ARGS in E. coli isolates along the PSCP are not in consistent with the previous studies as mentioned earlier which may be due to many reasons including use of different antibiotics, different source of isolation and different location. However, there is an increasing and alarming trend in antibiotic resistance all over the world in the general and in China in particular which needs further surveillance for the control of this alarming situation.
Conclusion
Different phenotypic and genotypic antibiotic resistance prevail in E. coli isolates along the PSCP. Resistance for LIN was the highest in overall (96.3%, 77/80) isolates followed by AMX, AMP. The most prevalent ARGs in the isolates recovered from pig farms was blaTEM (100%, 20/20), followed by blaCMY-2 (80%, 16/20), tetA and tetB (60%, 12/20) and tetC (50%, 10/20). These isolates possess multiple drug resistance which is a matter of great concern for public health.
Acknowledgement
The project was supported by Key Lab. of Agriculture Microbiology, Huazhong Agriculture University, Wuhan, China.
Statement of conflict of interest
All authors declare no conflict of interest.
References
Cai, X., Chen, H., Blackall, J., Yin, Z., Wang, L. and Liu, Z., 2005. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol., 111: 231-236. https://doi.org/10.1016/j.vetmic.2005.07.007
Clermont, O., Olier, M., Hoede, C., Diancourt, L., Brisse, S. and Keroudean, M., 2011. Animal and human pathogenic E. coli strains share common genetic background. Infect. Genet. Evol., 11: 654-662. https://doi.org/10.1016/j.meegid.2011.02.005
Clermont, O., Bonacorsi, S. and Bingen, E., 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. environ. Microbiol., 66: 4555-4558. https://doi.org/10.1128/AEM.66.10.4555-4558.2000
Foley, S.L. and Lynne, A.M., 2008. Food animal associated Salmonella challenges: Pathogenicity and antimicrobials resistance. J. Anim. Sci., 86: 173-187. https://doi.org/10.2527/jas.2007-0447
Gao, P., He, S., Huang, S., Li, K., Liu, Z. and Xue, G., 2015. Impacts of coexisting antibiotics, antibacterial residues, and heavy metals on the occurrence of erythromycin resistance genes in urban wastewater. Appl. Microbiol. Biotechnol., 99: 3971-3980. https://doi.org/10.1007/s00253-015-6404-9
Geimba, M.P., Tondo, E.C., Oliver, F.A., Canal, C.W. and Brandelli, A., 2004. Serological characterization and prevalence of spvR genes in Salmonella isolated from foods involved in outbreak in Brazil. J. Fd. Protect., 67: 1229-1233. https://doi.org/10.4315/0362-028X-67.6.1229
Gilani, A.H., Khan, A., Ali, T. and Ajmal, S., 2008. Mechanisms underlying the anti-spasmodic and bronchodilatory properties of Terminalia bellerica. J. Ethnopharmacol., 116: 528-538. https://doi.org/10.1016/j.jep.2008.01.006
Jessica M.A.B., Webber, M.A., Baylay, A.J., Ogbolu, D.O. and Piddock, L.J.V., 2015. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol., 13: 42-51. https://doi.org/10.1038/nrmicro3380
Jiu, Y., Zhu, S., Khan, S.B., Sun, M., Zou, G., Meng, X., Wu, B., Zhou, R. and Li, S., 2017. Phenotypic and genotypic resistance of salmonella isolates from healthy and diseased pigs in China during 2008-2015. Microb. Drug Resist., 23: 651-659. https://doi.org/10.1089/mdr.2016.0132
Johnson, J.R. and Russo, T.A., 2002. Extra intestinal pathogenic Escherichia coli: The other bad E. coli. J. Lab. Clin. Med., 39: 155-162. https://doi.org/10.1067/mlc.2002.121550
Johnson, J.R., Delavari, P., O’Bryan, T.T., Smith, K.E. and Tatini, S., 2005a. Contamination of retail foods, particularly turkey, from community markets (Minnesota, 1999-2000) with antimicrobial-resistant and extra intestinal pathogenic Escherichia coli. Foodborne Pathog. Dis., 2: 38-49. https://doi.org/10.1089/fpd.2005.2.38
Johnson, J.R., Kuskowski, M.A., Smith, K., O’Bryan, T.T. and Tatini, S., 2005b. Antimicrobial- resistant and extra-intestinal pathogenic Escherichia coli in retail foods. J. Infect. Dis., 191: 1040-1049. https://doi.org/10.1086/428451
Kozak, G.K., Patrick, B., Nicol, J., Reid-Smith, R.J. and Jardine, C., 2009. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in Natural Environments in Ontario, Canada. Appl. environ. Microbiol., 75: 559-566. https://doi.org/10.1128/AEM.01821-08
Normile, D., 2005. WHO probes deadliness of China’s pig-borne disease. Science, 309: 1308-1309. https://doi.org/10.1126/science.309.5739.1308a
Khan, S.B., Zou, G., Cheng, Y.T., Xiao, R., Li, L., Wu, B. and Zhou, R., 2016. Phylogenetic grouping and distribution of virulence genes in Escherichia coli along the production and supply chain of pork around Hubei, China. J. Microbiol. Immunol. Infect., 50: 382-385. https://doi.org/10.1016/j.jmii.2016.03.006
Tan, C., Tang, X., Zhang, X., Ding, Y., Zhao, Z. and Wu, B., 2011. Serotypes and virulence genes of extra intestinal pathogenic Escherichia coli isolates from diseased pigs in China. Vet. J., 19: 483-488.
Wang, K., 2013. The expression of ABC efflux pump, Rv1217c–Rv1218c, and its association with multidrug resistance of Mycobacterium tuberculosis in China. Curr. Microbiol., 66: 222-226. https://doi.org/10.1007/s00284-012-0215-3
Wang, X.M., Jiang, H.X., Liao, X.P., Liu, J.H., Zhang, W.J., Zhang, H., Jiang, Z.G., Lü, D.H., Xiang, R. and Liu, Y.H., 2010. Antimicrobial resistance, virulence genes, and phylogenetic background in Escherichia coli isolates from diseased pigs. FEMS Microbiol. Lett., 306: 15-21. https://doi.org/10.1111/j.1574-6968.2010.01917.x