Incidence of blaIMP and blaVIM Genes among Carbapenemase Producing Escherichia coli in Lahore, Pakistan

Shafqat Husnain Khan1, Shah Jahan2, Irshad Ahmad3,4, Sadeeq ur Rahman5,* and Tayyab ur Rehman4,*

1Department of Pathology, Microbiology Section, Continental Medical College, Lahore, Pakistan

2Department of Immunology, University of Health Sciences, Lahore, Pakistan

3School of Biomedical Sciences and Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds, UK

4Institute of Basic Medical Sciences, Khyber Medical University, Peshawar, Pakistan

5College of Veterinary Sciences and Animal Husbandry, Abdul Wali Khan University, Mardan, Pakistan

ABSTRACT

Antibiotic drug resistance in E. coli is a worldwide health problem. Particularly, increasingly reported carbapenem resistance due to carbapenemases is highly worrisome. Literature regarding incidence of class B metallo-β-lactamases (MBLs) - producing E. coli has not yet judiciously been addressed. In this study, we investigated the occurrence of carbapenemase- and MBLs-producers among a collection of 100 carbapenem resistant E. coli obtained from a tertiary hospital at Lahore Pakistan. All carbapenemase producers were further investigated to identify frequency of blaIMP and blaVIM encoding genes. Results of modified hodge test identified 81% carbapenemase producers, while combined disc diffusion test identified 28 isolates as MBL producers among them. Of all carbapenemase producers, 25 isolates (30.8%) of carbapenemase-producing E. coli were found to harbor bla-VIM gene, while 13 isolates (16.04%) were found to carry blaIMP gene. We report on high incidence rate of carbapenemase producers among carbapenem resistant E. coli isolates.


Article Information

Received 06 December 2018

Revised 23 January 2019

Accepted 06 February 2019

Available online 10 June 2019

Authors’ Contributions

SHK and SJ performed the lab work. IA provided chemicals and reagents. SR wrote the manuscript. TR supervised and design the experiments.

Key words

Antibiotic resistance, Carbapenems, Echerichia coli, Metallo-β-lactamases, PCR amplification.

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.5.sc1

* Corresponding author: [email protected];

[email protected]

0030-9923/2019/0005-1959 $ 9.00/0

Copyright 2019 Zoological Society of Pakistan



All over the world, Antibiotic drug resistance (AMR) is emerging as a major health problem. Particularly resistant to carbapenem drug is highly worrisome as these drugs are considered to be the last resort for patients infected with multidrug resistant pathogens (Nordmann et al., 2012; Rahman et al., 2018a). The issue is even more serious in countries with less investment in health sectors and unrestricted regulations in drugs. In Pakistan, the irrational and indiscriminate use of antibiotics in hospitals and in general practices has led to the emergence of strains of bacteria that are resistant to one or more antibiotics (Ain et al., 2018; Amin et al., 2011; Khattak et al., 2018; Shah et al., 2017; Rahman et al., 2018b, c). There is a danger of the situation worsening because very few new antibiotic drugs are entering into clinical practice. Without effective action, it has been estimated that the worldwide death toll due to drug-resistant infections could reach 10 million by 2050 (https://amr-review.org/home.html).

Escherichia coli is one of the most important type of Enterobacteriaceae that causes urinary tract infections, respiratory tract infections, intestinal infections, septicemia and other hospital-acquired infections (Griffin and Tauxe, 1991). Empirical therapy using antibiotics has led E. coli to become resistant to different antibiotics, including carbapenems in E. coli recovered from human clinical settings, community and food animals (Adnan et al., 2017; Ali et al., 2016, 2017; Amin et al., 2011). Carbapenems are considered to be highly efficient against multidrug resistant E. coli and prescribed when other drugs do not respond. However, E. coli has developed various mechanisms of resistance including production of carbapenemase enzymes to inactivate carbapenem drugs (Nordmann et al., 2011; Aqil et al., 2018). The Ambler classification of β-lactamases (carbapenemases) describes four types (A, B, C, D) according to amino acid sequence homology with over 900 β-lactamases describes so far. Class B β-lactamases includes metallo β-lactamases enzymes that require zinc ions for enzymatic activity. All MBLs share a common feature of being inhibited by ethylenediaminetetraacetic acid (EDTA) and other metal chelating agents, due to their metal-dependent catalytic mechanism. The hydrolysis mechanism is unique for MBLs compared with other β-lactamases because no stable or pseudo-stable covalent intermediate is formed during hydrolysis. They are therefore not inhibited by classical serine β-lactamase inhibitors such as clavulanic acid, tazobactam and sulbactam (Meletis, 2016).

The first MBL was detected and studied in the environmental and opportunistic pathogenic bacterium Bacillus cereus (Lim et al., 1988). In Pakistan, the first MBL-producing strain was a Pseudomonas aeruginosa isolated from a patient with urinary tract infection in Rawalpindi (Butt et al., 2005). The bla-IMP and bla-VIM types of genes are considered to be important and widely reported MBLs (Nordmann et al., 2011; Toleman et al., 2005). Literature study suggested that the incidence bla-IMP and bla-VIM types of genes have been predominantly reported in Asia (Amudhan et al., 2012; Bahar et al., 2010). However, the prevalence of these two genes has not yet judiciously been highlighted in E. coli. Therefore, the current study was designed to investigate the occurrence of MBLs in a tertiary care hospital Lahore Pakistan. We report on high occurrence of carbapenemase-producing E. coli carrying bla-IMP and bla-VIM types of genes.

Materials and methods

This study was conducted between Sept 2017 and April 2018. A total of one hundred non duplicate E. coli isolates, which were found resistant to at least one carbapenem drug were obtained from collection of a tertiary care hospital at Lahore, Punjab Pakistan.. E. coli was reconfirmed on the basis of colonial characteristics and morphology and biochemically using an API 20E Test System for Enterobacteriaceae (bioMérieux, France). Antimicrobial susceptibility of isolates was tested by the Kirby-Bauer disc diffusion method using mueller-hinton agar (Oxoid, UK), according to Clinical Laboratory Standards Institute (CLSI). The antibiotic discs contained imipenem (10 µg) and meropenem (10 µg). Carbapenemase-producing E. coli were identified by the modified hodge test (Genc et al., 2016) and phenotypic detection of MBL was done by a combined disc diffusion method as per guidelines of Clinical laboratory Standard Institute (CLSI, 2016). In the combined disc test, if the increase in inhibition zone and imipenem-EDTA disc was ≥7 mm than the imipenem alone, the test was considered as MBL-positive.

Isolates found positive for carbapenemase production were subjected to PCR based identification for blaIMP and blaVIM using primers described in Table I. Plasmid DNA was extracted through plasmid isoaltion kit (TIANGEN Biotech Beijing, Co., Ltd.). The quality and quantity of extracted DNA was determined through nanodrop as well gel electrophoresis. Primers for PCR were synthesized by GeneLink, while master mix was purchased from Thermo Scientific. PCR reaction was performed in a total of 25µl reaction mixture. PCR was performed at a range of temperatures of 50-56°C and the optimum temperature was identified as 55°C.

 

Results and discussion

All E. coli isolates were picked up from carbapenem-resistant culture collection and were tested again against meropenem and imipenem antibiotics to ensure its resistance pattern against carbapenem drugs. Results showed that all of these 100 isolates of E. coli were carbapenem non-susceptible, all being resistant to imipenem (100%) and meropenem (100%). Out of these 100 isolates, 81 were found positive for carbapenemase production based on Modified Hodge Test, whilst only 28 isolates were phenotypically positive for MBL production. Our current observed incidence rate of carbapenemase production among imipenem-resistant E. coli is higher as compared to previous report of 37.1% from Lahore in 2015 (Ain et al., 2018). Furthermore, in the same study, Ain et al. (2018) observed an overall 63.38% frequency of occurrence of MBL among all clinical isolates as compared to 28% observed in our study (Ain et al., 2018). This suggests that in the current study, MBL incidence rate was found much lower as compared to previous study. This could be the strain difference, as we have only focused on E. coli while, Ain et al. (2018) studied overall prevalence among different strains including E. coli. Our results showed that 25 isolates (30.8%) of

 

Table I.- Primers used for PCR amplification of blaIMP and blaVIM genes.

Target gene

Primer

Primer sequence (5′- 3′)

Amplicon size (bp)

Reference

blaIMP

IMP-F

CTACCGCAGCAGAGTCTTTG

587 bp

Senda et al. (1996)

IMP-R

AACCAGTTTTGCCTTACCAT

blaVIM

VIM-F

AGTGGTGAGTATCCGACAG

261 bp

Mavroidi et al. (2000)

VIM-R

ATGAAAGTGCGTGGAGAC


 

carbapenemase-producing E. coli were found to harbor bla-VIM gene, while 13 isolates (16.04%) were found to carry blaIMP gene (Fig. 1). All PCR amplicon of the targeted genes were sequenced and confirmed through BLAST. A recent study from district Lahore concluded that of 100 carbapenem resistant isolates, 93 and 89 isolates were positive for carbapenemase and β-lactamase production, respectively, while, 3.3% of these isolates were found positive for bla-IMP and 32.5% were found positive for bla-VIM (Akhtar et al., 2018). Our results are corroborates with the result of studies reported in India, Madagascar and Brazil where 94.4%, 89.8% and 88.2% carbapenemase positivity was described among gram-negative bacteria, respectively (Amudhan et al., 2012; Andriamanantena et al., 2010; Franco et al., 2010). Other studies suggest widespread presence of carbapenemase encoding genes in other parts of Paksitan suggesting to initiate steps to discourage dissemination of these features. This suggest that incidence of carbapenemase producers are quite high with considerably proportion of strains carrying bla-IMP gene. The higher incidence rate of MBL and subsequent higher occurrence of bla-IMP and bla-VIM genes in our clinical isolates is possibly due to the ability of E. coli to capture novel resistance genes through horizontal recombination located on the conjugative plasmids. The absence of bla-IMP and bla-VIM genes in the rest of carbapenem resistant strains does reflect that other types of carbapenemase encoding genes may also be present in the vicinity. It is speculated that other types of carbapenemase encoding genes such blaNDM-1, blaOXA-48 etc. may also be widespread in the area and should be investigated. In conclusion, the results describe here indicate high prevalence of carbapenemase-producing E. coli which, if not properly managed, will present a devastating challenge for the health care system of Pakistan.

 

Conclusion

It is concluded that E. coli isolated from different patients at a tertiary care hospital at Lahore indicate high prevalence of carbapenemase production stains comprising MBL. Majority of these isolates were encoding bla-IMP and bla-VIM genes, however, possibility of existence of other genes cannot be rule out. Notably, bla-VIM gene was found more prevalent (30.8%) than the bla-IMP gene (16.04%). This suggests to restrict the use of carbapenem drugs in order to restrict further dissemination of resistance.

 

Acknowledgements

There was no funding available for the work.

 

Statement of conflict of interest

The authors have no conflicts of interest to report.

 

References

Adnan, M., Khan, H., Kashif, J., Ahmad, S., Gohar, A., Ali, A., Khan, M.A., Shah, S.S.A., Hassan, M.F. and Irshad, M., 2017. Pakistan Vet. J., 37: 230-232.

Ain, N.U., Iftikhar, A., Bukhari, S.S., Abrar, S., Hussain, S., Haider, M.H., Rasheed, F. and Riaz, S., 2018. Antimicrob. Resist. Infect. Contr., 7: 128. https://doi.org/10.1186/s13756-018-0417-y

Akhtar, J., Saleem, S., Shahzad, N., Waheed, A., Jameel, I., Rasheed, F. and Jahan, S., 2018. Pakistan J. Zool., 50: 2343-2349. https://doi.org/10.17582/journal.pjz/2018.50.6.2343.2349

Ali, T., Rahman, S., Zhang, L., Shahid, M., Zhang, S., Liu, G., Gao, J. and Han, B., 2016. Front. Microbiol., 7: 1931. https://doi.org/10.3389/fmicb.2016.01931

Ali, T., Rahman, S., Zhang, L., Shahid, M., Han, D., Gao, J., Zhang, S., Ruegg, P.L., Saddique, U. and Han, B., 2017. Oncotarget, 8: 90144. https://doi.org/10.18632/oncotarget.21496

Amin, A., Khan, M.A., Azam, S.M.F. and Haroon, U., 2011. J. Ayub med. Coll. Abbottabad, 23: 19-22.

Amudhan, M.S., Sekar, U., Kamalanathan, A. and Balaraman, S., 2012. J. Infect. Devel. Count., 6: 757-762.

Andriamanantena, T.S., Ratsima, E., Rakotonirina, H.C., Randrianirina, F., Ramparany, L., Carod, J.F., Richard, V. and Talarmin, A., 2010. Annls. clin. Microbiol. Antimicrob., 9: 17. https://doi.org/10.1186/1476-0711-9-17

Aqib, A.I., Nighat, S., Ahmed, R., Sana, S., Jamal, M.A., Kulyar, M.F.A., Khan, N.U., Sarwar, M.S., Hussain, M.A., Asadullah, Rahman, A. and Rahman, S., 2019. Pakistan J. Zool., 51: 307-315. http://dx.doi.org/10.17582/journal.pjz/2019.51.1.307.315

Bahar, M.A., Jamali, S. and Samadikuchaksaraei, A., 2010. Burns, 36: 826-830. https://doi.org/10.1016/j.burns.2009.10.011

Butt, T., Usman, M., Ahmad, R.N. and Saif, I., 2005. J. Pakistan med. Assoc., 55: 302-304.

CLSI., 2016. Performance standards for antimicrobial susceptibility testing. Clinical and Laboratory Standard Institute, CLSI document, Wayne, PA. pp. M100–S124.

Franco, M.R.G., Caiaffa-Filho, H.H., Burattini, M.N. and Rossi, F., 2010. Clinics, 65: 825-829. https://doi.org/10.1590/S1807-59322010000900002

Genc, O., Aksu, E. and Gulcan, A., 2016. J. Microbiol. Meth., 125: 8-11. https://doi.org/10.1016/j.mimet.2016.03.010

Griffin, P.M. and Tauxe, R.V., 1991. Epidemiol. Rev., 13: 60-98. https://doi.org/10.1093/oxfordjournals.epirev.a036079

Hasan, B., Perveen, K., Olsen, B. and Zahra, R., 2014. J. med. Microbiol., 63: 50-55. https://doi.org/10.1099/jmm.0.063925-0

Khattak, I., Mushtaq, M.H., Ayaz, S., Ali, S., Sheed, A., Muhammad, J., Sohail, M.L., Amanullah, H., Ahmad, I. and Rahman, S., 2018. Adv. exp. Med. Biol., 1057: 111-126. https://doi.org/10.1007/5584_2018_170

Lim, H., Pene, J. and Shaw, R., 1988. J. Bact., 170: 2873-2878. https://doi.org/10.1128/jb.170.6.2873-2878.1988

Mavroidi, A., Tsakris, A., Tzelepi, E., Pournaras, S., Loukova, V. and Tzouvelekis, L.S., 2000. J. Antimicrob. Chemother., 46: 1041-1043. https://doi.org/10.1093/jac/46.6.1041

Meletis, G., 2016. Therap. Adv. Infect. Dis., 3: 15-21. https://doi.org/10.1177/2049936115621709

Nordmann, P., Naas, T. and Poirel, L., 2011. Emerg. Infect. Dis., 17: 1791. https://doi.org/10.3201/eid1710.110655

Nordmann, P., Dortet, L. and Poirel, L., 2012. Trends mol. Med., 18: 263-272. https://doi.org/10.1016/j.molmed.2012.03.003

Rahman, S., Ali, T., Ali, I., Khan, N.A., Han, B. and Gao, J., 2018a. Biomed Res. Int., 2018: 9519718. https://doi.org/10.1155/2018/9519718

Rahman, S., Ali, T., Muhammad, N., Umer, T., Ahmad, S., Ayaz, S. and Han, B., 2018b. In: 2018 15th International Bhurban Conference on Applied Sciences and Technology (IBCAST). IEEE, pp. 203-214. https://doi.org/10.1109/IBCAST.2018.8312224

Rahman, S., Ahmad, S., Khan, I. and Pakistan, P., 2018c. Pak. Vet. J., 39: 116-120. https://doi.org/10.29261/pakvetj/2018.091

Sartor, A.L., Raza, M.W., Abbasi, S.A., Day, K.M., Perry, J.D., Paterson, D.L. and Sidjabat, H.E., 2014. Antimicrob. Agents Chemother., 58: 5589-5593. https://doi.org/10.1128/AAC.02425-14

Senda, K., Arakawa, Y., Ichiyama, S., Nakashima, K., Ito, H., Ohsuka, S., Shimokata, K., Kato, N. and Ohta, M., 1996. J. clin. Microbiol., 34: 2909-2913.

Shah, M.K., Saddique, U., Ahmad, S., Hayat, Y., Rahman, S., Hassan, M.F. and Ali, T., 2017. Small Rumin. Res., 153: 118-122. https://doi.org/10.1016/j.smallrumres.2017.06.002

Toleman, M.A., Biedenbach, D., Bennett, D.M., Jones, R.N. and Walsh, T.R., 2005. J. Antimicrob. Chemother., 55: 61-70. https://doi.org/10.1093/jac/dkh512