Transformation Efficiency of Five Agrobacterium Strains in Diploid and Tetraploid Potatoes
Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh*
Department of Agricultural Genetic Engineering, Faculty of Agricultural Sciences and Technologies, Nigde Omer Halisdemir University, Nigde, Turkey
Abstract | Development of transgenic potatoes is imperative to investigate various gene functions as well as to develop robust potato varieties resistant to different biotic and abiotic stresses, specially in diploid potato and to redirect the breeding program away from tetraploids to the diploids. We aimed to develop the protocol for transformation of Solanum chacoense diploid M6 potato using tetraploid S. tuberorsum cv. Desiree as a control using five different Agrobacterium strains harboring pBIN19 binary vector that further contains gusA gene, interrupted by an intronic sequence, under the control of 35S CaMV promoter. After transformation, we analyzed the transformation efficiencies of each of the Agrobacterium strains using the histochemical GUS analysis. The highest gusA gene transfer efficiency rate both for leaf (60%) and internode (100%) explants was observed in cv. Desiree using Agrobacterium strain GV2260, while the highest gene transfer efficiency rate for leaf and internode explants in S. chacoense M6 were obtained with AGL1. The highest callus formation for both cv. Desiree and S. chacoense M6 was obtained on cv. Desiree leaf explants, transformed via the Agrobacterium strain GV2260. The lowest callus formation, for both S. chacoense M6 and cv. Desiree, were obtained from internode explants. About 33% calli induction was achieved from transformation mediated by AGL1 strain in cv. Desiree, and about 23 % from LBA4404 strain in S. chacoense M6. This study will further aid in the development of stable transgenic potatoes, especially in diploid cultivars.
Received | September 02, 2019; Accepted | November 15, 2019; Published | November 26, 2019
*Correspondence | Allah Bakhsh, Department of Agricultural Genetic Engineering, Faculty of Agricultural Sciences and Technologies, Nigde Omer Halisdemir University, Nigde, Turkey; Email: [email protected]
Citation | Dönmez, B.A., S.D. Dangol and A. Bakhsh. 2019. Transformation efficiency of five Agrobacterium strains in diploid and tetraploid potatoes. Sarhad Journal of Agriculture, 35(4): 1344-1350.
DOI | http://dx.doi.org/10.17582/journal.sja/2019/35.4.1344.1350
Keywords | Potato, Diploid, Tetraploid, Agrobacterium-mediated transformation
Introduction
Potato is a food crop bearing tubers and a very important crop when it comes to food security, historically cultivated in Europe, North America, former soviet countries, later adopted in other parts of the world. Potato is now the fourth-most crucial crop globally (Hong et al., 2017; Craze et al., 2018). According to FAOSTAT (2017), 388.19 megatonnes of potatoes are being produced globally, grown in an area of 193026.42 square kilometers. As per Turkish Statistical Institute (TUIK, 2017), 4.55 megatonnes of potatoes are grown in Turkey in an area of 13,593.73 square kilometers annually.
The cultivated potatoes are tetraploids (2n=4x=48) and heterozygous, as well as its breeding is challenged by inbreeding depression and its ploidy level has been implicated to decreased fertility (Nadolska-Orczyk et al., 2006; Leisner et al., 2018). In addition, cultivated potatoes are highly tetrasomic, and its tetraploidy makes it a challenging crop in molecular biology research. This is specially true in gene editing studies, where targeting all alleles at a given time to generate homozygous mutation is quite challenging compared to diploids. Heterozygosity of tetraploid potato can also be challenging during gene editing experiments and subsequent next generation sequencing (NGS). Sufficient information is available on the failure of bioinformatic tools to detect CRISPR-mediated real mutation, confusing them with errors (Dangol et al., 2019).
Solanum chacoense M6 potato can be a good choice owing to its diploidy, homozygosity (developed by selfing S. chacoense for seven generations), self-compatibility (Sli gene that inhibits gametophytic self-incompatibility), elevated dry matter content, disease resistances and chip-processing qualities. The diploid potatoes could be beneficial if we can generate inbred lines for cultivated breeding with desired traits (Jansky et al., 2014; Enciso-Rodriguez et al., 2019; Hosaka and Hanneman, 1998). Very recently, whole genome sequencing of diploid S. chacoense M6 potato has been performed (Leisner et al., 2018). The availability of whole genome sequence makes S. chacoense M6 potato more important in molecular biology research. Therefore, focusing potato research on diploid S. chacoense M6 potatoes seems a way forward in achieving food security.
Agrobacterium-mediated transformation of S. tuberosum cv. Desiree has been pioneered long ago (Ooms et al., 1985; Tavazza et al., 1988; Visser, 1991) and several efficient transformation protocols have been described since then (Haesaert et al., 2015; Craze et al., 2018). Therefore, it has become a choice of cultivar as a control. So far, no reports have been made on diploid S. chacoense M6 potato with respect to its genetic transformation using Agrobacterium-mediated transformation. A similar study has been conducted in Nicotiana tabacum plant using the five different Agrobacterium strains containing nptII and gusA genes (Bakhsh et al., 2014) and in tomato using four different Agrobacterium strains harboring nptII and uidA gene in the binary vector (Chetty et al., 2013).
In this paper, we compared efficiencies of five different Agrobacterium strains in S. chacoense M6 diploids and cultivated tetraploid potato cv. Desiree, scrutinized its calli inducing rates and percentages of histochemical GUS stainings for each of the five Agrobaterium strain.
Materials and Methods
Plant material
Tetraploid cv. Desiree and diploid inbred line S. chacoense M6 potatoes were cultured in MS medium in growth chamber at 24±2ºC under fluorescent light at 100 µmol m-2s -1 with 16/8 hour (light/dark) photoperiod. Internodes and leaves were used as explants for the transformation experiments.
Agrobacterium-mediated transformation
Five different Agrobacterium strains were used for the experiment, namely GV2260, GV3101, LBA4404, AGL1 and EHA105. Electroporation of the plasmid pBIN19 vector (Figure 1) containing reporter gene p35S Gus-INT and nptII gene as a selection marker, was conducted in each of the Agrobacterium competent strains using Bio-Rad electroporation device ‘Gene Pulser XCell’. The transformed cells were plated on LB medium containing kanamycin (50 mg L-1) at 28 ºC for 2 days. The transformation of cells was confirmed using gusA gene specific primers (FP: 5’ CCCTTACGCTGAAGAGATGC 3’ and RP: 5’ GAGCGTCGCAGAACATTACA 3’). One single isolated colony from each of the positive transformed strains were inoculated to 10 mL LB broth (kanamycin 50 mg L-1), grown overnight and used for transformation of leaf explants at the OD600 value of 0.8. Each of the cultures was centrifuged at 5000 rpm for 10 mins at 4° C and the pellet was resuspended in 10 mL of MS broth. Following infection for 30 min, co-cultivation was performed for two days on MS medium containing 100 mg L-1 acetosyringone and 0.8 % agar.
Callus induction media (CIM)
The transformation was performed in three replicates for each of the five strains for leaf and internode explants, each replicate contained both explants.
After two days, explants were washed in distilled water containing antibiotic (Sulcid) for 15 minutes to kill Agrobacterium from the surface of the explants. After drying the explants on filter papers, two different callus inducing media (CIM) were used for each variety CIM-1 (2 mg L-1 BAP, 0.2 mg L-1 NAA, 1 mgL-1 transzeatin, 1 mg L-1 kinetin, 25 mg L-1 kanamycin and300 mgL-1 sulcid) composition was used for cv. Desiree explants while CIM-2 1 (2 mg L-1 BAP, 2 mg L-1 NAA, 25 mg L-1 kanamycin and 300 mgL-1 sulcid) was used for S. chacoense M6 explants. Data for callus induction was recorded and presented as %age.
Histochemical gus analyses
For detection of gusA gene, GUS solution was prepared (1 Mm X-gluc, 10mM EDTA, 100mM NaH2PO4, 0.1% Triton X-100, 50% methanol and 100 µg/ml Chloramphenicol; pH 8). We checked the histochemical GUS staining of leaf and internode explants co-cultivated for 2 days (one experiment), and on CIM cultivated for 6 weeks in three replicates. The explants grown on CIM were used for the calculation of GUS positive transformation rate. Explants grown on co-cultivation media as well as three replicates of each of the five different Agrobacterium transformed explants were treated with GUS solution in an eppendorf tube at 37o C overnight under dark condition. Next day, the explants were washed twice with ethanol and observed under the microscope.
Results and Discussion
Colony PCR was performed using gusA gene specific primers to confirm positive clones prior to the transformation of the explants (Data, not shown).
Callus induction rate
Three to four weeks later, callus formation from various explants in each of the three replicates was observed and relevant data (histochemical gus analysis percentages and calli inducing rates) was recorded from each of the plates. Percentage of callus induction from leaf and internode explants for S. chacoense M6 and cv. Desiree potatoes were calculated (Figures 2 and 3). In cv. Desiree, AGL1 Agrobacterium strain showed maximum callus induction efficiency from internodes (33.33%), followed by GV2260 (16.7%), EHA105 (15.56%), LBA4404 (13.46%), and GV3101 (12.07%). The percentage of maximum callus induction efficiency for leaf explants was 64.58% for GV2260 strain followed by LBA4404 (51.79%), EHA105 (47.73%), GV3101 (18%) and AGL1 (16.33%) (Figure 2).
In S. chacoense M6, maximum callus induction efficiency was induced by LBA4404 Agrobacterium strain from internodes (23.81%) followed by GV3101 (21.82%), GV2260 (21.43%), EHA105 (11.9%), and AGL1 (8.51%). The percentage of maximum callus induction efficiency for leaf explants in S. chacoense M6 was achieved at 88.1% in GV2260 strain followed by LBA4404 (77.78%), GV3101 (60.78%), AGL1 (54.84%) and EHA105 (53.33%) (Figure 3).
Histochemical GUS analysis
Transformed explants were tested for GUS expression using histochemical analysis according to the procedure described by Jefferson et al. (1987). For cv. Desiree internodal explants, Agrobacterium strain GV2260 gave the best results with 100% of GUS positive transformation efficiency, followed by AGL1 (87%), LBA4404 (60%), EHA105 (47%) and GV3101 (7%). No GUS staining was found on leaf explants transformed with AGL1 and GV3101. However, GV2260 gave the best GUS result in leaf explants with 60% GUS transformation, followed by EHA105 (13.33%) and LBA4404 (6.67%) (Figures 4 and 5).
GUS transformation rates in leaf and internode explants with different Agrobacterium strains were calculated for both S. chacoense M6 and cv. Desiree to elucidate the best Agrobacterium strain (among five) suitable for higher transformation rate in cv. Desiree and S. chacoense M6. For S. chacoense M6 internodal explants, Agrobacterium strain AGL1 showed the best GUS analysis result (100%), followed by GV2260 (93.33%), LBA4404 (93.33%), EHA105 (66.67%) and GV3101 (6.67%). For leaf explants, again AGL-1 and GV2260 Agrobacterium strains showed the highest percentage of GUS positive transformed plants (100%), EHA105 (93.33%), LBA4404 (80%), and GV3101 (20%) (Figures 6 and 7).
The high heterozygous nature of domesticated tetraploid potatoes renders challenges for functional genomics studies due to its allelic diversity. In such crop species, diploid potato such as S. chacoense M6 could be a viable option both in molecular biology as well as breeding program (Dangol et al., 2019; Enciso-Rodriguez et al., 2019). Further, when the whole genomic sequence of diploid S. chacoense M6 is already available in the potato genomic database (Leisner et al., 2018), it can be a model crop plant for the study of potatoes. As S. chacoense M6 transformation protocol has not been established yet, and as cv. Desiree transformation is more efficient and well-established (Ooms et al., 1985; Tavazza et al., 1988; Visser, 1991; Haesaert et al., 2015; Craze et al., 2018), we aimed to compare the Agrobacterium strains for S. chacoense M6 potato using cv. Desiree as a control.
In this study, various Agrobacterium strains (harboring beta-glucuronidase gusA gene interrupted by an intronic sequence under the control of 35S CaMV promoter in the plasmid pBIN19) were used to transform S. chacoense M6 leaf and internode explants using cv. Desiree cultivar as control. For this, we used various strains available in our laboratory (AGL1, GV2260, GV3101, LBA4404 and EHA105) and in-house protocol was followed (Bakhsh et al., 2014). The CaMV 35S promoter was for ubiquitous expression of the gusA gene. In this experiment during the transformation process, kanamycin antibiotic for antimicrobial resistance was used as a selective marker as it has been found to have higher efficiency in transformation experiments (McCormick et al., 1986; Bakhsh et al., 2014). GUS solution was used for the screening of the transformed explants and the stained explants were observed under the microscope.
The highest gusA gene transfer efficiency rate in cv. Desiree was found in leaf (60%) and internode (100%) explants mediated by the Agrobacterium strain GV2260. In S. chacoense M6, the highest gene transfer efficiency rate both for both leaf and internode explants was obtained from Agrobacterium strain AGL1 (100%). Combining both the gene transfer efficiency data for cv. Desiree and S. chacoense M6, the highest gusA gene efficiency was obtained with Agrobacterium strain GV2260, and the lowest gusA gene efficiency was obtained with Agrobacterium strain GV3101. The highest callus formation for explants was obtained on S. chacoense M6 leaf explants (88%) using Agrobacterium strain GV2260 and with cv. Desiree leaf explants (64%) using GV2260 strain. In cv. Desiree, the highest callus formation data was obtained from internode explants using AGL1 strain (with 33%). In S. chacoense M6, the highest callus formation data was obtained from internode explants (23%) using LBA4404 strain. The reason for obtaining high callus formation data from leaf explants could be due to the inoculation process, for its appropriate surface area for transformation as compared to the internode explants which were quite thinner, lacked usual thickness and tender.
In previous studies on tomato using various Agrobacterium strains (Chetty et al., 2013), highest transformation rate (65%) was observed with the Agrobacterium strain GV3101. In their study, Agrobacterium strain EHA105 was defined to be more efficient compared with GV3101 strain. In their experiment, inoculation time was limited to 20 minutes. The differences arising between these two studies could be mainly related to the type of strains used, plasmid type, and the inoculation time used for transformation. Hence, the discrepancy might have arisen in these two studies. In the study conducted by Chetty et al. (2013), the highest transformation efficiency rate was obtained in cotyledon explants with GV3101 strain. In our experiment, we didn’t use the cotyledon explants; the lowest transformation efficiency rate was found in internode explants with GV3101 strain in cv. Desiree, whereas in S. chacoense M6 the lowest efficiency rate was obtained in the internode explants with GV3101 strain.
From our experiment overall, we can see that GV2260 is the most suitable strain for callus induction in cv. Desiree and S. chacoense M6 explants, although LBA4404 was found to be better in S. chacoense M6 internode explants and AGL1 in cv. Desiree internode explants. However, the efficiency of LBA4404 is not consistenly high for all the explants in cv. Desiree and S. chacoense M6. The highest callus formation data obtained from internode explants inoculated with LBA4404 in S. chacoense M6 internode explant was 23%.
GUS histochemical analysis revelaed that AGL1 was the best for transformation in near similarity with GV2260 strain in S. chacoense M6. In cv. Desiree, the best histochemical GUS transformation was found to be in GV2260. The highest gene transfer efficiency rate for all the explants used in diploid S. chacoense M6 was obtained from AGL1 (100%). The highest callus induction rate for explants was obtained in S. chacoense M6 leaf explants with the inoculation from GV2260 (88%). Furthermore, there is a genotype-specific requirement in terms of hormonal composition and their concentrations, which renders the suitable transformation and regeneration protocol to be predicted in advance for a particular genotype fundamentally impossible (Visser, 1991). This could be the reason for different responses of Agrobacterium strains in various explants in terms of their transformation efficiency.
We recommend GV2260 and AGL1 to be better strain for further experiments in optimizing the transformation protocol for diploid S. chacoense M6 potato. However, AGL1 has been reported to be a hypervirulent strain (Anand et al., 2019).
Conclusions and Recommendations
We have compared the transformation efficiency of diploid S. chacoense M6 potato using cv. Desiree as a control using five different Agrobacterium strains. We found that GV2260 could be the best strain to transform diploid S. chacoense M6 potato based on their overall callus inducing performance as well as histochemical data records. This study can further aid in developing the optimization protocol for the stable plant transformation in diploid S. chacoense M6 potato using the strain we have recommended.
Acknowledgments
Mr. Sarbesh Das Dangol is a TUBITAK (Scientific and Technological Council of Turkey) fellow availing Graduate Scholarship Programme for International Students-2215 (PhD). The support of TUBITAK is highly acknowledged. We are very grateful to Dr. Abdellah Barakate for his generous willingness to provide us with the diploid inbred line S. chacoense M6 seeds from the James Hutton Institute, Dundee, UK, for which we also sought permission from United States Department of Agriculture (USDA) for the germplasm transfer.
Novelty Statement
The present study focuses on the development of the transgenic Solanum chacoense diploid M6 potato, which could be helpful in developing potato varieties resistant to biotic/abiotic stresses; the development of transgenic potato especially M6 is imperative in that the whole genome has been sequenced and this plant is homozygous as well as self-compatible. Developing a transgenic line for such a crop is quite important in po-tato breeding and hasn’t been reported before.
Author’s Contributıon
Betul Ayça Dönmez completed her BS thesis out of the data obtained from this research work. The establishment of genetic transformation system in diploid inbred line M6 is one of objective of PhD thesis work of Sarbesh Das Dangol who wrote the article. The research work was conceptualized and supervised by Allah Bakhsh.
References
Anand, A., E. Wu, Z. Li, S. TeRonde, M. Arling, B. Lenderts, J.S., Mutti, W., Gordon-Kamm, T.J., Jones and N.D., Chilcoat.. 2019. High efficiency Agrobacterium-mediated site-specific gene integration in maize utilizing the FLP-FRT recombination system. Plant. Biotechnol. J. 17(8): 1636-1645.
Bakhsh, A., E. Anayol and S. Ozcan. 2014. Comparison of transformation efficiency of five Agrobacterium tumefaciens strains in Nicotiana Tabacum L. Emir. J. Food Agric. 26 (3): 259-264. https://doi.org/10.9755/ejfa.v26i3.16437
Chetty, V.J., N. Ceballos, D. Garcia, J. Narváez-Vásquez, W. Lopez and M.L. Orozco-Cárdenas. 2013. Evaluation of four Agrobacterium tumefaciens strains for the genetic transformation of tomato (Solanum lycopersicum L.) cultivar Micro-Tom. Plant Cell Rep. 32(2): 239-247. https://doi.org/10.1007/s00299-012-1358-1
Craze, M., R. Bates, S. Bowden and E.J. Wallington. 2018. Highly efficient Agrobacterium-mediated transformation of potato (Solanum tuberosum) and production of transgenic microtubers. Curr. Prot. Plant Biol. 3: 33–41. https://doi.org/10.1002/cppb.20065
Dangol, S.D., A. Barakate, J. Stephens, M.E. Caliskan and A. Bakhsh. 2019. Genome editing of potato using CRISPR technologies: current development and future prospective. Plant Cell Tissue Organ Cult. 139:403-416.
Enciso-Rodriguez, F., N.C. Manrique-Carpintero, S.S. Nadakuduti, C.R. Buell, D. Zarka and D.S. Douches. 2019. Overcoming self-incompatibility in diploid potato using CRISPR-Cas9. Front. Plant Sci. 10: 376. https://doi.org/10.3389/fpls.2019.00376
FAOSTAT. 2017. https://www.fao.org/faostat/en/#data/QC/visualize. Retrieved on August 7, 2019.
Haesaert, G., J.H. Vossen, R. Custers, M. De Loose, A. Haverkort, B. Heremans, R. Hutten, G. Kessel, S. Landschoot, B. Van Droogenbroeck and R.G. Visser. 2015. Transformation of the potato variety Desiree with single or multiple resistance genes increases resistance to late blight under field conditions. Crop Protect. 77: 163-175. https://doi.org/10.1016/j.cropro.2015.07.018
Hong, Z., X. Fen, W. Yu, H. Hong-hai and D. Xiao-feng. 2017. Progress of potato staple food research and industry development in China. J. Integ. Agric. 16(12): 2924-2932. https://doi.org/10.1016/S2095-3119(17)61736-2
Hosaka, K. and R.E. Hanneman. 1998. Genetics of self-compatibility in a self-incompatible wild diploid potato species Solanum chacoense. 1. Detection of an S locus inhibitor (Sli) gene. Euphytica. 99: 191-197.
Jansky, S.H., Y.S. Chung and P. Kittipadukal. 2014. M6: a diploid potato inbred line for use in breeding and genetics research. J. Plant Regis. 8(2): 195-199. https://doi.org/10.3198/jpr2013.05.0024crg
Jefferson, R.A., T.A. Kavanagh and M.W. Bevan, 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6(13):3901–3907.
Leisner, C.P., J.P. Hamilton, E. Crisovan, N.C., Manrique-Carpintero, A.P., Marand, L., Newton, G.M., Pham, J. Jiang, D.S., Douches, S.H., Jansky and C.R., Buell. 2018. Genome sequence of M6, a diploid inbred clone of the high-glycoalkaloid-producing tuber-bearing potato species Solanum chacoense, reveals residual heterozygosity. Plant J. 94: 562-570. https://doi.org/10.1111/tpj.13857
McCormick, S., J. Niedermeyer, J. Fry, A. Barnason, R. Horsch and R. Fraley. 1986. Leaf disc transformation of cultivated tomato (L. sculentum) using Agrobacterium tumefaciens. Plant Cell Rep. 5: 81–84. https://doi.org/10.1007/BF00269239
Nadolska-Orczyk, A., A. Pietrusinska, A. Binka-Wyrwa, D. Kuc and W. Orczyk. 2006. Diploid potato (Solanum tuberosum L.) as a model crop to study transgene expression. Cell Mol. Biol. Lett. 12(2): 206–219. https://doi.org/10.2478/s11658-006-0064-9
Ooms, G., A. Karp, M.M. Burrell, D. Twell and J. Roberts. 1985. Genetic modification of potato development using Ri T-DNA. Theor. Appl. Genet. 70(4): 440-446. https://doi.org/10.1007/BF00273752
Tavazza, R., M. Tavazza, R.J. Ordas, R.J, G. Ancora and E. Benvenuto. 1988. Genetic transformation of potato (Solanum tuberosum): an efficient method to obtain transgenic plants. Plant Sci. 59: 175-182. https://doi.org/10.1016/0168-9452(89)90135-0
TUIK. 2017. https://www.tuik.gov.tr/PreTablo.do?alt_id=1001. Retrieved on August 28, 2019.
Visser, R.G. 1991. Regeneration and transformation of potato by Agrobacterium tumefaciens. In Plant tissue culture manual, Springer, Dordrecht. pp. 301-309. https://doi.org/10.1007/978-94-009-0103-2_16