Campylobacter Species Isolated from Chickens in Egypt: Molecular Epidemiology and Antimicrobial Resistance
Nahed H. Ghoneim, Maha A. Sabry, Zeinab S. Ahmed and Esraa A. Elshafiee*
Zoonoses Department, Faculty of Veterinary Medicine, Cairo University, Egypt
ABSTRACT
Campylobacter is one of the most important zoonotic bacterium and the leading cause of human gastroenteritis worldwide. To investigate the occurrence and antimicrobial resistance of this pathogen, a total of 360 chicken cloacal swabs and 15 water samples were gathered from different localities in Giza and Cairo Governorates. An additional 50 stool specimens were collected from individuals in contact with the examined chickens. Eleven Campylobacter isolates were recovered through bacteriological examination. Campylobacter spp. were identified by polymerase chain reaction (PCR) as C. jejuni (63.6 %) and C. coli (36.4 %) through the detection of the Map A and Ceu E genes, respectively. The antibiotic resistance of the Campylobacter isolates was determined via the disc diffusion method and was observed most frequently to nalidixic acid (81.8 %), tetracycline (72.7 %), ciprofloxacin (54.5 %), and erythromycin (54.5 %), while low resistance to ceftriaxone (18.2 %) was detected. Among the 11 Campylobacter isolates, 9 isolates were multidrug resistant (MDR). The tet (O) gene, which is responsible for tetracycline resistance, was detected in only 6 isolates. Phylogenetic analysis of the tet (O) gene sequences recovered from the C. jejuni isolates revealed that the strains isolated from chickens and drinking water from the same farm were identical. However, the sequence of the tet (O) gene from human isolates was highly similar to that from drinking water isolates. Our findings highlight the presence of MDR Campylobacter strains in chickens and the role of drinking water as a potential reservoir for tetracycline-resistant isolates. Therefore, regular monitoring of resistance is required, and increased attention should focus on preventing the transmission cycle of such emerging pathogens between different ecosystems to avoid public health hazards.
Article Information
Received 24 March 2019
Revised 20 May 2019
Accepted 06 August 2019
Available online 28 February 2020
Authors’ Contribution
NHA, ZSA, EAE and MAS presented the concept. NHA, EAE and MAS wrote the manuscript. ZSA: prepared the samples and applied bacteriological examination and PCR assay. EAE helped in laboratory work.
Key words
C. jejuni, C. coli, MDR, tet (O), Chicken, Human
DOI: https://dx.doi.org/10.17582/journal.pjz/20190324080346
* Corresponding author: [email protected]
0030-9923/2020/0003-0917 $ 9.00/0
Copyright 2020 Zoological Society of Pakistan
INTRODUCTION
Campylobacter is among the most prevalent causes of human gastroenteritis and is responsible for a significant number of foodborne illnesses and deaths (CDC, 2016; Nyachuba, 2010). Thermophilic C. jejuni, C. coli, C. lari, and C. upsaliensis are considered the most important species implicated in foodborne illness (EFSA, 2013).
The majority of Campylobacter infections in humans are associated with poor handling practices or the consumption of undercooked chicken (Doorduyn et al., 2010). Campylobacter infections produce little or no clinical diseases in poultry (Luangtongkum et al., 2006). However, the colonization of the intestinal tract of market-age chickens by Campylobacter may lead to the heavy contamination of their carcasses in processing plants (Jeffrey et al., 2001). Other routes of infection include contact with pets, exposure to farm animals, and the consumption of raw milk, untreated water, and undercooked beef, pork and shellfish (DuPont, 2007).
Campylobacteriosis in humans is usually characterized by self-limiting watery/bloody diarrhoea, abdominal cramps, nausea, and fever. Severe neurological sequelae, bacteraemia, and other extra-intestinal complications develop infrequently (Blaser and Engberg, 2008). Erythromycin (a macrolide) is considered the drug of choice for campylobacteriosis. On the other hand, fluoroquinolone (FQ) (Allos, 2001), tetracycline and gentamicin antibiotics are also frequently used as alternative drugs in cases of Campylobacter infection (Blaser, 2008).
Antimicrobial resistance, especially to fluoroquinolone (ciprofloxacin) and macrolides (erythromycin), has emerged in Campylobacter (Lehtopolku et al., 2011). The use of tetracycline while rearing farm animals has been reviewed in recent years because of its growth-promoting properties (Chopra et al., 1992). The addition of a sub-therapeutic dose of chlortetracycline in livestock rations positively affects the rate of growth and feed utilization of young chickens (Stockstad et al., 1949). Therefore, a significant increase in tetracycline resistance has been observed in Campylobacter isolates recovered from chickens (EFSA, 2012). Such resistance is usually associated with the tet (O) gene, which is carried on transmissible plasmids (Taylor and Courvalin, 1988).
In Egypt, genotyping confirmation of environmental Campylobacter strains, which may contribute to the rapid emergence and dissemination of resistant bacteria and genes among poultry and humans, is lacking. Accordingly, this study was designed to investigate the occurrence of Campylobacter spp. among chickens, water, and humans. Antibiotic susceptibility and the tetracycline resistance gene tet (O) were also investigated to determine the resistance pattern of Campylobacter isolates recovered from different sources. In addition, the tet (O) genes were sequenced to trace the potential source of such genes among Campylobacter isolates from chickens, water and humans.
MATERIALS AND METHODS
Sample collection
A total of 360 cloacal swab samples were collected from chickens from randomly selected farms (n=200), households (n=60) and poultry shops (n=100) located in El-Giza and Cairo Governorates. Fifty human stool specimens were gathered from housewives rearing poultry (n=20), workers at poultry farms (n=20), and chicken handlers at poultry shops (n=10). Additionally, 15 water samples were obtained from water tanks in farms, households and poultry shops (5 from each) at the same localities of the stool sample collections.
Bacteriological examination
Campylobacter detection and identification were performed according to the ISO 10272 (2006) standard. In brief, samples were taken with sterile swabs, and the swabs were transferred to tubes containing Cary Blair transport medium (Oxoid CM0519) and subsequently inoculated into tubes containing 9 ml of sterile selective enrichment thioglycolate broth. Water samples were prepared according to the standard procedure of the American Public Health Association (APHA, 1981). The enrichment broth tubes were incubated at 37 °C for 4 h, followed by incubation for an additional 24-48 h at 42 °C in a microaerophilic condition using anaerobic jars and Campy Gen generating kits (Oxoid CN0025 and CN0035). A loopful from each of the previously incubated enrichment broth tubes was streaked over mCCDA agar (Oxoid CM0739) supplemented with CCDA and then incubated at 42 °C for 48 h under the same conditions (ISO10272-1, 2006).
Molecular identification and detection of the tet (O) resistance-encoding gene
Genomic DNA was extracted from pure suspected colonies using the boiling method according to Sheedy et al. (2004), and the extracted DNA was stored at -20 °C until use.
Primers specific for Campylobacter spp. and antibiotic resistance genes are summarized in Table I. The amplification reaction was performed according to Wang et al. (2002). Each reaction assay (25 μl) contained 6 μl of template DNA from each isolate, 12.5 μl of Hot Star Taq Master Mix (Thermo Scientific), 1 μl of each primer (20 pmol), and 4.5 μl of PCR-grade water. The cycling conditions were as follows: initial denaturation at 94 °C for 5 min, 35 cycles each consisting of denaturation at 94 °C for 30 s, annealing at 55 °C for 45 s, and extension at 72 °C for 45 s, and a final extension step at 72 °C for 10 min. Then, PCR products (15 μl each) were electrophoresed on agarose gel (1.5 %) and visualized under ultraviolet light.
Antimicrobial susceptibility screening
Confirmed isolates were screened using the agar disc diffusion technique according to Finegold and Martin (1982) for susceptibility to nalidixic acid (NA, 30 µg), ciprofloxacin (CIP, 5 µg), gentamycin (CN, 10 µg), erythromycin (E, 15 µg), ampicillin (AMP, 10 µg), tetracycline (TE, 30 µg), ceftriaxone (CR, 30 µg) and chloramphenicol (C, 30 µg). The results of the tested antibiotics were interpreted according to the Clinical and Laboratory Standards Institute (CLSI, 2014).
MAR index
The multiple antibiotic resistance (MAR) indices of the isolates were determined as a/b, where ‘a’ represents the number of multiple antibiotics to which the particular isolates were resistant, and ‘b’ represents the number of multiple antibiotics to which the particular isolates were exposed (Kamperman., 1983).
Sequencing and phylogenetic analysis
The amplicons of the tet (O) gene in the selected isolates of C. jejuni and C. coli were purified using the GeneJET PCR Purification Kit (Thermo) according to the manufacturer’s instructions and then sequenced at the Animal Health Research Institute (AHRI) in Dokki, El- Giza. The sequencing step was conducted with Big Dye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). The obtained nucleotide sequences were determined by Basic Local Alignment Search Tool (BLAST) analysis and were compared with the sequences available in GenBank using NCBI.
To assess the relatedness of our gene sequences recovered from human, chicken and drinking water isolates, these sequences were downloaded and imported into Bio Edit version 7.0.1.4 for multiple alignments using
Table I. Primers used for Campylobacter species identification and tetracycline resistant gene (tet O) of Campylobacter isolates.
|
Target agent & genes |
Primer sequence (5'-3') |
Amplified Length (bp) |
Reference |
|
Campylobacter 23S rRNA |
TATACCGGTAAGGAGTGCTGGAG (F) |
650 |
|
|
ATCAATTAACCTTCGAGCACCG (R) |
|||
|
C. jejuni mapA |
CTATTTTATTTTTGAGTGCTTGTG (F) |
589 |
|
|
GCTTTATTTGCCATTTGTTTTATTA(R) |
|||
|
C. coli CeuE |
AAT TGA AAA TTG CTC CAA CTA TG(F) |
462 |
|
|
TGA TTT TAT TAT TTG TAG CAG CG(R) |
|||
|
Campylobacter tet O |
GGCGTTTTGTTTATGTGCG(F) |
559 |
|
|
ATGGACAACCCGACAGAAGC(R) |
the Clustal W program. The sequence identity matrix and MEGA6 software version (6.06) were used for construction of the phylogenetic tree by the neighbour-joining method (Fig. 1).
GenBank accession numbers
The nucleotide sequences of the tet (O) genes recovered from both C. jejuni and C. coli isolates in this study were deposited in GenBank under the following accession numbers: KY435367 (water sample, C. jejuni), KY407565 (cloacal swab, C. jejuni), KY435366 (cloacal swab, C. coli), and KY439759 (human stool, C. jejuni).
RESULTS
A total of 425 samples were analysed for the presence of Campylobacter spp. using bacteriological examination associated with PCR confirmation. Three of 50 human stool specimens (6.0 %), 7 of 360 chicken cloacal swabs (1.9 %) and only one of 15 water samples (6.7 %) from different households, farms and shops in Giza and Cairo Governorates were Campylobacter positive. C. jejuni was the most frequently isolated species among the positive isolates, representing 63.6 % (Table II).
Table II. Occurrence of Campylobacter spp. in the examined samples.
|
Sample origin |
Sample number |
Campylobacter isolates |
||
|
Positive (%) |
C. jejuni (%) |
C. coli (%) |
||
|
Human |
50 |
3 (6.0) |
2 (66.7) |
1 (33.3) |
|
Chicken |
360 |
7 (1.9) |
4 (57.1) |
3 (42.9) |
|
Water |
15 |
1 (6.7) |
1 (100.0) |
0 (0.0) |
|
Total |
425 |
11 (2.6) |
7 (63.6) |
4 (36.4) |
To identify the antimicrobial susceptibility of Campylobacter spp., all isolates (11) were screened against 8 antibiotics that are frequently used as growth promoters or treatments for chickens in Egypt. The highest resistance rates were identified towards nalidixic acid (81.8 %), tetracycline (72.7 %), ciprofloxacin (54.5 %) and erythromycin (54.5 %). A lower frequency (18.2 %) of resistance to ceftriaxone was observed (Table III).
The MAR indices of the isolated Campylobacter spp. indicated that each isolate was resistant to at least two antibiotics used in the current study. Among the isolates, only 2 C. jejuni strains isolated from humans were resistant to two antibiotics, with a MAR index of 0.3. The other 9 isolates (81.8 %) were resistant to three or more
Table III. Antimicrobial-resistant C. jejuni and C. coli isolates recovered from chicken, water and human specimens.
|
Classes of antibiotics |
Antibiotic concentration (µg) |
Resistant strains |
Total |
|
|
C. jejuni (n - 7) |
C. coli (n – 4) |
|||
|
Nalidixic acid (30) |
6 (85.7%) |
3 (71.4%) |
9 (81.8%) |
|
|
Quinolones |
Ciprofloxacin (5) |
4 (57.1%) |
2 (42.9%) |
6 (54.5%) |
|
Aminoglycosides |
Gentamycin (10) |
1(14.3%) |
2 (28.6%) |
3 (27.3%) |
|
Macrolides |
Erythromycin (15) |
3 (42.8%) |
3 (57.1%) |
6 (54.5%) |
|
Penicillins |
Ampicillin (10) |
1 (57.1%) |
2(28.6%) |
3 (27.3%) |
|
Tetracyclines |
Tetracycline (30) |
5 (71.4%) |
3 (57.1%) |
8 (72.7%) |
|
Cephalsporins (3rd generation) |
Ceftriaxone (30) |
1 (57.1%) |
1 (42.9%) |
2 (18.2%) |
|
Quinolones |
Chloramphenicol (30) |
3 (42.8%) |
1 (28.6%) |
4 (36.4%) |
antimicrobial agents. More multidrug-resistant (MDR) isolates were identified from chickens than from water and humans, and the isolates from chickens had MAR indices between 0.4 and 0.6 (Table IV).
All isolates were subjected to PCR to screen for the tet (O) gene, which contributes to tetracycline resistance. The genetic analysis revealed a 54.5 % (6/11) overall occurrence of the tet (O) gene among the examined isolates. Only 6 isolates (75 %) harboured tet (O) genes among 8 tetracycline-resistant isolates, whereas tet (O) was detected in 36.4 % of C. jejuni isolates (4/11) and 18.2 % of C. coli isolates (2/11) (Table V).
Table IV. Multiple antibiotic resistance (MAR) index of Campylobacter spp. from human, chicken and water samples.
|
MAR index |
Campylobacter spp. |
Isolate source |
Antibiotic resistant profile |
|
0.3 |
C.jejuni |
Human |
NA, TE |
|
0.3 |
C.jejuni |
Human |
CIP,C |
|
0.4 |
C.coli |
Human |
E, CR, C |
|
0.6 |
C.coli |
Cloacal swab |
NA, CIP, CN, AMP, TE |
|
0.5 |
C.coli |
Cloacal swab |
NA, CN, E, TE, |
|
0.6 |
C.coli |
Cloacal swab |
NA, CIP, E, AMP, TE |
|
0.6 |
C.jejuni |
Cloacal swab |
NA, CIP, E, AMP, TE |
|
0.6 |
C.jejuni |
Cloacal swab |
NA, CIP, E, TE, C |
|
0.4 |
C.jejuni |
Cloacal swab |
NA, CR, C |
|
0.5 |
C.jejuni |
Cloacal swab |
NA, CIP, E, TE |
|
0.4 |
C.jejuni |
water |
NA, CN, TE |
NA: 30 µg nalidixic acid; CIP: 5µg ciprofloxacin; CN: 10 µg gentamycin; E: 15 µg erythromycin; AMP: 10 µg ampicillin; TE: 30µg tetracycline; CR: 30 µg ceftriaxone and C: 30 µg chloramphenicol.
The identity of ≤ 99% to tet (O) gene sequences of the Campylobacter spp. strains, indicating that the set of primers described here exclusively amplified the 559 bp fragment of the target gene. Phylogenetic analysis of the tet (O) gene sequences recovered from the C. jejuni isolates revealed that the chicken and drinking water strains isolated from the same farm were identical. However, the sequences of the tet (O) genes from human isolates were highly similar to those from drinking water isolates. However, there were also similarities between the study sequences and the sequences retrieved from GenBank, as shown in Figure 1.
Table V. Detection of tet O gene in Campylobacter species isolated from different sources.
|
No. of positive isolates to tet O gene |
No. of strains resistant to tetracycline |
No. of isolates |
Source of isolates |
||||||
|
Total (n - 11) |
C. coli (n - 4) |
C. jejuni (n - 7) |
|||||||
|
% |
No. |
% |
No. |
% |
No. |
% |
NO. |
||
|
50.0 |
1 |
0.0 |
0 |
50.0 |
1 |
66.7 |
2 |
3 |
Human |
|
66.7 |
4 |
33.3 |
2 |
33.3 |
2 |
85.7 |
6 |
7 |
Chicken |
|
100.0 |
1 |
0.0 |
0 |
100.0 |
1 |
100.0 |
1 |
1 |
Water |
|
54.5 |
6 |
18.2 |
2 |
36.4 |
4 |
100.0 |
11 |
11 |
Total |
DISCUSSION
Campylobacter has now emerged as one of the leading causes of foodborne illness in humans around the world. Many studies have reported that there has been a rise in the incidence of campylobacteriosis globally in the past decade (Kaakoush et al., 2015). Campylobacter is found mostly in chicken meat; therefore, chicken meat and poultry farms play a key role in the epidemiology of human infection (Zhang et al., 2018). In the current study, the low contamination frequency of Campylobacter spp. detected in chicken cloacal swab samples is in agreement with Marinuo et al. (2012), who recorded a 1.48 % isolation rate of Campylobacter spp. in poultry farm samples. In addition, an EFSA report (2010) recorded a relatively low prevalence of Campylobacter in broiler flocks in Norway (3.2 %) and Finland (3.9 %). In contrast, Rajagunalan et al. (2014) in India and Bardon et al. (2008) in the Czech Republic reported Campylobacter prevalence rates of 76.32 % and 50.0 %, respectively. These variations may be attributed to geographical location, breeding methods and season-related differences (Daskalov and Maramski, 2012).
Since Campylobacter is a zoonotic pathogen and can often be recovered from asymptomatic individuals, the current study investigated the occurrence of this pathogen in workers with close contact to chickens regardless of gastrointestinal symptoms. The occurrence of Campylobacter spp. in humans was nearly similar to that recorded by Pazzaglia et al. (1993) and Zaghloul et al. (2012), who reported that Campylobacter spp. were identified in 6.4 and 6.6 % of human stool samples in Alexandria and Cairo Governorates in Egypt, respectively.
The most prevalent species recorded in our study was C. jejuni (63.6 %), and a similar result was also recorded in previous studies in chickens (Agunos et al., 2014; Sahin et al., 2015). This finding is in line with many studies reporting that C. jejuni is commonly found in the gastrointestinal tract of broiler chickens and wild birds, while C. coli is typically prevalent in other animals (Dasti et al., 2010; Epps et al., 2013).
C. jejuni was isolated from only one water sample from tanks used to provide drinking water to chickens in the present study. Similarly, Shimaa et al. (2015) recorded Campylobacter in 12.8 % of the examined water in chicken farms in Egypt. Moreover, a high prevalence (30 %) of Campylobacter spp. contamination was recorded by Barakat et al. (2015) in tap water. This finding may be attributed to the poor recovery of such pathogens from environmental samples using selective culture methods due to the formation of viable but non-culturable (VBNC) cells. Although a low level of contamination with this pathogen was detected in the drinking water samples in our study, this finding is indicative of a recent contamination of water tanks that were opened with faecal droppings of chickens or wild birds during the rearing period (Friedman et al., 2000). This result indicated the potential role of drinking water in poultry farms in the process of Campylobacter colonization in chickens. Moreover, several studies have indicated the role of the natural environment (soil and water) in the transmission of campylobacteriosis, either directly to humans or indirectly via farm animals, especially poultry (Bronowski et al., 2014). Hence, the use of poor-quality drinking water in poultry farms poses a public health threat.
The overall prevalence of antimicrobial agents to which a Campylobacter isolate was resistant ranged from 18.2 % to 81.8 %. In the current study, a high resistance to fluoroquinolones (nalidixic acid), tetracycline, quinolones (ciprofloxacin) and erythromycin was observed. Meanwhile, the isolates were susceptible to ceftriaxone (third-generation cephalosporin), gentamicin, ampicillin, and chloramphenicol. Similar findings have also been reported by Raeisi et al. (2017), who reported that poultry Campylobacter isolates were resistant to ciprofloxacin, nalidixic acid and tetracycline. On the other hand, Szczepanska et al. (2017) reported that in Poland, Campylobacter spp. were resistant to ciprofloxacin and tetracycline but were susceptible to erythromycin. The expected similarities and differences among our findings and those reported in previous studies may be attributed to the frequency of antibiotic usage in animal husbandry practices and human therapy (Zhao et al., 2010).
Resistance rates to tetracycline and quinolones vary worldwide, and the high prevalence of Campylobacter spp. that are resistant to these drug classes has increased and become increasingly worrisome in recent years (Mackiw et al., 2012). Alarmingly, the increased resistance of Campylobacter to antimicrobials, particularly tetracycline, erythromycin, and (fluoro)quinolones, is associated with a reduced response to therapy, leading to higher morbidity and mortality rates in humans (Zhu et al., 2006).
In summary, both human and chicken isolates are generally resistant to nalidixic acid, ciprofloxacin, tetracycline and erythromycin. This might be due to the improper use of these antibiotics in veterinary and human medicine. Therefore, the present findings suggest that antibiotics used for humans should not be used in poultry. Furthermore, the relatively high percentages of resistance to most antimicrobial agents screened in this study could be explained by the widespread and uncontrolled use of these agents as growth promoters or in animal treatment, reflect the extent to which these antibiotics are used in Egypt and pose a challenge to the management of Campylobacter infections.
Currently, multidrug resistance is becoming an increasing problem in Campylobacter isolates because it can compromise the effective treatment of campylobacteriosis. Nine Campylobacter spp. evaluated in the current study were resistant to at least 3 antimicrobial groups. Thus, they are characterized as MDR isolates; high levels of resistance were observed among the isolates from chicken cloacal swabs and water samples. This is in agreement with Said et al. (2010), who suggested that a higher prevalence of MDR strains has been reported from animal and meat isolates than from human isolates. Importantly, emerging MDR Campylobacter poses a great threat to the poultry industry and to humans because resistance genes could be transmitted between different hosts.
MAR indexing is a useful tool to identify ecological contamination. All Campylobacter spp. in this study had a MAR index greater than 0.3, which indicates a high frequency of antibiotic usage in poultry in Egypt. Moreover, these isolates are considered to originate from animals that have a high potential for contamination (Marian et al., 2012), subsequently exacerbating the public health concern associated with Campylobacter infections.
To investigate the molecular basis of tetracycline resistance in Campylobacter isolates, the presence of the tetracycline resistance gene tet (O) was estimated. The current study showed that not all tetracycline-resistant isolates harboured the tet (O) gene, and this finding was also observed by Obeng et al. (2012), who recorded a low correlation between tetracycline resistance and the presence of the tet (O) gene. Although high levels of phenotypic resistance to tetracycline were attributed to the presence of the tet (O) gene (Wieczorek et al., 2013), nonspecific efflux systems, such as the CmeABC multidrug efflux pump, may also play a role in decreasing the susceptibility to such antibiotics (Lovine, 2013).
Recently, gene sequencing has been considered a novel genotyping method with promising potential for the detection of epidemiological relationships and the diversity of genes recovered from different sources. In this study, the phylogenetic analysis of the isolate sequences demonstrated that chicken (KY407565, KY435366), drinking water (KY435367) and human (KY439759) isolate sequences show relationships with 5 sequences retrieved from GenBank, including retail chicken (CP013117), chicken liver (CP017866), chicken caecal content (CP017418), swine (JQ613156) and wild bird (AM884250), as they were found in the same cluster. From this cluster, the studied tet (O) sequences from chicken (KY407565) and drinking water (KY435367) isolates sampled from the same farm were closely related to each other, which reflects the environmental origin of the tet (O) gene in such chickens. This scenario highlights the potential role of contaminated drinking water in the transmission of tetracycline-resistant C. jejuni to chickens (Trigui et al., 2015)
The phylogenetic tree also demonstrates that the human tet (O) gene sequence in our study (KY439759) is more similar to the drinking water sequence (KY435367) than the chicken sequence (KY407565). Therefore, Campylobacter survival in water is critical for transmission to humans through the consumption of contaminated drinking water and for transmission from one animal reservoir to another (Bronowski et al., 2014). The results of our study augment this concept and underscore drinking water as a potential reservoir of resistance genes since they are recipients of bacteria from different sources (Kim et al., 2010), including livestock manure coming from neighbouring farms (Clark et al., 2003) and/or sewage (O’Reilly et al., 2007), and may play a pivotal role in the transmission of Campylobacter infection for humans and chickens. Importantly, the isolation of closely related tet (O) genes from C. jejuni strains in chickens, humans and drinking water at the same farm reflects the epidemiological relationship between them. Thus, increased attention should focus on preventing the transmission cycle of such pathogens between different ecosystems to avoid public health threats.
On the other hand, our study of the tet (O) gene sequence of C. coli recovered from chickens (KY435366) shows a relationship with the tet (O) gene sequence of C. jejuni recovered from the caecal content of chickens in the USA (CP017418), which suggests evidence of horizontal gene transfer (HGT) of genetic elements between C. coli and C. jejuni, especially in the intestinal tract of chickens (Avrain et al., 2004). Foodborne pathogens can acquire a variety of resistance genes from the reservoir of commensal bacteria in animals’ intestines (Salyers et al., 1995). Hence, Campylobacter spp. may acquire the tet (O) gene from commensal bacteria found in the intestinal tract of chickens, especially after oral administration of tetracycline (Fairchild et al., 2005). These pathways of resistance gene acquisition indicate that tetracycline resistance genes can be transmitted between bacteria and humans and between animals and different ecosystems.
In conclusion, this study demonstrated that C. jejuni strains were more common than C. coli in chicken, human and drinking water isolates at the same farm. Although a low percentage of Campylobacter was detected in the examined samples, the identification of high levels of antimicrobial resistance and MDR isolates make this issue even more serious. Most chicken Campylobacter isolates were MDR, particularly to antibiotics that are often used as first-line treatments. The closely related tet (O) genes from the C. jejuni strains in chickens, humans and drinking water were from the same farm. Thus, increased attention should focus on preventing the transmission cycle of such pathogens between different ecosystems to avoid public health threats and on the need to decrease the generation of tetracycline-resistant Campylobacter spp. through cautious use of tetracycline in poultry production. Our results emphasize the need for more frequent monitoring of the prevalence and antimicrobial resistance of Campylobacter to provide support for actions directed at reducing this pathogen in the food chain. In addition, we suggest further molecular studies on efflux system genes as an important tool to reduce the antimicrobial resistance and colonization of Campylobacter in animals raised for food purposes in Egypt.
ACKNOWLEDGEMENTS
We thank the Zoonoses department, Faculty of Veterinary Medicine, Cairo University for supporting us to complete this work.
Statement of conflict of interest
The Authors declares there is no conflict of interset.
REFERENCES
Agunos, A., Waddell, L., Léger, D. and Taboada, E., 2014. A systematic review characterizingon-farm sources of Campylobacter spp. for broiler chickens. PLoS One., 9: e104905. https://doi.org/10.1371/journal.pone.0104905
Allos, B.M., 2001. Campylobacter jejuni infections: update on emerging issues and trends. Clin. Infect. Dis., 32: 1201–1206. [PubMed: 11283810]. https://doi.org/10.1086/319760
American Public Health Association (APHA), 1981. Standard methods for the examination of water and wastewater, 15th ed. American Public Health Association, Washington, D.C.
Avrain, L., Vernozy-Rozand, C. and Kempf, I., 2004. Evidence for natural horizontal transfer of tetO gene between Campylobacter jejuni strains in chickens. J. appl. Microbiol., 97: 134–140. https://doi.org/10.1111/j.1365-2672.2004.02306.x
Barakat, A., Mona, M., El Fadaly, H., Nagwa, S., Nashwa, O., Eman, R., Kotb, M. and Zeinab, M., 2015. Zoonotic hazards of campylobacteriosis in some areas in Egypt. Life Sci. J., 12: 9-14.
Bardon, J., Kolar, M., Cekanova, L., Hejnar, P. and Koukalova, 2008. Prevalence of Campylobacter jejuni and its resistance to antibiotics in poultry in the Czech Republic. Zoon. Publ. Hlth., 56: 111- 116. https://doi.org/10.1111/j.1863-2378.2008.01176.x
Blaser, M.J. and Engberg, J., 2008. Clinical aspects of Campylobacter jejuni and Campylobacter coli infections. In: Campylobacter (eds. I. Nachamkin, C.M. Szymanski and M.J. Blaser). ASM Press; Washington DC, USA. pp. 99-121. https://doi.org/10.1128/9781555815554.ch6
Bronowski, C., James, C.E. and Winstanley, C., 2014. Role of environmental survival in transmission of Campylobacter jejuni. FEMS Microbiol. Lett. 356: 8–19. https://doi.org/10.1111/1574-6968.12488
CDC, 2016. Foodborne diseases active surveillance network (Food Net): Food Net Surveillance Report for 2014 (Final Report). U.S. Department of Health and Human Services, CDC, Atlanta, Georgia. http://www.cdc.gov/foodnet/reports/annualreports-2014.html.
Chopra, I., Hawkey, P.M. and Hinton M., 1992. Tetracyclines, molecular and clinical aspects. J. Antimicrob. Chemother., 29: 245–277. https://doi.org/10.1093/jac/29.3.245
Clark, C.G., Price, L., Ahmed, R., Woodward, D.L., Melito, P.L., Rodgers, F.G., Jamieson, F., Ciebin, B., Li, A. and Ellis, A., 2003. Characterization of waterborne outbreak-associated Campylobacter jejuni, Walkerton, Ontario. Emerg. Infect. Dis., 9: 1232–1241. https://doi.org/10.3201/eid0910.020584
CLSI, Clinical and Laboratory Standards Institute. 2014. Available at: http://clsi.org (17.04.2015).
Daskalov, H. and Maramski, A., 2012. Prevalence and factors affecting the presence of Campylobacter spp. in broiler carcasses in Bulgaria. Turk. J. Vet. Anim. Sci., 36: 539-545.
Dasti, J.I., Tareen, A.M., Lugert, R., Zautner, A.E. and Groß, U., 2010. Campylobacter jejuni a brief overview on pathogenicity-associated factors and disease-mediating mechanisms. Int. J. med. Microbiol., 300: 205–211. https://doi.org/10.1016/j.ijmm.2009.07.002
Doorduyn, Y., Van Den Brandhof, W., VAN Duynhoven, Y., Breukink, B., Wagenaar, J. and Van Pelt, W., 2010. Risk factors for indigenous Campylobacter jejuni and Campylobacter coli infections in The Netherlands: A case-control study. Epidemiol. Infect., 138: 1391-1404. https://doi.org/10.1017/S095026881000052X
DuPont, H.L., 2007. The growing threat of foodborne bacteria enteropathogens of animal origin. Clin. Infect. Dis., 45: 1353–1361. https://doi.org/10.1086/522662
EFSA (European Food Safety Authority), 2010. Analysis of the baseline survey on the prevalence of Campylobacter in broiler batches and of Campylobacter and Salmonella on broiler carcasses in the EU, 2008- Part A: Campylobacter and Salmonella prevalence estimates. EFSA J. 8: 1503. https://doi.org/10.2903/j.efsa.2010.1503
EFSA, 2012. The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2010. Euro Surveilliance, 10.3: 2598. https://doi.org/10.2903/j.efsa.2012.2598
EFSA, 2013. The European Union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2011. EFSA J., 11: 3129. https://doi.org/10.2903/j.efsa.2013.3129
Epps, S., Harvey, R., Hume, M., Phillips, T., Anderson, R. and Nisbet, D., 2013. Foodborne Campylobacter: infections, metabolism, pathogenesis and reservoirs. Int. J. environ. Res. Publ. Hlth., 10: 6292–6304. https://doi.org/10.3390/ijerph10126292
Eunju, S. and Lee, Y., 2009. Comparison of three different methods for campylobacter isolation from porcine intestine. J. Mircobiol. Biotechnol., 19: 647-650.
Fairchild, A.S., Smith, J.L., Idris, U., Lu, J., Sanchez, S., Purvis, L.B., Hofacre, C. and Lee, M.D., 2005. Effects of orally administered tetracycline on the intestinal community structure of chickens and on tet determinant carriage by commensal bacteria and C. jejuni. Appl. environ. Microbiol., 71: 5865–5872. https://doi.org/10.1128/AEM.71.10.5865-5872.2005
Finegold, S.M., Martin, W.J., 1982. Diagnosis microbiology, 16h Ed. Th C.V. MosbyCo.St. Louis Toronto London.
Friedman, C.R., Neimann, J., Wegener, H.C. and Tauxe, R.V., 2000. Epidemiology of Campylobacter jejuni infection in the United States and other industrialized nations. In: Campylobacter (eds. I. Nachamkin and J.M. Blaser) 2nd Ed. American Society for Microbiology, Washington D.C. pp: 121-138.
Gibreel, A., Tracz, D.M., Nonaka, L., Ngo, T.M., Connell, S.R. and Taylor, D.E., 2004. Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance. Antimicrob. Agents Chemother., 48: 3442–3450.
lovine, N.M., 2013. Resistance mechanisms in Campylobacter jejuni. Virulence, 4: 230–240. https://doi.org/10.4161/viru.23753
ISO10272-1, 2006. AND ISO/TS 10272-2.2006. Microbiology of food and animal feeding stuffs–Horizontal method for the detection and enumeration of Campylobacter spp. Part 1: Detection method; Part 2: Colony count technique. International Organisation for Standardisation (ISO), ISO Central Secretariat.
Luangtongkum, T., Morishita, T.Y., Ison, A.J., Huang, S., McDermott, P.F. and Zhang, Q., 2006. Effect of conventional and organic production practices on the prevalence and antimicrobial resistance of Campylobacter spp. in poultry. Appl. environ. Microbiol., 72: 3600–3607. https://doi.org/10.1128/AEM.72.5.3600-3607.2006
Jeffrey, J.S., Tonooka, K.H. and Lozanot, J., 2001. Prevalence of campylobacter spp. from skin, crop, and intestine of commercial broiler chicken carcasses at processing. Poult. Sci., 80: 1390–1392. https://doi.org/10.1093/ps/80.9.1390
Kaakoush, N.O., Castaño-Rodríguez, N., Mitchell, H.M. and Man, S.M. 2015. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev., 28: 687–720. https://doi.org/10.1128/CMR.00006-15
Kim, S., Park, H. and Chandran, K., 2010. Propensity of activated sludge to amplify or attenuate tetracycline resistance genes and tetracycline resistant bacteria: a mathematical modeling approach. Chemosphere, 78: 1071–1077. https://doi.org/10.1016/j.chemosphere.2009.12.068
Krumperman, P.H., 1983. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. environ. Microbiol., 46: 165-170.
Lehtopolku, M., Kotilainen, P., Haanpera-Heikkinen, M., Nakari, U.M., Hanninen, M.L., Huovinen, P., Siitonen, A., Eerola, E., Jalava, J. and Hakanen, A.J., 2011. Ribosomal mutations as the main cause of macrolide resistance in Campylobacter jejuni and Campylobacter coli. Antimicrob. Agents Chemother., 55: 5939–5941. https://doi.org/10.1128/AAC.00314-11 https://doi.org/10.1128/AAC.48.9.3442-3450.2004
Mackiw, E., Korsak, D., Rzewuska, K., Tomczuk, K. and Rozynek, E., 2012. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from food in Poland. Fd. Contr., 23: 297-301. https://doi.org/10.1016/j.foodcont.2011.08.022
Marian, M.N., Sharifah, S.M., Zuraini, M.I., Son, R., Maimunah, M., Lee, H.Y., Wong, W.C. and Elexson, N., 2012. MPN-PCR detection and antimicrobial resistance of Listeria monocytogenes isolated from raw and ready-to-eat foods in Malaysia. Fd. Contr., 28: 309–314. https://doi.org/10.1016/j.foodcont.2012.05.030
Marinou, I., Bersimis, S., Ioannidis, A., Nicolaou, C., Mitroussia-Ziouva, A., Legakis, N.J. and Chatzipanagiotou, S., 2012. Identification and antimicrobial resistance of Campylobacter species isolated from animal sources. Front. Microbiol., 3: 1-6. https://doi.org/10.3389/fmicb.2012.00058
Nyachuba, D.G., 2010. Foodborne illness: Is it on the rise? Nutr. Rev., 68: 257–269. PHAC, 2010. ARCHIVED - C-EnterNet 2008 Annual Report. PHAC. http://www.phacaspc.gc.ca/foodnetcanada/pubs/2008/campylobacter-eng.php. https://doi.org/10.1111/j.1753-4887.2010.00286.x
Obeng, A.S., Rickard, H., Sexton, M., Pang, Y., Peng, H. and Barton, M., 2012. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia. J. appl. Microbiol., 113: 294–307. https://doi.org/10.1111/j.1365-2672.2012.05354.x
O’Reilly, C.E., Bowen, A.B., Perez, N.E., Sarisky, J.P., Shepherd, C.A., Miller, M.D., Hubbard, B.C., Herring, M., Buchanan, S.D., Fitzgerald, C.C., Hill, V., Arrowood, M.J., Xiao, L.X., Hoekstra, R.M., Mintz, E.D. and Lynch, M.F., 2007. A waterborne outbreak of gastroenteritis with multiple etiologies among resort island visitors and residents: Ohio. Clin. Infect. Dis., 44: 506–512. https://doi.org/10.1086/511043
Pazzaglia, G., AL Bourgeois Arab, I., Mikhail, I., Podgore, J.K., Mourad, A., Riad, S., Gaffar, T. and Ramadan, A.M., 1993. Campylobacter-associated diarrhoea in Egyptian infants: epidemiology and clinical manifestations of disease and high frequency of concomitant infections. J. Diarrh. Dis. Res., 11: 6-13
Rajagunalan, S., Bisht, G., Pant, S., Singh, S.P., Singh, R., Ajagunalan, K.D., Bisht, S.G., Pant, S., Singh, S.P., Singh, R. and Dhama, K., 2014. Prevalence and molecular heterogeneity analysis of Campylobacter jejuni and Campylobacter coli isolated from human, poultry and cattle, in Pantnagar, India. Vet. Arhiv., 84: 493-504.
Raeisi, M., Khoshbakht, R., Ghaemi, E.A., Bayani, M., Hashemi, M., Seyedghasemi, N.S. and Shirzad-Aski, H., 2017. Antimicrobial resistance and virulence-associated genes of Campylobacter spp. isolated from raw milk, fish, poultry, and red meat. Microb. Drug Resist., 23: 925–933. https://doi.org/10.1089/mdr.2016.0183
Salyers, A.A., Shoemaker, N.B., Stevens, A.M. and Li, L.Y., 1995. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements. Microbiol. Rev., 59: 579–590.
Sahin, O., Kassem, I.I., Shen, Z., Lin, J., Rajashekara, G. and Zhang, Q., 2015. Campylobacter in poultry: ecology and potential interventions. Avian Dis., 59: 185–200. https://doi.org/10.1637/11072-032315-Review
Said, M.M., El-Mohamady, H., El-Beih, F.M., Rockabrand, D.M., Ismail, T.F., Monteville, M.R., Ahmed, S.F., Klena, J.D., Salma, M.S., 2010. Detection of gyrA mutation among clinical isolates of Campylobacter jejuni isolated in Egypt by MAMA PCR. J. Infect. Dev. Ctries., 4: 546-554. https://doi.org/10.3855/jidc.963
Sheedy, S.A., Ingham, A., Rood, J.I. and Moore, R.J., 2004. Highly conserved alpha toxin sequences of avianisolates of C. perfringens. J. clin. Microbiol., 42: 1345-1347. https://doi.org/10.1128/JCM.42.3.1345-1347.2003
Shimaa, T.O., El Fadaly, H.A. and Barakat, A.M., 2015. Public Health Hazard of Zoonotic Campylobacter jejuni reference to Egyptian regional and seasonal variations. Res. J. Microbiol., 10: 343-354. https://doi.org/10.3923/jm.2015.343.354
Stockstad, E.L.R., Jukes, T.H., Pierce, J., Page, A.C. and Franklin, A.L., 1949. The multiple nature of the animal protein factor. J. biol. Chem., 180: 647–654.
Szczepanska, B., Andrzejewska, M., Spica, D. and Klawe, J., 2017. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from children and environmental sources in urban and suburban areas. BMC Microbiol., 17: 80. https://doi.org/10.1186/s12866-017-0991-9
Taylor, D.E. and Courvalin, P., 1988. Mechanisms of antibiotic resistance in Campylobacter species. Antimicrob Agents Chemother, 32: 1107–1112. https://doi.org/10.1128/AAC.32.8.1107
Trigui, H., Thibodeau, A., Fravalo, P., Letellier, A. and Faucher, P.S., 2015. Survival in water of Campylobacter jejuni strains isolated from the slaughterhouse. Springer Plus, 4: 799. https://doi.org/10.1186/s40064-015-1595-1
Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price, L., Woodward, D.L. and Rodgers, F.G., 2002. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. clin. Microbiol., 40: 4744-4747. https://doi.org/10.1128/JCM.40.12.4744-4747.2002
Wieczorek, K. and Osek, J., 2013. Antimicrobial resistance mechanisms among campylobacter, BioMed Res. Int. Article ID 340605, 1–12. https://doi.org/10.1155/2013/340605
Zaghloul, M.Z., Farouk, N. and Galal, Z.A., 2012. Detection of Cambylobacter spp. in stool samples by new methods in comparison to culture. Life Sci. J., 9: 2566-2571.
Zhang, X., Tang, M., Zhou, Q., Zhang, J., Yang, X. and Gao, Y., 2018. Prevalence and characteristics of Campylobacter throughout the slaughter process of different broiler batches. Front. Microbiol., 9: 2092. https://doi.org/10.3389/fmicb.2018.02092
Zhao, S., Young, S.R., Tong, E., Abbott, J.W., Womack, N., Friedman, S.L. and McDermott, P.F., 2010. Antimicrobial resistance of Campylobacter isolates from retail meat in the United States between 2002 and 2007. Appl. environ. Microbiol., 76: 7949–7956. https://doi.org/10.1128/AEM.01297-10
Zhu, J., Zhang, Y., Hua, X., Hou, J. and Jiang, Y., 2006. Antibiotic resistance in Campylobacter. Rev. med. Microbiol., 17: 107–121. https://doi.org/10.1097/MRM.0b013e3280c4d106