Distribution of Antibiotic Resistance and Antibiotic Resistant Genes in Campylobacter jejuni Isolated from Poultry in North West of Pakistan
Sher Bahadar Khan1, Mumtaz Ali Khan2,*, Hameed Ullah Khan3, Sher Ali Khan4, Shah Fahad5, Faheem Ahmad Khan6, Irshad Ahmad7, Nighat Nawaz8, Sidra Bibi9 and Muhammad Muneeb10
1Department of Animal Health, The University of Agriculture, Peshawar, Pakistan
2Department of Livestock and Dairy Development, Govt. of Khyber Pakhtunkhwa, Peshawar, Pakistan
3Veterinary Research Institute, Peshawar, Pakistan
4Direcotorate General of Agriculture Research, Peshawar, Pakistan
5University of Swabi, Swabi, Khyber Pakhtunkhwa, Pakistan
6Centre for Biomedical Research, Key Lab of Organ Transplantation, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, China
7Institute of Basic Medical Sciences, Khyber Medical University, Peshawar, Pakistan
8Department of Chemistry, Islamia College University, Peshawar, Pakistan
9Department of Poultry Sciences, Faculty of Animal Husbandry and Veterinary Sciences, The University of Agriculture, Peshawar, Pakistan
10Department of Food Science and Technology, Faculty of Nutrition Sciences, The University of Agriculture, Peshawar, Pakistan
ABSTRACT
Campylobacter species are one of the most important food borne zoonotic pathogens. A total of 1260 poultry meat samples were collected from four different regions of Khyber Pakhtunkhwa province and processed for isolation of campylobacter species. A total of 182 (14%) Campylobacter jejuni were isolated using enrichment and plate media followed by confirmation through multiplex PCR. Isolates were tested for 15 antibiotics using disc diffusion method followed by detection of their respective antimicrobial resistant genes. Overall prevalence of Campylobacter jejuni was 14% being higher in Peshawar division (21%) followed by Bannu division (16%), Malakand division (13%) and Hazara division (8%). Over all highest antibiotic resistance was found against AMX (93%) followed by LIN (88%), AMP (86%), TET (82%), SXT (75), CHL (68%), CLR (65%), STR (50%), GEN (44%), OFX (27%), CIP (25%), LFX (13%) and AZM (11%) while the least resistance was found against GAT (8%) and CRO (9%). 90% isolates were found to have multiple drug resistance. As for as antibiotic resistant genes are concerned, the highest ARG was blaTEM (93%) followed by tetA (82%), sul2 (75%), blaSHV (72%), tetC (71%), strA/strB (50%), sul1 (49%), blaCMY2 and aadA (44%) while the least resistant gene was aadb (9%) followed by sul3 (21%) and aac(3)IV (37%). About 92% isolates were found to have multiple drug resistance genes which is a matter of great concern from human public health perspective.
Article Information
Received 28 August 2019
Revised 23 November 2019
Accepted 20 December 2019
Available online 28 November 2020
Authors’ Contribution
SBK, MAK, SF and IA designed the study. SBK, MAK, HU, SB and MM performed the experiments. SBK, MAK, SAK, FAK and NN analyzed the data and wrote the article.
Key words
Antibiotic resistance, Antimicrobial resistant genes, Campylobacter jejuni, Poultry meat, Zoonotic pathogens.
DOI: https://dx.doi.org/10.17582/journal.pjz/20190828140843
* Corresponding author: [email protected]
0030-9923/2021/0001-0079 $ 9.00/0
Copyright 2021 Zoological Society of Pakistan
Introduction
Campylobacter is one of the most important pathogen implicated in food borne zoonoosis. The pathogen is world widely distributed and have been reported in different countries including European Union, USA and New Zeland (EFSA-ECDC 2015; CDC, 2017; Rapp et al., 2012). Campylobacter jejuni is the most important species responsible for human campylobacteriosisis while Campylobacter coli and C. lari are second and third responsible species (EFSA-ECDC, 2014). These organisms are fastidious, gram negative, bacilli, non spore forming, thermo tolerant, grow in microaerphilic conditions with a wide incubation period of 1-10 days (Gharst et al., 2013). Foods of animal origin are most commonly contaminated by this pathogen and the reason is these organism are commensals of GIT of different animals including cattle, buffalo, sheep, goat, swine and birds (Zhao et al., 2001; Bork and Petersen et al., 2005; Moran et al., 2009; Di Giannatale et al., 2010; Adzitey et al., 2012; Rejab et al., 2012; Wieczorek et al., 2013). Poultry meat is one of the most animal food source of this pathogen responsible for further transmission and cross contamination to other food items (Silva et al., 2011). Utilization of contaminated food items with this pathogen and under cooked meat have been reported for possible human illness. Gastrointestinal tract is mostly involved in human infection characterized by bloody diarrhea, vomiting, abdominal cramps and pyrexia. The disease may lead to further complications including Guillian barre syndrome, arthritis and Miller Fisher syndrome if not properly treated (WHO, 2017).
Antimicrobial resistance is a worldwide problem in all pathogens in general and in campylobacter species in particular. Unnecessary usage of antibiotics in animals feed particularly in poultry feed as a growth promoting factors is the main reason behind this AMR development. Besides this self medication/inappropriate usage of antibiotics in human illness are other contributing factors. Different mechanisms are involved in AMR development including biofilm formation, antibiotic resistant genes, plasmids and transposons.
Study on this pathogen in poultry is very scarce or very limited in KPK. To the best of our research and knowledge this is first study in Khyber Pakhtunkhwa province and therefore it was planned to find out the prevailing situation of AMR in campylobacter species in poultry meat along the supply chain.
Materials and Methods
Samples collection
A total of 1260 poultry meat and tissue samples were collected and brought to laboratory under sterile condition. These meat samples were first cultured on preston campylobacter enrichment broth and then on Columbia blood agar under incubation temperature of 42°C for 48 h in microaerophilic atmosphere according to ISO standard. Identification was performed through colonial characteristics, microscopic morphology and rapid biochemical identification system (Oxoid, Basingstoke, UK). For extraction of genomic DNA from the bacterial isolates kit method was used (Omega Bio-Tek, USA). Species specific genes for campylobacter were targeted in genomic DNA through PCR. Specific primers, PCR amplifications and conditions are described in Table I.
Antimicrobial susceptibility testing (AST)
To check antibiotic susceptibility Campylobacter isolates were tested against 15 different antibiotics through disc diffusion method. For interpretation of the antibiotic susceptibility results standard guidelines of the Clinical and Laboratory Standards Institute (CLSI) (Galni et al., 2008). Following 15 different antibiotics were tested in the AST: Lincomycin (LIN, 2 μg), Azithromycin (AZM, 15 μg), Ampicillin (AMP, 10 μg), Suphamethoxazole+Trimethpram (SXT, 25 μg), Ciprofloxacin (CIP, 5ug), Gatifloxacin (GAT, 5ug), Ofloxacin (OFX, 5 μg), Levofloxacin (LVX, 5 μg), Clarithromycin (CLR, 15 μg), Chloramphenicol (CHL, 30 μg), Tetracycline (TET, 30 μg), Strptomycin (STR, 10 μg), Gentamycin (GEN, 10 μg), Amoxicillin (AMX, 20 μg), and Ceftriaxone (CRO, 30 μg). Multidrug resistance (MDR) strains (isolates resistant to three or more than three antibiotics) were determined.
Detection of antibiotic resistance genes (ARGs)
For detecting major resistance genes, a set of multiplex PCRs were used (Kozak et al., 2009). Major ARGs including b-lactamases (blaCMY-2, blaTEM, blaSHV), sulfonamides (sul1, sul2 and sul3), gentamycin (aac(3)IV, aadB),
Table I.- Specific primers and PCR conditions for species specificity of Campylobacter.
|
Specific genes |
Primers |
Sequence of primers (5′-3′) |
Size of products (bp) |
|
C. jejuni 23S rRNA |
23S F 23S R |
TATACCGGTAAGGAGTGCTGGAG ATCAATTAACCTTCGAGCACCG |
650 |
|
C. fetus sapB2 |
CF F CF R |
GCAAATATAAATGTAAGCGGAGAG TGCAGCGGCCCCACCTAT |
435 |
|
C. upsaliensis glyA |
CU F CU R |
AATTGAAACTCTTGCTATCC TCATACATTTTACCCGAGCT |
204 |
|
C. lari glyA |
CL F CL R |
TAGAGAGATAGCAAAAGAGA TACACATAATAATCCCACCC |
251 |
|
C. coli glyA |
CC F CC R |
GTAAAACCAAAGCTTATCGTG TCCAGCAATGTGTGCAATG |
126 |
|
C. jejuni hipO |
CJ F CJ R |
ACTTCTTTATTGCTTGCTGC GCCACAACAAGTAAAGAAGC |
323 |
streptomycin (strA/strB, aadA and (aac(3)IV) and tetracycline [tet(A), tet(B), tet(C)] were targeted. These specific genes were targeted through specific primers. Details of the primers, PCRs amplification and conditions used are given in Table II.
Table II.- Zone of inhibition and concentrations of different antibiotics discs.
|
S. No |
Antibiotics |
Abbreviation |
Disc content |
Zone of inhibition (mm) |
||
|
Sensitive |
Intermediate |
Resistance |
||||
|
1. |
Azithromycin |
AZM |
15 µg |
>18 |
14-17 |
<13 |
|
2. |
Lincomycin |
LIN |
2 µg |
>21 |
16-20 |
<15 |
|
3. |
Ampicillin |
AMP |
10 µg |
>17 |
14-16 |
<13 |
|
4. |
Sulphamethoxazole + Trimethoprim |
SXT |
25 µg |
>16 |
11-15 |
<10 |
|
5. |
Ciprofloxacin |
CIP |
5 µg |
>31 |
21-30 |
<20 |
|
6. |
Gatifolxacin |
GAT |
5µg |
>18 |
15-17 |
<14 |
|
7. |
Ofloxacin |
OFX |
5 µg |
>31 |
21-30 |
<20 |
|
8. |
Levofloxacin |
LVX |
5 µg |
>31 |
21-30 |
<20 |
|
9. |
Clarithromycin |
CLR |
15 µg |
>18 |
14-17 |
<13 |
|
10. |
Chloramphenicol |
CHL |
30 µg |
>18 |
13-17 |
<12 |
|
11. |
Tetracyclin |
TET |
30 µg |
>15 |
12-14 |
<11 |
|
12. |
Strptomycin |
STR |
10 µg |
>15 |
12-14 |
<11 |
|
13. |
Gentamycin |
GEN |
10 µg |
>15 |
13-14 |
<12 |
|
14. |
Amoxicillin |
AMX |
20 µg |
>17 |
14-16 |
<13 |
|
15. |
Ceftriaxone |
CRO |
30 µg |
> 23 |
20-22 |
<19 |
Table III.- Targeted antibiotic resistance genes, their primers and PCR conditions.
|
mPCR |
Targeted genes |
Primers |
Sequence of primers |
Annealing temp (°C) |
Product size (bp) |
|
1 |
blaTM |
GKTEMFd |
TTAACTGGCGAACTACTTAC |
55 |
247 |
|
GKTEMRd |
GTCTATTTCGTTCATCCATA |
||||
|
blaSHV |
SHV-Fj |
AGGATTGACTGCCTTTTTG |
55 |
393 |
|
|
SHV-Rj |
ATTTGCTGATTTCGCTCG |
||||
|
blaCMY-2 |
CMYFd |
GACAGCCTCTTTCTCCACA |
55 |
1000 |
|
|
CMYRd |
GGACACGAAGGCTACGTA |
||||
|
2 |
aadA |
4Fe |
GTGGATGGCGGCCTGAAGCC |
63 |
525 |
|
4Re |
AATGCCCAGTCGGCAGCG |
||||
|
strA/strB |
strA-Ff |
ATGGTGGACCCTAAAACTCT |
63 |
893 |
|
|
strB-Rf |
CGTCTAGGATCGAGACAAAG |
||||
|
aac(3)IV |
aac4-Lg |
TGCTGGTCCACAGCTCCTTC |
63 |
653 |
|
|
aac4-Rg |
CGGATGCAGGAAGATCAA |
||||
|
3 |
aadB |
aadB-Li |
GAGGAGTTGGACTATGGATT |
55 |
208 |
|
aadB-Ri |
CTTCATCGGCATAGTAAAAG |
||||
|
4 |
tet (A) |
TetA-Lc |
GGCGGTCTTCTTCATCATGC |
63 |
502 |
|
TetA-Rc |
CGGCAGGCAGAGCAAGTAGA |
||||
|
tet (B) |
TetBGK-F2m |
CGCCCAGTGCTGTTGTTGTC |
63 |
173 |
|
|
TetBGK-R2m |
CGCGTTGAGAAGCTGAGGTG |
||||
|
tet (C) |
TetC-Lc |
GCTGTAGGCATAGGCTTGGT |
63 |
888 |
|
|
TetC-Rc |
GCCGGAAGCGAGAAGAATCA |
||||
|
5 |
sul1 |
sul1-Fb |
CGGCGTGGGCTACCTGAACG |
66 |
433 |
|
sul1-Bb |
GCCGATCGCGTGAAGTTCCG |
||||
|
Sul2 |
sulII-Lc |
CGGCATCGTCAACATAACCT |
66 |
721 |
|
|
sulII-Rc |
TGTGCGGATGAAGTCAGCTC |
||||
|
Sul3 |
sul3-GKa-Fd |
CAACGGAAGTGGGCGTTGTGGA |
66 |
244 |
|
|
sul3-GKa-Rd |
GCTGCACCAATTCGCTGAACG |
Results
Prevalence of Campylobacter jejuni
Broiler meat samples (n=1260) were processed for detection of campylobacter species. All isolates were further confirmed through colony characteristics, morphology, biochemical testing and detection of their specific genes through PCR. The overall prevalence of Camylobacter jejuni was 14% being higher in Peshawar Division (21%) followed by Bannu division (16%), Malakand Division (13%) and Hazara Division (8%). A total of 182 isolates were obtained from four different regions. All the four regions are different in temperature and climatic condition.
Distribution of phenotypic antibiotic resistance
A total of 182 isolates were tested for 15 different antibiotics using disc diffusion method. Over all highest antibiotic resistance was found against AMX (93%) followed by LIN (88%), AMP (86%), TET (82%), SXT (75), CHL (68%), CLR (65%), STR (50%), GEN (44%), OFX (27%), CIP (25%), LFX (13%) and AZM (11%) while the least resistance was found against GAT (8%) and CRO(9%). There was a very obvious and crystal clear difference in distribution of antibiotic resistance in Campylobacter jejuni isolates from four different regions as shown in Table IV. 90% isolates were found to have multiple drug resistance.
Table IV.- Antibiotic resistance in Campylobacter jejuni.
|
S. No. |
Antibiotics |
No. of resistant isolates |
||||
|
Total n=182 (%) |
Peshawar division n= 65(%) |
Bannu division n= 50(%) |
Malakand division n=42(%) |
Hazara division n= 25(%) |
||
|
1 |
LIN |
160 (88) |
50 (77) |
45 (90) |
35 (83) |
25 (100) |
|
2 |
AMX |
170 (93) |
62 (95) |
48 (96) |
37 (88) |
23 (92) |
|
3 |
TET |
150 (82) |
55 (84) |
40 (80) |
35 (83) |
20 (80) |
|
4 |
AMP |
157 (86) |
60 (92) |
45 (90) |
33 (78) |
19 (76) |
|
5 |
SXT |
136 (75) |
48 (74) |
40 (80) |
30 (71) |
18 (72) |
|
6 |
CHL |
124 (68) |
42 (65) |
39 (78) |
28 (67) |
15 (60) |
|
7 |
CLR |
118 (65) |
40 (61) |
38 (76) |
30 (71) |
10 (40) |
|
8 |
STR |
91 (50) |
25 (38) |
24 (48) |
32 (76) |
10 (40) |
|
9 |
GEN |
80 (44) |
32 (49) |
21(42) |
15 (36) |
12 (48) |
|
10 |
OFX |
50 (27) |
18 (28) |
15 (30) |
12 (28) |
5 (20) |
|
11 |
CIP |
45 (25) |
20 (31) |
11 (22) |
9 (21) |
5 (20) |
|
12 |
LFX |
25 (13) |
9 (14) |
10 (20) |
5 (11) |
1(4) |
|
13 |
AZM |
20 (11) |
8 (12) |
7 (14) |
5 (11) |
0 (0) |
|
14 |
CRO |
15 (8) |
6 (9) |
5 (10) |
4 (9) |
0 (0) |
|
15 |
GAT |
10 (5) |
5 (8) |
4 (8) |
1 (2) |
0( 0) |
Table V.- Antibiotic resistant genes (ARGs) in Campylobacter jejuni.
|
ARGs |
Total, n=182 (%) |
Peshawar, n= 65(%) |
Bannu, n= 50 (%) |
Malakand, n=42(%) |
Hazara, n= 25(%) |
|
tetA |
150 (82) |
55 (85) |
40 (80) |
35 (83) |
20 (80) |
|
tetB |
87 (48) |
40 (61) |
30 (60) |
10 (24) |
7 (25) |
|
tetC |
129 (71) |
48 (74) |
38 (76) |
30 (71) |
13 (52) |
|
aadA |
80 (44) |
32 (49) |
18 (36) |
24 (57) |
6 (24) |
|
strA/strB |
91 (50) |
25 (38) |
24 (48) |
32 (76) |
10 (40) |
|
aac(3)IV |
68 (37) |
28 (43) |
20 (40) |
17 (40) |
3 (12) |
|
blaTEM |
170 (93) |
62 (95) |
48 (96) |
37 (88) |
23 (92) |
|
blaSHV |
131 (72) |
51 (78) |
36 (72) |
29 (69) |
15 (60) |
|
blaCMY-2 |
80 (44) |
30 (46) |
17 (34) |
20 (48) |
13 (52) |
|
Sul1 |
90 (49) |
29 (45) |
23 (46) |
18 (43) |
20 (80) |
|
Sul2 |
136 (75) |
48 (74) |
40 (80) |
30 (71) |
18 (72) |
|
Sul3 |
38 (21) |
12 (18) |
17 (34) |
10 (24) |
1 (4) |
|
aaddB |
16 (9) |
9 (14) |
5 (10) |
2 (5) |
0 (0) |
Distribution of antibiotic resistant genes (ARGs)
As for as antibiotic resistant genes are concerned, the highest ARG was blaTEM (93%) followed by tetA (82%), sul2 (75%), blaSHV (72%), tetC (71%), strA/strB (50%), sul1 (49%), blaCMY2 and aadA (44%) while the least resistant gene was aadb (9%) followed by sul3 (21%) and aac(3)IV (37%). All the isolates from four different regions were found to have different distribution of resistant genes as shown in Table V. 92% isolates were found to have multiple antibiotic resistances.
Discussion
Campylobacter species are among the most important food borne pathogens causing zoonosis. Mostly this infection is restricted to GIT in human but in severe cases it may lead to other severe syndromes. Different countries have reported different prevalence of campylobacter in poultry meat including 85% in Northern Ireland (Moran et al., 2009), 87% in Poland (Wieczorek et al., 2013), 20.8% in Estonia (Mäesaar et al., 2014), and 73-81% in Italy (Parisi et al, 2007; Pezzotti et al., 2003). These results are a bit higher and not consistent to our study and the reasons could be due to different climatic conditions, different slaughtering techniques, evisceration, and packing processing. Other reasons may due to different types of samples used.
Antibiotic resistance is one of the greatest threat to the world after infections. This study also described the prevailing situation of AMR in Campylobacter jejuni. Here are also different study reports from different countries describing different scenario of AMR in Campylobacter. Ledergerber et al. (2003) have reported 28.7% resistance to ciprofloxacin, 12.6% to tetracycline, 11.8% to sulphonamide, and 10.3% to ampicillin in a study conducted in Switzerland. Mattheus et al. (2012) have conducted a study in Belgium poultry in which he found resistance of Campylobacter species to AMP (47.4%), CIP (42.1%), Erythromycin (12.1%), GEN (25.6%), nalidixic acid (46.4%) and TET (45.3%). Miflin et al. (2007) have conducted a study on Campylobacter jejuni in Queensland region and found 18.4% resistance for tetracycline and 17.6% for ampicillin. Bester et al. (2008)highest resistance for tetracycline (98.2%) and ceftriaxone (96.4%) in a study conducted in broiler in South Africa. Obeng et al. (2012) have observed extensive resistance of campylobacter to lincomycin (51-100%), ampicillin (33·3-60·2%) and tetracycline (5·6-40·7%). Wieczorek et al. (2018) conducted a study in Poland in poultry and found resistance to ciprofloxacin (92.5%), followed by nalidixic acid (88.9%) and tetracycline (68.4%). Another study conducted in Poland by Wysok et al. (2017), where he reported 52.7% resistance to ciprofloxacin, 56% to nalidixic acid and 61.3% to doxycycline.
Nguyen et al. (2016) have found high rate of resistance to nalidixic acid, tetracycline and ciprofloxacin of 77.4, 71.0 and 71.0%, respectively. Low resistance (25.8%) was detected for gentamicin and chloramphenicol. Gupta et al. (2004) have conducted a study on AMR in USA from 1998-2001. They observed that ciprofloxacin-resistant Campylobacter have increased from 13% to 19%. No increase was observed in erythromycin resistance which remains the same at 2% from 1998-2001. Senok et al. (2007) have discovered highest resistance of Campylobacter to CIP (88.8%) and 32.6% to TET in a study conducted in Kingdom of Bahrain. Similarly, a study conducted in China by Xia et al. (2010) have reported 98% resistance of Campylobacter to nalidixic acid, ciprofloxacin, enrofloxacin, tetracyclines and doxycycline. These studies are a clear indication of extensive AMR in Campylobacter around the world. The difference in the results could be due to different geographical locations, different climatic conditions and usage of different antibiotics in animal feeds.
To the best of our search, knowledge and understanding this is the first study that we conducted on the detection of ARGs in Campylobacter in Pakistan. Our study have reported the highest ARG blaTEM (93%) followed by tetA (82%), sul2 (75%), blaSHV (72%), tetC (71%), strA/strB (50%), sul1 (49%), blaCMY2 and aadA (44%) while the least resistant gene was aadb (9%) followed by sul3 (21%) and aac(3)IV (37%) which is consistent to phenotypic data. Different countries have reported different ARGs in Campylobacter. Abdi-Hachesoo et al. (2014) have tested Campylobacter species for TET genes in Iran and found that 18% isolates were positive for TET (A) gene. Obeng et al. (2012) have found different antibiotic resistance genes including bla (OXA-61) (82·6-92·7%), cmeB (80·3-89%) and tet(O) (22·3-30·9%) in C. coli isolates from pigs, while C. jejuni from chickens were found to harbor bla(OXA-61) (59-65·4%) and tet(O) (19·2-40·7%). Similarly, Reddy and Zishiri (2017) have tested Campylobacter species for gyrA, blaOXA-61, and TET genes. 68% isolates were found positive for tetO gene which was the most prevalent. Quinolone resistance was highly associated with gyrA genes. Gleisz et al. (2006) have tested campylobacter for AMR in Austria and found that 21% were resistant to tetracycline, 18% for AMP and 11% for STR and all isolates were found positive for tetO gene. Again results of ARGs are also in disagreement and possible reasons could be due to different geographical locations, usage of different antibiotics and testing of different targeted ARGs.
Conclusion
Campylobacter jejuni 90% have multiple drug resistance while more than 92% have multiple ARGs. This is an alarming situation of AMR in Campylobacter jejuni in Khyber Pakhtunkhwa province of the country which needs prompt attention of the concerned veterinary and public health authorities since the diseases is zoonotic that could pose potential health threat.
Acknowledgment
The study was supported by the Microbiology Laboratory of Department of Animal Health, The University of Agriculture, Peshawar, Directorate General Extension and Directorate General of Research, Veterinary Research Institute, Peshawar.
Statement of conflict of interest
There is no conflict of interest.
References
Adzitey, F., Huda, N., Rusul, G. and Ali, R., 2012. Prevalence and antibiotic resistance of Campylobacter, Salmonella, and L. monocytogenes in ducks: A review. Foodb. Pathog. Dis., 9: 498-505. https://doi.org/10.1089/fpd.2011.1109
Abdi-Hachesoo, B., Khoshbakht, R., Sharifiyazdi, H., Tabatabaei, M., Hosseinzadeh, S. and Asasi, K., 2014. Tetracycline resistance genes in Campylobacter jejuni and C. coli isolated from poultry carcasses. Jundishapur J. Microbiol., 7: 121-129. https://doi.org/10.5812/jjm.12129
Borck, B. and Pedersen, K., 2005. Pulsed-field gel electrophoresis types of Campylobacter spp. in Danish turkeys before and after slaughter. Int. J. Fd. Microbiol., 101: 63-72. https://doi.org/10.1016/j.ijfoodmicro.2004.10.044
Bester, L.A. and EssackPrevalence of antibiotic resistance in Campylobacter isolates from commercial poultry suppliers in KwaZulu-Natal, South Africa. J. Antimicrob. Chemother., 62: 1298-1300. https://doi.org/10.1093/jac/dkn408
CDC, 2017. Campylobacter (Campylobacteriosis). Centers for Disease Control and Prevention CDC. Available at: https://www.cdc.gov/campylobacter/index.html
EFSA-ECDC, 2014. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2012. European Food Safety Authority and European Centre for Disease Prevention and Control. Eur. Fd. Safe. Auth. J., 12: 3590. https://doi.org/10.2903/j.efsa.2014.3590
EFSA-ECDC, 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. European Food Safety Authority and European Centre for Disease Prevention and Control. Eur. Fd. Safe. Auth. J., 13: 3991. https://doi.org/10.2903/j.efsa.2015.3991
Gupta, A., Nelson, J.M., Barrett, T.J., Tauxe, R.V., Rossiter, S.P., Friedman, C,R., Joyce, K.W., Smith, K.E., Jones, T.F., Hawkins, M.A., Shiferaw, B., Beebe, J.L., Vugia, D.J., Rabatsky-Ehr, T., Benson, J.A., Root, T.P. and Frederick J., 2004. Antimicrobial resistance among Campylobacter strains, United States, 1997–2001. Emerg. Infect. Dis., 10: 6. https://doi.org/10.3201/eid1006.030635
Gleisz, B., Sofka, D. and Hilbert, F., 2006. Antibiotic resistance genes in thermophilic Campylobacter spp. isolated from chicken and turkey meat. EPC 2006 - 12th European Poultry Conference, 10-14 September, 2006, Verona, Italy.
Galani, I., Kontopidou, F., souli, M., Rekatsina, P.D, Koratzanis, E., Deliolanis, J. and Giamarellou, H., 2008. Colistin susceptibility testing by Etest and disc diffusion methods. Int. J. Antimicrob. Agents, 31: 434-439. https://doi.org/10.1016/j.ijantimicag.2008.01.011
Giannatale, E.D., Prencipe, V., Colangeli, P., Alessiani, A., Barco, L., Staffolani, M., Tagliabue, S., Grattarola, C., Cerrone, A.., Costa, A., Pisanu, M., Santucci, U., Iannitto, G. and Migliorati, G., 2010. Prevalence of thermotolerant Campylobacter in broiler flocks and broiler carcasses in Italy. Vet. Ital., 46: 405-414.
Gharst, G., Oyarzabal, O.A. and Hussain, S.K., 2013. Review of current methodologies to isolate and identify Campylobacter spp. from foods. J. Microbiol. Meth., 95: 84-92. https://doi.org/10.1016/j.mimet.2013.07.014
Kozak, G.K., Boerlin, P., Janecko, N., Reid-Smith, R.J. and Jardine, C., 2009. Antimicrobial resistance in E. coli of swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario. Appl. environ. Microbiol., 75: 559-566. https://doi.org/10.1128/AEM.01821-08
Ledergerber, U., Regula, G., Stephan, R., Danuser, J., Bissig, B. and Stärk, K.D.C., 2003. Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland. BMC Publ. Hlth., 3: 39. https://doi.org/10.1186/1471-2458-3-39
Moran, L., Scates, P. and Madden, R.H., 2009. Prevalence of Campylobacter spp. in raw retail poultry on sale in Northern Ireland. J. Fd. Protec., 72: 1830-1835. https://doi.org/10.4315/0362-028X-72.9.1830
Mattheus, W., Botteldoorn, N., Heylen, K., Pochet, B. and Dierick, K., 2012. Trend analysis of antimicrobial resistance in Campylobacter jejuni and Campylobacter coli isolated from Belgian pork and poultry meat products using surveillance data of 2004–2009. Foodb. Pathog. Dis., 9: 5. https://doi.org/10.1089/fpd.2011.1042
Miflin, J.K., Templeton, J.M. and Blackall, P.J.,Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from poultry in the South-East Queensland region. J. Antimicrob. Chemother., 59: 775-778. https://doi.org/10.1093/jac/dkm024
Mäesaar, M., Praakle, K., Meremäe, K., Kramarenko, T., Sõgel, J., Viltrop, A., Muutra, K., Kovalenko, K., Matt, D., Hörman, A., Hänninen, M.-L. and Roasto, M., 2014. Prevalence and counts of Campylobacter spp. in poultry meat at retail level in Estonia. Fd Contr., 44: 72–77.
Nguyen, T.M.N., Hotzel, H., Njeru, J., Mwituria, J., El-Adawy, H., Tomaso, H., Neubauer, H. and Hafez, H.M., 2016. Antimicrobial resistance of Campylobacter isolates from small scale and backyard chicken in Kenya. Gut Pathog., 8: 121-125. https://doi.org/10.1186/s13099-016-0121-5
Obeng, A.S., Rickard, H., Sexton, M., Pang, Y., Peng, H. and Barton, M., 2012. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia. J. appl. Microbiol., 113: 294-307. https://doi.org/10.1111/j.1365-2672.2012.05354.x
Parisi, A., Lanzilotta, S.G., Addante, N., Normanno, G., Di Modugno, G. and Dambrosio, A., 2007. Prevalence, molecular characterization and antimicrobial resistance of thermophilic campylobacter isolates from cattle, hens, broilers and broiler meat in south-eastern Italy. Vet. Res. Commun., 31: 113-123.
Pezzotti, G., Serafin, A., Luzzi, I., Mioni, R., Milan, M. and Perin, R., 2003. Occurrence and resistance to antibiotics of Campylobacter jejuni and Campylobacter coli in animals and meat in northeastern Italy. Int. J. Fd. Microbiol., 82: 281-287.
Rapp, D., Ross, C.M., Pleydell, E.J. and Muirhead, R.W., 2012. Differences in the fecal concentrations and genetic diversities of Campylobacter jejuni populations among individual cows in two dairy herds. Appl. environ. Microbiol., 78: 7564-7571. https://doi.org/10.1128/AEM.01783-12
Rejab, S.B., Zessin, K.H., Fries, R. and Patchanee, P., 2012. Campylobacter in chicken carcasses and slaughterhouses in Malaysia. Southeast Asian J. trop. Med. Publ. Hlth., 43: 96-104.
Reddy, S. and Zishiri, O.T., 2017. Detection and prevalence of antimicrobial resistance genes in Campylobacter spp. isolated from chickens and humans. Onderstepoort J. Vet. Res., 84: 1. https://doi.org/10.4102/ojvr.v84i1.1411
Senok, A., Yousif, A., Mazi, W., Sharaf, E., Bindayna, K., Elnima, E. and Botta, G., 2007. Pattern of antibiotic susceptibility in Campylobacter jejuni isolates of human and poultry origin. Jpn. J. Infect. Dis., 60: 1-4.
Silva, J., Leite, D., Fernandes, M., Mena, C., Gibbs, P.A. and Teixeira, P., 2011. Campylobacter spp. as a foodborne pathogen: A review. Front. Microbiol., 2: 200. https://doi.org/10.3389/fmicb.2011.00200
Wieczorek, K., Kania, I. and Osek, J., 2013. Prevalence and antimicrobial resistance of Campylobacter spp. isolated from poultry carcasses in Poland. J. Fd. Protec., 76): 1451-1455. https://doi.org/10.4315/0362-028X.JFP-13-035
Wieczorek, K., Wołkowicz, T. and Osek, J., 2018. Antimicrobial resistance and virulence-associated traits of Campylobacter jejuni isolated from poultry food chain and humans with diarrhea. Front. Microbiol., https://doi.org/10.3389/fmicb.2018.01508
WHO, 2017. Campylobacter. World Health Organization. Available at: http://www.who.int/mediacentre/factsheets/fs255/en/
Wysok, B., Wojtacka, J., Wiszniewska, A., Szteyn, J. and Gomółka, M., 2017. Prevalence and antimicrobial resistance of Campylobacter isolates from poultry offals. Med. Wet., 73: 561-566. https://doi.org/10.21521/mw.5770
Xia, C., GaoWa, N., CongMing, W., Yang, W., Lei, D., LiNing, X., PengJie, L., QiJing, Z. and JianZhong, S., 2010. Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China. Vet. Microbiol., 144: 133-139. https://doi.org/10.1016/j.vetmic.2009.12.035
Zhao, C., Ge, B., Villena, J.D., Sudler, R., Yeh, E., Zhao, S., White, D.G., Wagner, D. and Meng, J., 2001. Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington DC area. Appl. environ. Microbiol., 67: 5431-5436. https://doi.org/10.1128/AEM.67.12.5431-5436.2001