Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
1Zoology Division, Institute of Pure and Applied Biology, Bahauddin Zakariya University, Multan 60800, Pakistan; 2Department of Pathobiology, Faculty of Veterinary Sciences, Bahauddin Zakariya, University, Multan 60800, Pakistan; 3Department of Statistics, Bahauddin Zakariya University, Multan 60800, Pakistan.
Abstract | The current survey was designed to study the infections of Theileria spp. (Theileria lestoquardi and T. ovis) in small ruminants through PCR and microscopy in Musa Pak Shaheed, Multan district, Pakistan amidst 2013. A total of 200 small ruminants (93 sheep and 107 goats) without any apparent signs of theileriosis were examined to diagnose Theileria piroplasms. During sampling, blood was amassed by puncturing the jugular vein in eppendorf comprising EDTA as anticoagulant coated tubes for the detection of Theileria piroplasms. DNA was extracted from collected samples and subjected to PCR amplification to determine ovine and caprine theileriosis. Through a questionnaire, the data regarding animals as well as herds characteristics were gathered to define the risk factors favors the spread of Theileria spp. infection. 24% and 8.5% Theileria infection identified through PCR and microscopic examination during present investigation. The PCR detected 14.5% and 9.5% Theileria piroplasms infection in sheep and goats, respectively. Among Theileria species, PCR identified the incidence of T. lestoquardi and T. ovis was 16.5% and 5% respectively while 6% blood samples revealed mixed infection of both species in overall small ruminants. The infection rate of T. lestoquardi was higher (9.5% and 7%) than T. ovis (3% and 2%) in sheep and goats respectively. Statistically significant correlation revealed between theileriosis and animal species, different age groups, presence of ticks, herd size and herd composition in small ruminants. The outcomes of the current survey ratified PCR amplification is discernible, specific and sensitive assay for diagnosis of ovine and caprine theileriosis.
Received | May 10, 2017; Accepted | November 30, 2020; Published | February 21, 2021
*Correspondence | Muhammad Riaz, Zoology Division, Institute of Pure and Applied Biology, Bahauddin Zakariya University, Multan 60800, Pakistan; Email: [email protected]
Citation | Riaz, M., Z. Tasawar, M.Z. Ullah and Z. Hussain. 2021. Parasitological and molecular survey on theileriosis of sheep and goats and the related risk factors in Musa Pak Shaheed Town, Multan, Pakistan. Sarhad Journal of Agriculture, 37(1): 136-145.
DOI | http://dx.doi.org/10.17582/journal.sja/2021/37.1.136.145
Keywords | PCR, Microscopic examination, Theileria lestoquardi, Theileria ovis, Sheep, Goats, Ruminants
Introduction
Livestock sector is an imperative tool of national economy in developing countries like Pakistan, being a source of foodstuff, energy resources and organic fertilizers for crops growth (Ahmad et al., 2007; Manan et al., 2006). Livestock sector in Pakistan subsidized to agriculture worth 56.3 percent although it contributes 11.8 % to the gross domestic product (GDP) during 2014-15. Livestock sector added Rs. 778.3 billion during 2013-14 to Rs. 801.3 billion during 2014-15 to the national income, a rise in 3.0 % recorded related to prior year (Economic Survey, 2014-15). Livestock role, in rural community can be professed that 30-35 million rural inhabitants are involved in livestock production having 2-3 cattle/buffaloes and 5-6 small ruminants (sheep or goats) per family having household fortune, helping to derive 30-40 % of their income (Durrani et al., 2006; Irshad et al., 2010). Sheep and goats constitute 2 from 3 billion total ruminants throughout the world (Ahmad et al., 2011). In Pakistan nearly 25 goats’s breed and at least two dozen sheep’s breed are raised throughout the country (Khan et al., 2006). Small ruminant rearing is favorable as a capital asset for generating breeding inventory and food product (Idrees et al., 2007). Comparing small ruminant hoisting with cattle, the former require considerably less capital per head. Generally lower productivity of livestock in Pakistan ascribed to many factors containing health problems caused by nutritional deficiencies, parasitic infestation and contagious infections dissonantly affect the ruminants which resulted in low productivity and high mortality (Zulfiqar et al., 2012). Theileriosis in small ruminants caused clinical illness and higher mortalities reported in Southern Europe, Middle East, China and Indian Subcontinent (Rao et al., 1991). Ovine and caprine theileriosis occurs due to six Theileria species, from these species, T. lestoquardi, T. luwenshuni and T. uilenbergi are deliberated extremely pathogenic while T. separata, T. ovis and T. recondite are in general less pathogenic in sheep and goats (Razmi et al., 2003). Theileria ovis and T. lestoquardi are whispered to cause ovine and caprine theileriosis in Pakistan (Durrani et al., 2011). T. lestoquardi causes pathogenic infection in sheep (Yin et al., 2007) and in goats (Jianxun and Hong, 1997) which also termed as malignant ovine theileriosis. Malignant ovine theileriosis has three forms: Acute, sub acute and chronic. Acute form may lead to death after a short course of fever and one or more of clinical symptoms that may appear: depression, inappetance, fever, swelling of superficial lymph nodes, respiratory manifestations and appearance of pale visible mucous membranes, jaundice and oedema of the throat (Rehman et al., 2010; Woldehiwet, 2007).
During earlier studies in Pakistan, Theileria spp. infection investigated through presence of clinical symptoms and examination of stained smears of bloods and lymphnodes. Microscopic examination and presence of clinical symptoms are trustworthy only in critical cases but deficient in carrier animals due to morphological resemblances among piroplasms (Inci et al., 2010; Telmadarraiy et al., 2012). Subclinical infections are also identified by serological methods such as indirect florescent antibody test (IFAT) and enzyme linked immunosorbent assay (ELISA) (Leemans et al., 1999) but these methods are not impeccable due to low parasitemia level and cross-reactions with other related pathogens (Altay et al., 2012). Polymerase chain reaction (PCR) is sensitive and specific than microscopy and IFAT for the diagnosis of Theileria piroplasms in small ruminants (Altay et al., 2005; Durrani et al., 2012). Bovine theileriosis had been extensively studied throughout the country However, the epidemiological attributes of theileriosis in small ruminants oats in Pakistan are poorly understood throughout the country and further studies are required to determine the real status of theileriosis and development of better methods to control ovine and caprine theileriosis (Naz et al., 2012). Currently, PCR amplification has been considered the preferential technique for diagnosis of ovine caprine theileriosis than conventional methods due to sensitive and specific as well as detected piroplasms at low parasitaemia level. This present investigation was aimed to study the indubitable status of theileriosis in sheep and goats from district Multan, Pakistan and adjoining areas by microscopy and PCR amplification method.
Materials and Methods
Study area
The study was conducted in Musapak Shaheed town of district Multan which is a one of the major cities in Punjab, Pakistan (Figure 1). The district Multan is located between 29’-22’north latitude and 71’-4’ east longitude with an extreme temperature 49 ºC during summer and 1ºC in winter and an average rainfall is 127 mm. The Musa pak shaheed town is located eastern to the Multan district, Pakistan. Total area of Musa pak shaheed town is about 322 sq., kilometers containing 24 union councils. Sheep and goats rearing is significant occupation of Musa pak shaheed town. Mostly small ruminants are reared collectively with average size of herd ranges between 50-100 animals/herd.
Blood sampling
Blood was collected from jugular vein of 200 apparently healthy small ruminants containing sheep (N= 93) and goats (N= 107) arbitrarily selected from various herds during 2013 located in Musapak Shaheed Town, Multan district, Pakistan. The blood samples were preserved in 5 ml glass tubes containing a drop of 0.5 M EDTA as anticoagulant. Through questionnaire, data regarding characteristics of animals and herds were gathered during sampling.
.
Blood smear examination
Thin smears of blood were prepared in field during sampling, and then air dried, fixed in methanol which used as preservative. 10% giemsa solution was used for staining the smears. Binocular microscope was used to examine smears under oil immersion lens at 1000 x magnification (Altey et al., 2005).
DNA extraction
The extraction of DNA was carried out by inorganic method followed (Shaikh et al., 2004).
Briefly, 750µl blood was taken in eppendorf tubes and 750µl of TE buffer (10 mM Tris-HCl, 2 mM EDTA, pH 8.0) was added and mixed by vertex, then centrifuged at 13,000 rpm for 5 min. The supernatant was wasted and TE washing was repeated for 2–3 times to make the pellet of WBCs totally hemoglobin free. Then add 6oo ml TNE buffer (10 mM Tris HCl, 2 mM EDTA, 400 mM NaCl) and 20 μl of 10% sodium dodecyl sulfate and 1 µl Proteinase K for protein digestion was added in pellets and incubated overnight.
After this add 1 ml of 5 M NaCl in eppendorf, shaked and chilled for 15 min on ice for precipitation of digested proteins which were pelleted by centrifugation for 5 min. and removed. Now the supernatant was shifted to new eppendorf and equal volume of chilled isopropanol was added, DNA in the form of fiber was appeared in the eppendorf tubes and pelleted by centrifugation for 5 min. After this DNA pellet was washed (70% ethanol) and dissolved in TE buffer. The extracted DNA was quantified through gel electrophoresis using 1.0% agarose gel.
PCR amplification
A touchdown thermocycler (BIORAD) was used for PCR amplification with a 50 µl total reaction volume having 5 µl of 10 X PCR buffer (100 mMTris–HCl (pH 9), 500 mMKCl, 1% Triton X-100), 250M each of the four dNTPs, 2 U Taq DNA polymerase, each primer 10 pg and 5 µl of template DNA. Three primers sets were used for amplification of the parasitic DNAs through PCR during present study described in Table 1. Professor Urike Seitzer (VIIRC, Borstel, Germany) provided positive control DNA of T. ovis and T. lestoquardi. Thermo profile for PCR of Theileria specific was containing at 94oC for 3 min., followed by 35 cycles, 1 min. at 94oC for denaturation, 1 min. at 60oC for annealing and 1 min. at 72oC for extension, with a final extension step of 72oC for 7 min. (Allossp et al., 1993) Thermo profile for T. lestoquardi was comprising at 94oC for 3 min., followed by 35 cycles at 94oC for 1 min., 56oC for 1 min. and 72oC for 1 min. with a final extension step of 72oC for 7 min. (Kirver et al., 1998). Thermo profile of T. ovis was consisting for 3 min. at 96oC, was followed by 5 cycles, 30s at 94oC, 30s at 56oC and of 1 min. at 72oC. These 5 cycles were followed by 30 cycles. Each cycle consisted of 30s at 94oC, 30s at 54oC and 1 min. at 72oC (Altay et al., 2005). The PCR program was ended with a final extension step of 7 min. at 72oC. Gel electrophoresis was used for documentation of PCR amplified fragments from extracted DNA of blood samples. 10 µl PCR amplified products with loading buffer run on 1.5% gel for 30 minutes and observed under UV illuminator for valuation and record.
Statistical analysis
For statistical analysis small ruminants were divided into different age catagories: ≤ 1 year, 1-2 years and ˃ 2 years old. Herds were divided in three different size categories containing animals 1-30, 31-60 and ˃ 60 animals. Based on composition, the animal’s herd was categorized into three groups containing sheep only, goats only or mixed containing both sheep and goats. Chi square and Fisher’s exact test was used for data analysis regarding Theileria spp. infection and potential risk factors responsible involved in outbreak of theileriosis in studied population of sheep and goats. MiniTab (Version 16) used to statistically analyze the recorded data of small ruminants.
Results and Discussion
Prevalence of Theileria infection in small ruminants
Theileria piroplasms were detected in 8.5% (17/200) small ruminants based on microscopic screening having ribbon or curved shaped observed under binocular microscope as described by Urquhart et al. (1996) as shown in Figure 2. Sheep revealed higher infection (5%) compared to goats (3.5%) based on microscopic examination. To evaluate the true status of Theileria spp. infection, the blood samples were subjected to PCR amplification which revealed significantly higher prevalence 24% (48/200) of Theileria species by the amplification of a 1098-bp DNA fragment of 18SSU ribosomal RNA (Allsopp et al., 1993) as depicted in Figure 3. Theileria infection found significantly higher (14.5%) in sheep as compared to goats (9.5%). All the positive samples identified through blood smears were confirmed by PCR. The incidence of Theileria piroplasms among different sampling sites was significantly associated (p ˂0.05) as indicated by chi square analysis as shown in Table 2. The PCR amplification showed higher infection of theileriosis in Basti Jhanday wala (60%) while lower in Botay wala (6.7%). The current investigation is the foremost report on ovine and caprine theileriosis in Musapak Shaheed, Multan district, Pakistan. PCR analysis indicated the incidence of theileriosis was more rampant in area under study.
Table 1: Primers used for the detection of genus Theileria infection and T.ovis and T. lestoquardi in small ruminants in Musapak shaheed, Multan, Southern Punjab, Pakistan during 2013.
|
Primer specificity |
Target gene |
Product size (bp) |
Reference |
|
|
Theileria specific |
18SSU rRNA |
F. 5′-AGTTTCTGACCTATCAG-3′ |
1098 |
|
|
R. 5′-TTGCCTTAAACTTCCTTG-3′ |
||||
|
Theileria ovis |
18SSU rRNA |
F. 5′-TCGAGACCTTCGGGT-3′, |
520 |
|
|
R. 5′-TCCGGACATTGTAAAACAAA-3′ |
||||
|
Theileria lestoquardi |
18SSU rRNA |
F. 5′-GTGCCGCAAGTGAGTCA-3′ |
785 |
|
|
R.5′GGACTGATGAGAAGACGATGAG3′ |
Table 2: Microscopic examination of thin blood smears and PCR amplification results of sheep and goats in Musapak Shaheed, Multan, Southern Punjab, Pakistan during 2013.
|
Area |
No. of samples |
Test |
||||
|
Micr. examination |
PCR examination |
|||||
|
Positive |
% |
Positive |
% |
P*value |
||
|
Basti Garrialla |
40 |
2 |
(5) |
10 |
(25) |
|
|
Botay wala |
30 |
1 |
(3.3) |
2 |
(6.7) |
|
|
19 Kasi |
10 |
- |
- |
1 |
(10) |
|
|
Basti Jhaday wala |
25 |
3 |
(12) |
15 |
(60) |
|
|
Makhdoom Rashid |
20 |
2 |
(10) |
3 |
(15) |
|
|
Jalal abad |
30 |
3 |
(10) |
8 |
(26.7) |
|
|
Dera Budahu |
20 |
5 |
(25) |
6 |
(30) |
0.000 b*** |
|
Punjnand |
25 |
2 |
(8) |
3 |
(12) |
|
|
Total |
200 |
17 |
(8.5) |
48 |
(24) |
0.000a*** |
a: Fisher’s exact test; b: Chi square test; P < 0.01 = Significant (*).
The infection rate of Theilaeria lestoquardi and T. ovis
Theileria spp. identified through PCR was T. lestoquardi and T. ovis in small ruminants during current study. The blood samples detected positive by microscopy verified through PCR amplification. Theileria piroplasms did not discern in stained blood smears that were found negative during PCR amplification. The diagnosis of hemoprotozoans is often onerous in the carrier animals due to low parasitemia and mixed infection of piroplasms (Altay et al., 2005) and specific and sensitive molecular techniques are needed for diagnosis of Theileria piroplasms (Naz et al., 2012). PCR amplification enables the detection and discernment of Theileria spp. at low parasitemia rates in carrier small ruminants. The present study revealed higher incidence of theileriosis by PCR amplification (24%) compared to blood smears examination (8.5%) in studied small ruminants. Statistical significant association (p ˂ 0.00) perceived between PCR and blood smear screening test. Our results are consistent to previous findings reported in Turkey by Altay et al. (2005); in Pakistan by Durrani et al. (2011) and in Iran by Jalali et al. (2014) who confirmed that PCR amplification revealed higher prevalence of theileriosis in small ruminants compared to microscopy. The lower prevalence reported by microscopy during present study was expected because this technique does not detect carrier small ruminants with low parasitemia rate. During PCR, the amplified DNA fragment 520 bp considered positive for T. ovis (Altey et al., 2005) and 785 bp for T. lestoquardi (Kirver et al., 1998) respectively in the studied blood samples of small ruminants as indicated in Figure 4. In overall small ruminants theileriosis found higher in sheep (14.5%) than goats (9.5%) and the association was statistically significant (p ˂0.05) between theileriosis and animal species as stated in Table 3. The prevalence of T. lestoquardi, T. ovis and mixed infection (both spp.) was found 16.5%, 5% and 3% respectively in overall small ruminants. Both in sheep and goats the infection rate of T. lestoquardi was reported higher than T. ovis during present study. Among Theileria positive samples in sheep the T. lestoquardi infection was significantly higher (65.5%) compared to T. ovis (20.7%) while mixed infection of both species was reported in 13.8% blood samples. Similar trend of higher infection of T. lestoquardi was found 73.7% compared to T. ovis 21% and mixed infection was found in 5.3% among positive blood samples of goats as described in Table 3.
Table 3: The frequency of Theileria species based on PCR in sheep and goats in Musa Pak Shaheed Town, Multan District, Southern Punjab, Pakistan during 2013.
|
Theileria species |
Overall 200 |
Sheep 93 |
Goats 107 |
|
Genus Theileria |
48 (24 %) |
29 (14.5 %) |
19 (9.5 %) |
|
Theileria lestoquardi |
33 (16.5 %) |
19 (65.5 %) |
14 (73.7 %) |
|
Theileria ovis |
10 (5 %) |
6 (20.7 %) |
4 (21 %) |
|
Mixed |
6 (3 %) |
4 (13.8 %) |
1 (5.3 %) |
|
P value |
0.00a |
0.00a |
0.01a |
a: Chi square test P < 0.01= Significant (*).
The frequency of theileriosis in sheep and goats during current study was outstanding which share the same pasture. PCR identified statistically significantly (p < 0.05) higher prevalence of theileriosis in sheep (14.5%) than in goats (9.4%) during present study. The findings are in consistent with the findings of Guo et al. (2002) who reported 27.63% sheep and 13.12% goats infected with theileriosis in Ganan region, China. Similar results were found by Irshad et al. (2010) during a study in Okara and Islamabad, Pakistan, higher prevalence in sheep (7.36%) compared to goats (3.8%). Similar trend was found by Altay et al. (2012) who reported higher Theileria infection in sheep (28.90%) than in goats (4.10%) in Turkey. Iqbal et al. (2013) also reported higher prevalence of theileriosis in sheep (23.00%) than goats (11.00%) based on RLB during a study in Pakistan. Statistically significantly higher prevalence (p < 0.05) in sheep compared to goats could be due to difference of skin nature of the two livestock species. The skin of goats is thin and more resistant for attachment of ticks as compared to skin of sheep (Naz et al., 2012) and variation of resistance in various breeds and due to the fact that goats used marginal areas for breeding where is lower chance for ticks to contact with animal body reported by Alessandra and Santo (2012).
Through PCR amplification, Theileria lestoquardi and T. ovis were diagnosed in studied small ruminants. Similar Theileria spp. was reported by Heiderpour et al. (2009, 2010) and by Durrani et al. (2011) in sheep and goats. The infection rate of T. lestoquardi was significantly (p< 0.05) higher (16. 5 %) than T. ovis (5%) while mixed infection of both species was recorded 3% in overall small ruminants. Significantly (p< 0.05) higher frequency of T. lestoquardi 65.5% and 73.3% compared to T. ovis 27.7 and 21% was found in sheep and goats respectively during present study. But our results are contradicts to Sayen et al. (2009) and Rjeibi et al. (2014) who reported higher prevalence of T. ovis compared to T. lestoquardi in small ruminants in Turkey. This discrepancy may be due to difference of geoclimatic conditions, tick infestation and genetic resistance among different species of small ruminants against theileriosis.
The results revealed T. lestoquardi infection was significantly higher (65.5%) compared to T. ovis (20.7%) in sheep. The findings are in line with Heiderpour et al. (2010) who reported higher prevalence (87.5%) of T. lestoquardi compared to (12.5%) of T. ovis in small ruminants in Iran. Similar trends of higher prevalence of T. lestoquardi (54.8%) compared to T. ovis (40.2%) revealed in sheep by Zeemi et al. (2011) in Iran. The results of present study disagree with the previous findings of Altay et al. (2012) who reported higher prevalence of T. ovis (18.9%) compared to other Theileria species infection in Turkey. Yaghfoori et al. (2013) reported higher prevalence of T. ovis (43%) than T. lestoquardi (3%) in sheep in Iran which is contradicts to present study. In goats, the infection of T. lestoquardi and T. ovis was found 73.7% and 4.0% respectively during the present study. The similar results of higher prevalence of T. lestoquardi in goats has been reported by many authors in different regions of the world, 40.0 % by Luo and Yin (1997); 20.8% by Zangana and Naqid (2011); 78.3% in Nubian goats by Hussein et al. (1993); 14.0% by Hassan et al. (2013). The findings of current survey denies by Sayin et al. (2009) who reported higher prevalence of T. ovis (12.36%) than T. lestoquardi in sheep and goats in Turkey. The difference in infection rate of Theileria species in sheep and goats might be validated to genetic difference of animal species, tick species acting as vector and geoclimatic conditions of the studied areas.
Risk factors involved in the spread of theileriosis
For the evaluation of risk factors associated with theileriosis, the pooled data was analyzed. Fisher exact test revealed a significant correlation (p ˂0.05) of Theileria spp. infection with animal species and presence of ticks but non-significant association with gender of the animal (p > 0.05) in overall small ruminants. For assessment of animals and herds characteristics as possible risk factor for the spread of theileriosis in sheep and goats, some basic data of every animal and herd was collected during the survey. The males had higher infection rate (27.7%) than that of females (23.2%). Our results indicated a non-significant correlation (p>0.05) between theileriosis and gender in small ruminants. Similar trends of higher theileriosis in male animals recorded when only goat data was analyzed and the correlation with theileriosis was significant (p < 0.05). In sheep, the infection rate of both Theileria species was same in both sexes and the association was non-significant (p > 0.05). The results are in consistent with Hussein et al. (2013) who reported that males had higher infection of ovine theileriosis (30.64%) as compared to females (12.74%) in Sudan. The probable reason of lower prevalence in females could be due to fact that during pregnancy lactation, heat reduced tick resistance which in turn led to the lower transmission of disease, but contradicts to Naz et al. (2012) who found higher Theileria spp. infection in females than males in sheep and goats in Lahore, Pakistan. Chi square results indicated the prevalence of Theileria infection was significantly correlated with age of animals (p < 0.05) as depicted in Table 4. The collected data of sheep and goats was also separately analyzed which indicated non-significant correlation of theileriosis with gender and breed in sheep (p > 0.05) while age and tick infestation was significantly correlated with theileriosis (p ˂ 0.05) as indicated in Table 4. Among goats age of the animal and tick infestation was found non-significant (p > 0.05) while gender and breed of goats was found significant (p ˂ 0.05) as described in Table 4.
Table 4: Association between occurrence of Theileria parasites identified by PCR in sheep and goats and the studied parameters describing animal characters in Musa Pak Shaheed, Multan, Southern Punjab, Pakistan during 2013.
|
Animal type |
Parameters |
No. of samples |
Piroplasms Positive |
Piroplasms Negative |
P* value |
|
|
Sheep and goats (Combined) |
Animal type |
Sheep |
93 |
29 (41.7) |
64 (58.3) |
0.03a* |
|
Goats |
107 |
19 (26.6) |
88(73.4) |
|||
|
Sex |
Male |
36 |
10 (27.7) |
26 (72.3) |
0.52a |
|
|
Female |
164 |
38 (23.2) |
126(76.8) |
|||
|
Age |
≤ 1 year |
57 |
19 (33.3) |
38 (66.7) |
0.02b* |
|
|
≤ 2 year |
66 |
18 (27.3) |
48 (72.7) |
|||
|
≥ 3 year |
77 |
11 (14.3) |
66 (85.7) |
|||
|
Ticks |
Present |
140 |
41 (39.5) |
99 (61.5) |
||
|
Absent |
60 |
7 (25) |
53 (75) |
0.00a* |
||
|
Sheep |
Sex |
Male |
13 |
4 (30.8) |
9 (69.2) |
0.97 a |
|
Female |
80 |
25 (31.3) |
55 (68.7) |
|||
|
Age |
≤ 1 year |
23 |
12 (52.2) |
11 (47.8) |
0.03b |
|
|
1-2 year |
35 |
10 (28.6) |
25 (71.4) |
|||
|
≥ 3 year |
35 |
7 (20) |
28 (80) |
|||
|
Ticks |
Present |
67 |
25 (45.3) |
42 (50.8) |
||
|
Absent |
26 |
4 (25) |
22 (75) |
0.04 a* |
||
|
Breed |
Lohi |
81 |
27 (50) |
54 (50) |
0.25 a |
|
|
Kajli |
12 |
2 (40.4) |
10 (59.6) |
|||
|
Goats |
Sex |
Male |
23 |
8 (32) |
15 (68) |
0.01 a |
|
Female |
84 |
11 (13.1) |
73 (86.9) |
|||
|
Age |
≤ 1 year |
34 |
7 (20.6) |
27 (79.4 ) |
0.17b* |
|
|
1-2 year |
31 |
8 (25.8) |
23 (74.2) |
|||
|
≥ 3 year |
42 |
4 (9.6) |
38 (90.4) |
|||
|
Ticks |
Present |
73 |
16 (40) |
57 (60) |
||
|
Absent |
34 |
3 (11.3) |
31 (88.7) |
0.11 a* |
||
|
Breed |
Nacchi |
28 |
8 (40) |
20 (60) |
0.05b |
|
|
Beetal |
54 |
5 (18) |
49 (82) |
|||
|
Teddy |
25 |
6 (31.6) |
19 (68.4) |
a: Fisher’s exact test; b: Chi square test; P < 0.01= Significant (*).
Age barrier in small ruminants (sheep and goats) against theileriosis was examined during the present study. Theileria species infection reported higher in age group one year (33.3%) in overall small ruminants than age group one to two year (27.3%) and lower in ≥ 3 year (14.3%) and statistically this association was significant (p < 0.05). Similar trend of higher Theileria spp. infection was found in sheep and the association was significant. The results are in line with Iqbal et al. (2013) who reported higher infection rate of theileriosis animals having age less than one year in small ruminants in Pakistan. Guo et al. (2002) also found higher incidence and death rate due to Theileria spp. infection both in young and adults of sheep and goats during a study in Ganan region, China. The current results are contradicts with Razmi et al. (2003) who stated non-significant correlation of Theileria positivity in different age groups of sheep population. The discrepancy may be due to difference of resistance against theileriosis in different breeds of small ruminants.
Breed wise prevalence indicated non-significant (p < 0.05) association of theileriosis in overall small ruminants but among sheep Lohi breed more infected with theileriosis than Kajli while in goats significant association was found between breeds and theileriosis (p ˃ 0.05). Nacchi breed revealed higher infection of theileriosis than Beetal and Teddy breed. The difference of Theileria infection among different breeds of small ruminants might be due to variance of genetic resistance against theileriosis, host management and ecological factors which are tangled in spread of ticks and Tick borne diseases. Chi square results indicated that both herd size and herd composition had significant correlation (p < 0.05) with theileriosis in small ruminants represented in Table 5. Herd size was found the significant risk factor involved in disseminate of ovine and caprine theileriosis. The higher infection rate of theileriosis reported in herds having smaller size (53.3%) than larger size during present study and chi square indicated a significant correlation (p < 0.05) of theileriosis and different herd size. These results are contradicts to Durrani et al. (2012) who stated ovine theileriosis was not affected by the herd size during a study from Pakistan. The prevalence of Theileria spp. infection reported higher (44%) in herds having sheep only compared to herds having either only goats (10%) or both sheep and goats (20.0%). Chi square indicated a significant corelation (p< 0.05) between Theileria spp. infection and herd composition. Our results are opposes to Saeed et al. (2015) who found that mixed herds aggregates the Theileria spp. infection.
Table 5: Association between occurrence of Theileria parasites identified by PCR in sheep and goats and the studied parameters describing animal and herd characteristics in Multan, Southern Punjab, Pakistan during 2013.
|
|
Parameters |
No. of samples |
Piroplasms positive |
Piroplasms negative |
P* value |
|
Size of herd |
1- 30 |
15 |
8 (53.3) |
7 (46.7) |
0.01b* |
|
31-60 |
50 |
14 (28) |
36 (72) |
||
|
More than 60 |
135 |
26 (19.3) |
109(80.2) |
||
|
Herd composition |
Sheep only |
25 |
11 (44) |
14 (56) |
0.03b* |
|
Goats only |
40 |
10 (25) |
30 (75) |
||
|
Sheep and goats |
135 |
27 (20) |
108 (80) |
b: Chi square test; P < 0.01 = Significant (*).
Conclusions and Recommendations
Ovine and caprine theileriosis has not been extensively studied in sheep and goats in south of Punjab, Pakistan and to our knowledge this is first study based on PCR assay in Multan district (Pakistan). The results of the current investigation concluded that ovine and caprine theileriosis is endemic in the studied area. Poor hygienic conditions and poverty might be the contributing factor for theileriosis in area under study. The risk of ovine and caprine theileriosis can be significantly reduced by generating public awareness about the disease.
Acknowledgements
This manuscript is a part of my Ph. D. dissertation funded by the Higher Education Commission, Islamabad, Pakistan under the indigenous Ph.D. fellowship scheme (Phase IV). Grateful acknowledgements are due to all the Veterinary Assistants for their help during the sample collection.
Novelty Statement
Ovine and Caprine theileriosis caused by Theileria species resulted in higher economic losses and mortalities upto 100% in case of outbreak and there is paucity of information regarding theileriosis in sheep and goats, therefore it is necessary to address this issue in southern Punjab where livestock is an integral part of agricultural system.
Author’s Contribution
Survey, blood sample collection, the experimental work in the laboratory i.e., microscopic examination, DNA extraction and PCR amplification and the compilation of results were performed by MR. Statistical analysis was carried out by MZU and ZH. The manuscript was drafted by MR while critically analyzed and reviewed by ZT.
Conflict of interest
The authors have declared no conflict of interest.
References
Ahmad, J., H. Alp, M. Askin and U. Seitzer. 2007. Current status of ticks in Asia. Parasitol. Res., 102: 159-162. https://doi.org/10.1007/s00436-007-0696-3
Ahmed, J., H. Yin, M. Bakheit, Z. Liu, H. Mehlhorn and U. Seitzer. 2011. Small ruminant theileriosis. Small Rumin. Res., 2: 135-153. https://doi.org/10.1007/978-3-642-21396-0_8
Alessandra, T. and C. Santo. 2012. Tick-borne diseases in sheep and goats: clinical and diagnostic aspects. Small Rumin. Res., 106: S6–S11. https://doi.org/10.1016/j.smallrumres.2012.04.026
Allsopp, B.A., H.A. Baylis, M.T. Allsopp, T. Cavalier-Smith., R.P. Bishop, D.M. Carrington, B. Sohanpal and P. Spooner. 1993. Discrimination between six species of Theileria using oligonucleotide probes which detect small subunit ribosomal RNA sequences. Parasitology, 107: 157-165. https://doi.org/10.1017/S0031182000067263
Altay, K., N. Dumanli and M. Aktas. 2012. A study on ovine tick-borne hemo-protozoan parasites (Theileria and Babesia) in the East Black Sea Region of Turkey. Parasitol. Res., 111: 149-153. https://doi.org/10.1007/s00436-011-2811-8
Altay, K., N. Dumanli, J. Patricia, B. Holman and M. Aktas. 2005. Detection of Theileria ovis in naturally infected sheep by nested PCR. Vet. Parasitol., 127: 99-104. https://doi.org/10.1016/j.vetpar.2004.09.012
Duranni, S., Z. Khan, R.M. Khattack, M. Andleeb, M. Ali and M. Hameed. 2012. A comparison the presence of Theileria ovis by PCR amplification of their SSU RNA gene in small ruminants from two provinces of Pakistan. Asia Pac. J. Trop. Dis., 2: 43-47. https://doi.org/10.1016/S2222-1808(12)60010-3
Durrani, A.Z., M. Younus, N. Kamal, N. Mehmood and A.R. Shakoori. 2011. Prevalence of ovine Theileria Species in District Lahore. Pak. J. Zool., 43: 57-60.
Durrani, Z.A., N. Kamal and M.S. Khan. 2006. Incidence of theiloriosis and estimation of packed cell volume, Total erythrocyte count and Haemoglobin in buffaloes. J. Anim. Pl. Sci., 16: 3-4.
Economic Survey (2014-15). Economic Affairs Finance Division, Islamabad.Pakistan.
El-Hussein, A.M., A. El-Ghali and S.A. Mohammed. 1993. Efficacy of buparvaquone in the treatment of malignant theileriosis of sheep in Ed-Damer Province, N. State, Sudan: A field trial. Sud. J. Vet. Res., 12: 51–57.
Guo, S., Z. Yuan, G.W.W. Wang, M. Denglu and D. Hongde. 2002. Epidemiology of ovine theileriosis in Ganan region, Gansu Province, China. Parasitol. Res. 88: 36-37. https://doi.org/10.1007/s00436-001-0568-1
Hassan, A.A., M.A. Abdalla, R.H. Mohamed and H.H. Aden. 2013. Preliminary assessment of goat piroplasmosis in Benadir Region, Somalia. Open J. Vet. Med., 3: 273-276. https://doi.org/10.4236/ojvm.2013.36044
Heidarpour, B.M., H.R. Haddadzadeh, B. Kazemi, P. Khazraiinia, M. Bandehpour and M. Aktas. 2009. Molecular identification of ovine Theileria species by a new PCR RFLP method. Vet. Parasitol., 161: 171–177. https://doi.org/10.1016/j.vetpar.2009.01.035
Heidarpour, B.M., P. Khazraiinia and H.R.B. Haddadzadeh. 2010. Identification of Theileria spp. in sheep in the eastern half of Iran using nested PCR- RFLP and microscopic techniques. Iran. J. Vet. Res., 11: 262 -265.
Idrees, M., Z. Mahmood, M. Shafi and U. Sidique. 2007. Performance evaluation of extension services of livestock and dairy development department in district Peshawar (NWFP). Sarhad J. Agric., 23: 519-526.
Inci, A., A. Ica, A. Yildiri and O. Duzlu. 2010. Identifica-tion of Babesia and Theileria species in small ruminants in Central Anatolia (Turkey) via reverse line blotting. Turk. J. Vet. Anim. Sci., 34: 205-210.
Iqbal, F., R.M.K. Khattak, S. Ozubek, M.N.K. Khattak, A. Rasul and M. Aktas. 2013. Application of the Reverse Line Blot Assay for the molecular detection of Theileria and Babesia spp. in sheep and goats blood samples from Pakistan. Iran. J. Parasitol., 8: 289-295.
Irshad, N., M. Qayyum, M. Hussain and M.Q. Khan. 2010. Prevalence of tick infestation and theileriosis in sheep and goats. Pak. Vet. J., 30: 178-180.
Jalali, S.M., Z. Khaki, B.D. Kazemi, S. Rahbari, P. Shayan, M. Bandehpour and S.P. Yasini. 2014. Molecular Detection and Identification of Theileria Species by PCR-RFLP Method in Sheep from Ahvaz, Southern Iran. Iran. J. Parasitol., 9: 99-106.
Jianxun, L. and Y. Hong. 1997. Theileriosis of sheep and goats in China. Trop. Anim. Health Prod., 29: 8-10. https://doi.org/10.1007/BF02632907
Khan, M.F.U. and A. Salman. 2006. Investment possibilities in mutton production, in, proceedings of National Conference on Investment Opputunities in Livestock Sector, Naational Agricultural Research Center (ed, H, Husnain), Agri. Found. of Pakistan, Islamabad, Pakistan. pp 62-88.
Khan, M.S., M.N. Khan, S. Ahmad and S. Mahmood. 2007. Genetic resources and diversity in Pakistani sheep. Int. J. Agric. Biol., 9: 941-944.
Kirvar, E., T. Ilhan, F. Katzer, G. Wilkie, P. Hooshmand-Rad and D. Brown. 1998. Detection of Theileria lestoquardi (hirci) in ticks, sheep, and goats using the polymerase chain reaction. Ann. New York Acad. Sci. 849: 52–62. https://doi.org/10.1111/j.1749-6632.1998.tb11033.x
Leemans, I., D. Brown, P. Hooshmand-Rad, E. Kirvar and A. Uggla. 1999. Infectivity and cross-immunity studies of Theileria lestoquardi and Theileria annulata in sheep and cattle: In vivo responses. Vet. Parasitol., 8: 179-192. https://doi.org/10.1016/S0304-4017(99)00013-8
Luo, J. and H. Yin. 1997. Theileriosis of sheep and goats in China. Trop. Anim. Health Prod., 29: 8S-10S. https://doi.org/10.1007/BF02632907
Manan, A., Z. Khan, B. Ahmad and M. Abdullah. 2006. Prevalence and identification of ixodid tick genera in frontier region Peshawar. J. Agric. Biol. Sci., 2: 21-25.
Naz, S., A. Maqbool, S. Ahmed, K. Ashraf, N. Ahmed and K. Saeed. 2012. Prevalence of theleriosis in small ruminants in Lahore, Pakistan. J. Vet. Anim. Sci., 2: 216-220.
Rao, V.N.A., K.S. Palaniswami, D.J. Ghellappa, S.A. Joseph and J.F. Gnanabaranam. 1991. A report of concurrent haemoprotozoan and rickettsial infection in sheep. Indian Vet. J., 68: 487-488.
Razmi, G.R., A. Naghibia, M.R. Aslanib and H. Hossein. 2003. An epidemiological study on Babesia infection in small ruminants in Mashhad Suburb, khorasan Province, Iran. Korean J. Parasitol., 50: 39-44. https://doi.org/10.1016/S0921-4488(03)00107-X
Rehman, Z.U., M.S. Khan, M. Avais, M. Aleem, M.Z. Shabbir and J.A. Khan. 2010. Prevalence of theileriosis in sheep in Okara District, Pakistan. Pak. J. Zool., 42: 639-643.
Rjeibi, M.R., M. Gharbi, M. Mhadhbi, W. Mabrouk, B. Ayari and I. Nasfi. 2014. Prevalence of piroplasms in small ruminants in North-West Tunisia and the first genetic characterisation of Babesia ovis in Africa. Parasite, 21: 23-30. https://doi.org/10.1051/parasite/2014025
Saeed, S., M. Jahangir, M. Fatima, R.M. Khattak and R.S. Shaikh. 2015. PCR based detection of Theileria lestoquardi in apparently healthy sheep and goats from two districts in Khyber Pukhtoon Khwa (Pakistan). Trop. Biomed., 32: 225-232.
Sayin, F., S. Nalbantoglu, B.A. Bayram, A. Çkakmak and Z. Karer. 2009. Epidemiological studies on sheep and goat Vheilåria infection. Ankqra. Univ. Vet. Fak. Derg., 56: 12w-129. https://doi.org/10.1501/Vetfak_0000002168
Shaikh, R.S., K. Ramzan, S. Nazil, N. Khan and S. Riazuddin. 2004. A new locus for non syndromic deafness DFNB maps to chromosomes 11p13-p12. Am. J. Med. Genet. Ana., 138: 392-395. https://doi.org/10.1002/ajmg.a.30949
Telmadarraiy, Z., M.A. Oshaghi, N. Hosseini-Vasoukolaei, N., M.R. Yaghoobi-Ershadi, F. Babamahmoudi and F. Mohtarami. 2012. First molecular detection of Theileria ovis in Rhipicephalus sanguineus ticks in Iran. Asian Pac. J. Trop. Med., 5: 29–32. https://doi.org/10.1016/S1995-7645(11)60240-X
Urquhart, G.M., J. Armour, J.L. Duncan, A.M. Dunn and F.W. Jennings. 1996. Veterinary parasitilogy. 2nd ed. Blackwell Science Ltd, Oxford, London, pp. 246-252.
Woldehiwet, Z., 2007. Tick-bornediseases. In: I.D. Aitken (eds.) diseases of sheep, 4th ed., Blackwell publishing Ltd, Oxford, pp. 353-354.
Yaghfoori, S., G.R. Razmi and M. Heidarpour. 2013. Molecular detection of Theileria spp. in sheep and vector ticks in Fasa and Kazeroun areas, Fars Province, Iran. Arch. Razi Instit., 68: 159-164.
Yin, H., L. Schnittger, J. Luo, U. Seizer and J.S. Ahmed. 2007. Ovine theileriosis in China: A new look at an old story. Parasitol. Res., 101: 191–195. https://doi.org/10.1007/s00436-007-0689-2
Zaeemi, M., H.R. Haddadzadeh, P. Khazraiinia, B. Kazemi and M. Bandehpour. 2011. Identification of different Theileria species (Theileria lestoquardi, Theileria ovis, and Theileria annulata) in naturally infected sheep using nested PCR-RFLP. Parasitol. Res., 108: 837–843. https://doi.org/10.1007/s00436-010-2119-0
Zangana, I.K. and I.A. Naqid. 2011. Prevalence of piroplasmosis (Theileriosis and Babesiosis) among goats in Duhok Governorate. Al-Anbar J. Vet. Sci., 4: 50-57.
Zulfiqar, S., S. Shahnawaz, M. Ali, A.M. Bhutta, S. Hayat and S. Qadir. 2012. Detection of Babesia bovis in blood samples and its effect on the hematological and serum biochemical profile in large ruminants from Southern Punjab. Asia Pac. J. Trop. Biomed., 2: 104-108. https://doi.org/10.1016/S2221-1691(11)60202-5