Research Article
Isolation and Molecular Characterization of Bovine Coronavirus from Calves with Acute Gastroenteritis in Egypt
Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3
1Virology Research Department Central Lab; 2Virology Unit, Shebin District Lab; 3Biotechnology Research Department, Animal Health Research Institute, Agricultural Research Center (ARC), Dokki 12618, Egypt.
Abstract | This study was intended for the antigenic and molecular characterization of betacoronavirus 1 (bovine coronavirus) BCoV in newborn gastroenteritis calves in the Delta Region, Menofia Province, Egypt, also for isolation and identification of the local circulating BCoV strain for further diagnosis or vaccination. In cattle, Betacoronavirus 1 bovine coronavirus (BCoV) is primarily involved in enteric infections which leads to serious complication which may be fatal in young calves up to 3 months of age. A total of 20 fecal samples were collected in the winter season of 2018 and 2019, all samples were serologically screening by antigen-capture ELISA, then molecular confirmation by RT-PCR targeted to nucleocapsid protein gene (N-gene) was carried out followed by phylogenetic analysis. Positive samples were isolated on Vero cell culture and identified by TEM and immune-peroxidase technique. Betacoronavirus 1 was detected by ELISA in 6 out of 20 fecal samples (30%), PCR detected 4 out of 6 ELISA positive samples at specific M.W. band of 236 bp by electrophoresis, and one sample was sequenced and submitted on Genbank with acc.no. MW173144, further phylogenetic sequence analysis revealed high percentage of identity with reference strains from different countries. Phylogenetic tree cleared that current research strain was found related to France strains 2013 and 2014, also to local Egypt strain 2019 with acc.no. MN053321, two samples were successfully isolated in Vero cells and positively identified after the 3rd passage by TEM and immune-peroxidase technique. ELISA results are considered an alarmingly high prevalence that requires further statistically designed epidemiological studies, phylogenetic analysis revealed minimum evolution rate and stability of BCoV genome.
Received | March 05, 2021; Accepted | March 14, 2021; Published | April 28, 2021
*Correspondence | Ahmed Fawzy Afify, Virology Research Department Central Lab, Animal Health Research Institute, Agricultural Research Center (ARC), Dokki 12618, Egypt; Email: [email protected]
DOI | http://dx.doi.org/10.17582/journal.hv/2021/8.2.29.38
Citation | Moussa, S.A., A.F. Afify, S. Salah and A. Hamed. 2021. Isolation and molecular characterization of bovine coronavirus from calves with acute gastroenteritis in Egypt. Hosts and Viruses, 8(2): 29-38.
Keywords: Betacoronavirus-1, BCoV, Vero cells, TEM, IP and gastroenteritis
Information
Diarrhea is one of the most serious problems affecting cattle, particularly younger ones from 1 week to 3 months of age, leading to serious dehydration, which in many cases can be fatal (Blowey and Weaver, 2011). The most common viral enteric pathogens were known include Bovine Rotavirus (BRoV) and Betacoronavirus 1 Bovine Coronavirus (BCoV) (Cavanagh, 1997), can cause enteric and respiratory infections in calves and adult livestock. (Lathrop et al., 2000; Hoet et al., 2003). Betacoronavirus 1 infection is a significant cause of economic losses for the dairy industry worldwide (Saif, 2004). In addition, the maximum decrease in dairy production is about 10 percent and can last for 1-2 weeks, after dairy production levels are recovered in mild BCoV epidemics, but dairy production decreases to 30 percent in extreme epidemics and continues for up to 1 month (Radostits et al., 2007).
Betacoronavirus 1 BCoV is classified in the order Nidovirales, family Coronaviridae, subfamily Coronavirinae; genus Betacoronavirus (Group 2 Coronavirus) subgroup 2A (Graham et al., 2013). Coronaviridae members have enveloped viruses with a single-stranded non-segmented positive-sense RNA genome of 27-32 kb in length (Saif, 2004). Virions are pleomorphic to spherical, about 80–200 nm in diameter.
Betacoronavirus 1 BCoV genomeconsists of 13 open reading frames (ORFs) flanking 5′ and 3′ untranslated regions encodingfivestructural proteins (SP) and non-structural proteins (NSP). Five majorstructural proteins are encoded within the genomic RNA suchas hemagglutinin-esterase (HE) protein (ORF3), spike (S) glycoprotein (ORF4), small membrane (E) protein (ORF8), transmembrane (M) protein (ORF9), and nucleocapsid (N) protein (ORF10) (Chouljenko et al., 2001; Masters, 2006).Coronavirus host spectrum and tissue tropism variations are referred to as the spike (S) glycoprotein, which is split into two functional domains, S1 (N-terminal half) and S2 by intracellular protease (C-terminal half) (Gallagher and Buchmeier, 2001). The peripheral S1 subunit is responsible for host-cell receptor virus attachment (Kubo et al., 1994), neutralizing antibody induction (Yoo and Dereget, 2001), and haemagglutination function (Schultze et al., 1991). The S1 sequence is variable, with mutations correlated with altered antigenicity and pathogenicity of the virus in this area (Ballesteros et al., 1997); which explains why this region was used as a target to research the molecular epidemiology of BCoV infection (Jeong et al., 2005; Liu et al., 2006). The S2 subunit sequence is more conserved, and this subunit is responsible for the operation of cell membrane fusion (Yoo et al., 1991).
Most research investigating the importance of BCoV in neonatal calf diarrhea (NCD) have been carried out in the northern hemisphere (Ammar et al., 2014; Bidokhti et al., 2013; Decaro et al., 2008b; Hasoksuz et al., 2002; Jeong et al., 2005; Lu et al., 1991; Mawatari et al., 2014; Ohlson et al., 2013), On the other hand, little epidemiological information is available on the identification, occurrence, and characterization of Betacoronavirus 1 BCoV in cattle from the Middle East in general, especially Egypt. In nasal secretions and in fecal samples, BCoV may be diagnosed. The diagnosis depends on the identification of the virus, viral antigen, or viral RNA; the detection of viruses requires isolation in cell culture, which is not the first option since certain BCoV strains have trouble adapting to cell culture.
While Betacoronavirus 1 BCoV antigens are most detected using ELISA, which has the good qualities of being fast and timesaving. Also, viral RNA detection through PCR (with different formats) was more widely used (Saif, 2010).
The present study aimed to determine the infection rate of Betacoronavirus 1 BCoV BCoV in diarrheic calves from some Egyptian governorates, additionally, to conduct a phylogenetic study with the Egyptian Betacoronavirus 1 BCoV strains in comparison with the BCoV strains; characterized worldwide and finally to prepare a BCoV (cell culture adapted) identified strain for further studies.
Materials and Methods
Ethics statement
This statement confirms that sampling for this research was performed as non-experimental clinical work with respecting the rules of the veterinary profession. Sampling was performed strictly on the owner’s request international, national, and\or institutional guidelines for sampling were followed with the approval of the local ethics committee on animal experimentation at the animal health research institute, agriculture research center (ARC), Egypt.
Clinical specimens’ collection and preparation
A total of 20 fecal samples were obtained between 2018 and 2019 from calves with acute gastroenteritis diarrhea, restlessness, loss of appetite, dry muzzle, fever, and dehydration finally deaths and aged from 5-21 days from some dairy herds in Egypt (Menofia governorate). Samples were submitted to the Animal health research institute, Virology department for laboratory diagnosis, considering biosecurity measures according to OIE Manual, 2018 (transport of biological material). Fecal samples were prepared in 0.01 M phosphate-buffered saline (PBS) (pH 7) centrifuged at 1500 x g and the supernatants were stored in sterile vials at -80 ° C (Barry et al., 2009).
Detection of BCoV antigen in fecal samples by antigen capture ELISA
BCoV antigen was detected in fecal samples by indirect antigen-capture sandwich ELISA (Monoscreen Ag ELISA, BIO K 344/2 Rochefort, Belgium), test procedures were performed according to manufacturing instructions.
Molecular characterization of BCoV
Nucleic acid was extracted from fecal samples using QIAamp mini elute virus spin kit (Qiagen, Germany, GmbH) according to manufacturing instructions. Nucleic acid was finally eluted with 100 µl of elution buffer.
RT- PCR protocol as previously described by Amer et al. (2013), targeted to N gene, by using a commercial kit (My Taq One-Step RT-PCR Kit) according to kit instructions. Primers used were (F: TGGATCAAGATTAGAGTTGGC, R: CCTTGTCCATTCTTCTGACC), expected length of the amplified sequence was 236 bp. Positive control RNA was included ready to use in the kit.
The PCR products were separated by 1.5% agarose gel electrophoresis (AppliChem, Germany, GmbH). A gene ruler 100bp DNA ladder (Fermentas, Thermo, Germany) was used to determine the fragment size. The gel was scanned by a gel documentation system (Alpha Innotech, Biometra) then the data was analyzed through computer software.
One representative sample of PCR products was purified using the QIAquick PCR Product extraction kit. (Qiagen, Valencia). Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer) was used for sequencing using Applied Biosystems genetic analyzer (HITACHI, Japan), to check the sequence identity; a BLAST® analysis (Basic Local Alignment Search Tool) was initially performed (Altschul et al., 1990). Then, the phylogenetic tree was constructed using MegAlign module of Lasergene DNA Star version 12.1 by maximum likelihood (Tamura et al., 2013).
Isolation of BCoV from ELISA positive, molecular characterized samples in VERO cells
VERO cell line (Vero-1008, ATCC-CCL-81) was used for isolation of the virus from two representative samples (PCR high positive samples). The procedures were carried out according to Hansa et al. (2014). The VERO cell line was kindly obtained from the tissue culture unit (T.C), VACSERA, Egypt. It was grown with Earl’s Minimal Essential Medium (EMEM). After being inoculated with 100 µl of prepared, filtered samples; prescription flasks were incubated for 1 hour in a CO2 incubator at 37 ºC. Then maintenance media was added (10 ml at each flask). Flasks were incubated at 37 ºC with daily inspection for 7 days for observation of any cytopathic changes. Positive control virus was supplied by veterinary serum and vaccine research institute (SERVAC), Egypt. Harvest of tissue culture suspension (row virus isolate) was prepared by three repetitive cycles of freezing and thawing, centrifugation at 3000 rpm\10 min.\4 ºC, collecting the supernatant, allotment in Eppendorf tubes at -80 ºC for further passaging or examination.
Identification of BCoV isolate by negative staining transmission electron microscopy (TEM)
As previously described, tissue culture suspensions have been prepared. On a carbon-coated grid, drops of the acquired suspension were placed; next, the grids were drained with filter paper before drying and negatively stained with 2% phosphotungstic acid, pH 5.0, then examined with TEM at EM-Unit, Central research laboratories, Faculty of Agriculture, Cairo University and examined according to Catroxo et al., 2010.
Identification of BCoV isolate by indirect Immuno-peroxidase test (IP) on VERO cell line
According to Schacherer et al. (1988), the test was performed using IP kit (Power-StainTM 1.0 Poly HRP DAB Kit) for BCoV detection in VERO cells, IP was performed in 16 microwells lab-Tek glass chamber slides TM on 24h infected cells, then slides were examined for specific reactions.
Results and Discussion
Implementation of Ag capture ELISA procedures detected BCoV antigen (Positive) in 30% of fecal samples, (6/20).
The used RT-PCR protocol detected BCoV in (4/20) 20% of fecal samples with a particular M.W band at 236 bp (Figure 1).
Partial nucleotide sequence of N-gene of one representative sample named (BCoV_EGY_AHRI_2020) was submitted to Genbank with accession number (MW173144). Analyzing the sequence data of the aligned strain revealed that our strain is distantly identical (at the nucleotide and amino acid levels) with other strains with accessions: KX982264, KT318095, and KT318094 (France 2014), KT318094 and KT318090 (France 2013), also with the local strain; accession: MN053321 (Egypt, 2019), meanwhile; with another local strain with accession: MK153062 (Egypt 2018) it showed lower identity (99.6% at the nucleotide level and 98.7% at amino-acid level), and less identity was observed (96.2% at both nucleotide and amino acid levels) with a recent strain with accession: LC494174 (Japan 2020), As described in nucleotide, amino-acids sequence identity table (Tables 1 and 2).
A phylogenetic tree was constructed as described (Figure 2), revealed that sequences aligned with our isolates in the present research were grouped, and more related to France isolates 2013, 2014, also with the latest local strain (Egypt 2019, Acc. No. MN053321).
Two representative samples (Full molecular characterized positive samples) were isolated in the VERO cell line, four successive serial passages were carried out. Inoculated flasks were inspected daily for specific BCoV CPE which was completely developed within 6 days after inoculation in the first passage, decreased gradually till reached 3 days in the fourth passage. Negative control cells did not record any specific CPE in contrast with the positive control cell which observed with clear specific CPE.
The observed BCoV CPE started with rounding 24 H.P.I (hours post-inoculation), then granular, swollen, or enlarged cells within 48 H.P.I., then the membranes of the enlarged cells showed vacuolation and clumping 72 H.P.I, then were fused to form syncytia with intra-cytoplasmic inclusions 96 H.P.I (which is indicative of viral infection),followed by detachment with CPE progression, focal to diffuse cytoplasmic vacuolation was prominent 5-6 days H.P.I., CPE produced came in agreement with (El-Kenawy et al., 2019), also with those of earlier reports (Tektoff et al., 1983). CPE of inoculated cells, positive and negative controls are cleared in Figure 3.
High loads of virus particles with marked pleomorphism were reported for the identification of two BCoV-suspected isolates (after four active serial passages), which appeared as rounded and elongated particles ranging from 72-206 nm with an average diameter of 140 nm, with characteristic radial projections, as shown in Figure 4.
Identification of the isolates referred to above (TEM identified); followed by the immune peroxidase (IP) test, which is considered positive if stained cells have been detected. The number of cells stained increased with incubation; the maximum recovery was reached in the time period between 1 and 8 h; the negative control cells were not stained, while the samples tested displayed brownish coloration, which gradually increased with incubation time (Figure 5), an incubation of at least 18 h was chosen.
The goal of this study was to detect Betacoronavirus 1 BCoV antigen in tested samples through Ag capture ELISA and RT-PCR, complete molecular characterization of positive PCR samples, then isolation and identification of circulating strain on cell culture, in order to prepare a new local Betacoronavirus 1 BCoV strain; full molecularly characterized to be further used in diagnostics and vaccine solutions. In Egypt, detection of Betacoronavirus 1coronavirus antigen in fecal samples obtained from newborn buffalo calves, bovine-like CoVs were detected in the faeces of suckling buffalo calves with profuse diarrhoea in Egypt using monoclonal antibody (MAb)-based enzyme-linked immunosorbent assay (ELISA) and immunoperoxidase assays (Abd El-Karim et al., 1990).
In egypt, Detection of coronavirus antigen in fecal samples obtained from newborn buffalo calves, bovine-like CoVs were detected in the faeces of suckling buffalo calves with profuse diarrhoea in Egypt using monoclonal antibody (MAb)-based enzyme-linked immunosorbent assay (ELISA) and immunoperoxidase assays (Abd El-Karim et al., 1990).
The CoV particles were identified in two further studies in Egypt using negative-contrast transmission electron microscopy (EM) in 20 and 55.2% of the faecal samples collected from diarrhoeic buffalo calves, and 8.3 and 19.1% of the faecal samples collected from apparently healthy buffalo calves, respectively (Byomi et al., 1996; Abd El-Rahim, 1997). The epidemiological data presented by the Tri-national Health Research Project, USAID, indicated that CoV is the second most-common pathogen causing diarrhoea in buffalo calves in Egypt with a prevalence rate of 37.7% (Saleh, 1994). The different bovine-like CoVs that have been identified in domesticated ruminants (water buffalo, sheep, goat, dromedary camel, llama and alpaca) and wild ruminants (deer, wild cattle, antelopes, giraffes and wild goats) are discussed in terms of epidemiology, transmission and virus characteristics. The presented data denote the importance of these viruses in the persistence of BCoV in nature, spread to new geographical zones, and continuous emergence of disease epidemics in cattle farms (Amer, 2018).
In the present study, a total of 20 fecal samples were collected from diarrheic calves aged up to 21 days during the calving season of 2018 and 2019, which had clinical findings like Betacoronavirus 1 BCoV as described by Lefèvre et al. (2010).
All samples were screened by BCoV antigen capture ELISA, this test was used due to its high sensitivity, and because of most of immunodiagnostic tests produced for enteric pathogen have either low specificity and/ or sensitivity (Selim et al., 1991; Kelkar et al., 2004).
Thirty percent of fecal samples were tested positive by Ag capture ELISA, this overall prevalence is considerably high, suggesting that Betacoronavirus 1 BCoV has a significant position in the epidemiology of neonatal calf diarrhea in Egypt, with a prevalence of only 3.7 percent in the latest local prevalence study (Egypt) on BCoV revealed (El-Kenawy et al., 2019).
The effect can be explained by decreasing passive immunity due to numerous possible causes, lack of natural resistance to infection due to lack of protocols for vaccination, as mentioned by (Uhde et al., 2008; Ammar et al., 2014).
For further clarification, a molecular tool (RT- PCR) was performed for rapid detection and confirmation of ELISA results. Standardization of RT-PCR was done according to Amer et al. (2013), by selecting viral N-gene-based primers as a conserved region among BCoV strains.
The correlation between the above-mentioned tests results even though the difference in overall prevalence in tested samples; possible explanations could be due to lower specificity of ELISA compared with RT PCR assay (Cho et al., 2001).
Phylogenetic analysis of tested sample suggests stability and minimum evolution rate for the current circulating BCoV strain due to nearly complete identity with the previous local samples of 2018 and 2019 Betacoronavirus 1 BCoV strains.
Both ELISA and PCR data indicate that further statistically designed surveys are needed to systematically evaluate Betacoronavirus 1 BCoV local prevalence as well as other enteropathogens associated with neonatal calf diarrhea in Egypt (Cho and Yoon, 2014).
Betacoronavirus 1 BCoV isolation is little used as a means of diagnosis, as it is difficult, requires well trained skilled analyst, however; BCoV can be readily grown on large no. of cell lines including VERO cell line which is used in our study according to (Clark, 1993; Benfield and Saif, 1990; Tsunemitsu and Saif, 1995). The Vero cell line was explicitly selected for isolation as it is said to produce consistent CPE; agreed with Tektoff et al. (1983). We selected two samples for isolation due to the difficulty of viral adaptation and replication on tissue culture, which linearly increases with no. of samples for isolation, which came in agreement with Hansa et al. (2014).
As Brandt et al. (1981), stated earlier, TEM (negative staining technique) is widely used for the detection and identification of BCoV based on morphological characteristics, this characteristic morphology evinced the identity of BCoV, which agreed with an early previous report by (Stair et al., 1972).
IP test results came in harmony with Katz et al. (1987); who cleared that the indirect IP staining technique was used to identify BCoV cell culture-based isolates.
Conclusions and Recommendations
Prevalence of Betacoronavirus 1 BCoV is increasing alarmingly, from 3.7% to 30% within 2 years between both recent studies (as mentioned), which requires further broad, statistically designed observational analytical epidemiological studies (cohort studies) to systematically evaluate, follow up BCoV situation and detect any evolution in circulating strain.
Vaccination programs with an efficient vaccine are required to raise passive immunity for calves and initiate an effective immune response in adults.
Detection of Betacoronavirus 1 BCoV by indirect antigen capture ELISA is a rapid sensitive tool for screening of fecal samples, but false-positive results may develop.
The VERO cell line can be used for BCoV isolation, in which coronavirus produces a characteristic CPE, however; not all strains can be readily adapted for growth in VERO cells, which reveals a kind of strain variation, which needs focused studies among antigenic and genomic levels.
Novelty Statement
This manuscript entitled “Isolation and Molecular Characterization of Bovine Coronavirus from Calves with Acute Gastroenteritis in Egypt” by Moussa S.A et al., intended to antigenic and molecular characterization of betacoronavirus 1
(bovine coronavirus, BCoV) in newborn gastroenteritis calves in the Delta Region, in Egypt , that enabled following up the virus activity and circulation through large sector of the country within two years of sampling process.
also it was performed for isolation and identification of the local circulating strain for further research or to used in vaccination protocols, that has a potential application on clearance of the viral activity and lowering the costs of imported vaccines.
Author’s Contribution
SAM: Developed the theory.
AFA and SS: carried out the experiment and wrote the manuscript.
AH: conceived the presented data and revised the manuscript.
Conflict of interests
The authors have declared no conflict of interest.
References
Abd El-Karim, I.A., A.A. El-Sanousi, N.M. Aly and I.M. Reda. 1990. Detection of coronavirus antigen in fecal samples obtained from new born buffalo calves. Vet. Med. J. Giza, 38: 77–85.
Abd El-Rahim, I.H.A., 1997. Rota and coronavirus infections in new born buffalo calves in Upper Egypt. Proceedings of the 4th Scientific Congress, Egyptian Society for Cattle Diseases Assuit, Egypt, pp. 210–220.
Altschul, S.F., W. Gish, W. Miller, E.W. Myers and D.J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol., 215(3): 403-410, ISSN 0022-283. https://doi.org/10.1016/S0022-2836(05)80360-2
Amer, H.M., A.A. El-Wahid, M.A. Shalaby, F.N. Almajhdi, F.T. Hufert and M. Weidmann. 2013. A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay. J. Virol. Methods. 2013 Nov; 193(2): 337-340. https://doi.org/10.1016/j.jviromet.2013.06.027
Amer, H.M., 2018. Bovine-like coronaviruses in domestic and wild ruminants. Anim. Health Res. Rev., 19(2): 113–124. https://doi.org/10.1017/S1466252318000117
Ammar, S., K. Mokhtaria, B. Tahar, A. Amar, B. Redha, B. Yuva, H. Mohamed, N. Abdellatif and B. Laid. 2014. Prevalence of rotavirus (GARV) and coronavirus (BCoV) associated with neonatal diarrhea in calves in western Algeria. Asian Pac. J. Trop. Biomed., 4(1): S318-S322. https://doi.org/10.12980/APJTB.4.2014C778
Ballesteros, M.L., C.M. Sanchez and L. Enjuanes. 1997. Two amino acid changes at the N-terminus of transmissible gastroenteritis coronavirus spike protein result in the loss of enteric tropism. Virology, 227: 378–388. https://doi.org/10.1006/viro.1996.8344
Barry, A.F., A.A. Fernandes, S.D. Tancler and A.A. Alcindo. 2009. Bovine coronavirus detection in a collection of diarrheic stool samples positive for group bovine rotavirus. Braz. Arch. Biol. Technol., 52: 45-49.
Benfield, D.A. and L.J. Sai https://doi.org/10.1590/S1516-89132009000700006 f. 1990. Cell culture propagation of a coronavirus isolated from cows with winter dysentery. J. Clin. Microbiol., 26: 1454-1457. https://doi.org/10.1128/JCM.28.6.1454-1457.1990
Bidokhti, M.R., M. Traven, N.K. Krishna, M. Munir, S. Belak, S. Alenius and M. Cortey. 2013. Evolutionary dynamics of bovine coronaviruses, natural selection pattern of the spike gene implies adaptive evolution of the strains. J. Gen. Virol., 94: 2036–2049. https://doi.org/10.1099/vir.0.054940-0
Blowey, R.W. and A.D. Weaver. 2011. Winter dysentery. Colour atlas of disease and disorders of cattle Third edition, pp. 58. https://doi.org/10.1016/B978-0-7234-3602-7.00005-4
Brandt, C.D., H.W. Kim, W.J. Rodriguez, L. Thomas, R.H. Yolken, J.O., Arrobio, A.Z. Kapikian, R.H. Parrott and R.M. Chanock. 1981. Comparison of direct electron microscopy, immune electron microscopy, and rotavirus enzyme-linked immunosorbent assay for detection of gastroenteritis viruses in children. J. Clin. Microbiol., 13: 976-981. https://doi.org/10.1128/JCM.13.5.976-981.1981
Byomi, A., W. Herbst and G. Baljer. 1996. Some viral agents associated with neonatal calf diarrhea. Assuit. Vet. Med. J., 35: 1–9. Google Scholar.
Catroxo, M.H.B., Miranda, L.B., Lavorenti, A., Petrella, S., Melo, N. A., Martins, A. 2010. Detection of Coronavirus in Capybaras (Hydrochoerishydrochaeris) by Transmission Electron Microscopy in São Paulo, by transmission electron microscopy, in São Paulo, Brazil. Int. J. Morphol., 28(2):549-555, 2010. https://doi.org/10.4067/S0717-95022010000200035
Cavanagh, D., 1997. Nidovirales, a new order comprising Coronaviridae and Arteriviridae. Arch. Virol., 142: 629-633.
Cho, K.O., M. Hasoksuz, P.R. Nielsen, K.O. Chang, S. Lathrop and L.J. Saif. 2001. Cross-protection studies between respiratory and calf diarrhea and winter dysentery coronavirus strains in calves and rt-PCR and nested PCR for their detection. Arch. Virol., 146: 2401-2419. https://doi.org/10.1007/s007050170011
Cho, Y.I. and K.J. Yoon. 2014. An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. J. Vet. Sci., 15: 1–17. https://doi.org/10.4142/jvs.2014.15.1.1
Chouljenko, V.N., X.Q. Lin, J. Storz, K.G. Kousoulas and A.F. Gorbalenya. 2001. Comparison of genomic and predicted amino acid sequences of respiratory and enteric bovine coronaviruses isolated from the same animal with fatal shipping pneumonia. J. Gen. Virol., 82: 2927–2933. https://doi.org/10.1099/0022-1317-82-12-2927
Clark, M.A., 1993. Bovine coronavirus. Br. Vet. J., 149: 51-70. https://doi.org/10.1016/S0007-1935(05)80210-6
Decaro, N., V. Mari, C. Desario, M. Campolo, G. Elia, V. Martella, G. Greco, F. Cirone, M.L. Colaianni, P. Cordioli and C. Buonavoglia. 2008. Severe outbreak of bovine coronavirus infection in dairy cattle during the warmer season. Vet. Microbiol., 126: 30–39. https://doi.org/10.1016/j.vetmic.2007.06.024
El-Kenawy, A.A., M.A. Shahein and H.A. Yassen. 2019. Isolation and identification of Bovine coronavirus (BCoV) from diarrheic calves in Dakahlia Governorate, Egypt. Mansoura Vet. Med. J., 20(1): 27-34. https://doi.org/10.35943/mvmj.2019.01.102
Gallagher, T.M. and M.J. Buchmeier. 2001. Coronavirus spike proteins in viral entry and pathogenesis. Virology, 279: 371–374. https://doi.org/10.1006/viro.2000.0757
Graham, R.L., E.F. Donaldson and R.S. Baric. 2013. A decade after SARS: Strategies for controlling emerging coronaviruses. Nat. Rev. Microbiol., 11(12): 836–848. https://doi.org/10.1038/nrmicro3143
Hansa, A., R.B. Rai, K. Dhama, M.Y. Wani, M. Saminathan and G.J. Ranganath. 2014. Isolation of bovine coronavirus (BCoV) in Vero cell line and its confirmation by direct FAT and RT-PCR. Pak. J. Biol. Sci., 16(21): 1342-1347. https://doi.org/10.3923/pjbs.2013.1342.1347
Hasoksuz, M., S. Sreevatsan, K.O. Cho, A.E. Hoet and L.J. Saif. 2002. Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates. Virus Res., 84: 101–109. https://doi.org/10.1016/S0168-1702(02)00004-7
Hoet, A.E., J. Smiley, C. Thomas, P.R. Nielsen, T.E. Wittum and L.J. Saif. 2003. Association of enteric shedding of bovine torovirus (Breda virus) and other enteropathogens with diarrhea in veal calves. Am. J. Vet. Res., 64: 485–490. https://doi.org/10.2460/ajvr.2003.64.485
Jeong, J.H., G.Y. Kim, S.S. Yoon, S.J. Park, Y.J. Kim and C.M. Sung. 2005. Detection and isolation of winter dysentery bovine coronavirus circulated in Korea during 2002–2004. J. Vet. Med. Sci., 67: 187–189. https://doi.org/10.1292/jvms.67.187
Katz, J.B., L. Ludemann, J. Pemberton and M.J. Schmerr. 1987. Detection of bovine virus diarrhea virus in cell culture using an immunoperoxidase technique. Vet. Microbiol., 13(2): 153-157. https://doi.org/10.1016/0378-1135(87)90040-X
Kelkar, S.D., V.S. Bhide, S.S. Ranshing and S.S. Bedekar. 2004. Rapid ELISA for the diagnosis of rotavirus. Indian J. Med. Res., 119: 60-65.
Kubo, H., Y.K. Yamada and F. Taguchi. 1994. Localization of neutralizing epitopes and the receptor-binding site within the amino-terminal 330 amino acids of the murine coronavirus spike protein. J. Virol., 68: 5403–5410. https://doi.org/10.1128/JVI.68.9.5403-5410.1994
Lathrop, S.L., T.E. Wittum, K.V. Brock, S.C. Loerch, L.J. Perino and H.R. Bingham. 2000. Association between infection of the respiratory tract attributable to bovine coronavirus and health and growth performance of cattle in feedlots. Am. J. Vet. Res., 61: 1062–1066. https://doi.org/10.2460/ajvr.2000.61.1062
Lefèvre, P.C., J. Blancou and R. Chermette. 2010. Infectious and parasitic diseases of livestock, chapter: Bovine coronavirus.
Liu, L., S. Hagglund, M. Hakhverdyan, S. Alenius, L.E. Larsen and S. Belak. 2006. Molecular epidemiology of bovine coronavirus based on comparative analyses of the S gene. J. Clin. Microbiol., 44: 957–960. https://doi.org/10.1128/JCM.44.3.957-960.2006
Lu, C.P., H.C. Yao and W. Eichhorn. 1991. Coronavirus as an agent of neonatal calf diarrhea in a Chinese dairy cattle farm. Zentralbl. Vet. B., 38: 473–476. https://doi.org/10.1111/j.1439-0450.1991.tb00898.x
Masters, P.S., 2006. The molecular biology of coronaviruses. Adv. Virus Res., 66: 193–292. https://doi.org/10.1016/S0065-3527(06)66005-3
Mawatari, T., K. Hirano, H. Ikeda, H. Tsunemitsu and T. Suzuki. 2014. Surveillance of diarrhea-causing pathogens in dairy and beef cows in Yamagata Prefecture, Japan from 2002 to 2011. Microbiol. Immunol., 58: 530–535. https://doi.org/10.1111/1348-0421.12174
Ohlson, A., S. Alenius, M. Traven and U. Emanuelson. 2013. A longitudinal study of the dynamics of bovine coronavirus and respiratory syncytial virus infections in dairy herds. Vet. J., 197: 395–400. https://doi.org/10.1016/j.tvjl.2013.01.028
OIE Terrestrial Manual, 2018. Chapter 1.1.3, transport of biological materials.
Heckert, R.A., L.J. Saif and G.W. Myers. 1989. Development of protein A-gold immunoelectron microscopy for detection of bovine coronavirus in calves: Comparison with ELISA and direct immunofluorescence of nasal epithelial cells. Vet. Microbiol., 19(3): 217–223. https://doi.org/10.1016/0378-1135(89)90068-0
Radostits, O.M., C.C. Gay, K.W. Hinchcliff and P.D. Constable. 2007. Veterinary medicine. A textbook of the diseases of cattle, horses, sheep, pigs, and goats, 10th edition. W.B. Saunders Company Ltd. London, pp. 1286.
Saleh, S.M., 1994. Epidemiological studies on diarrhea in cattle newborn calves fed on colostrum from vaccinated and control-pregnant cows. Trinational Animal Health Research Project (TAHRP), 2nd Annual Workshop. Sharm El-Sheikh, Egypt.
Saif, L., 2004. Bovine coronavirus infection. In: Coetzer JAW, Tustin RC, editors. Infectious diseases of livestock. Second Edith ed. Oxford, UK: Oxford University Press; pp. 795–802.
Saif, L.J., 2010. Bovine respiratory coronavirus. Vet. Clin. North Am. Food Anim. Pract., 26(2): 349-364. https://doi.org/10.1016/j.cvfa.2010.04.005
Schacherer, C., W. Braun, G. Bauer and H.W. Doerr. 1988. Detection of cytomegalovirus in bronchial lavage and urine using a monoclonal antibody to an HCMV early nuclear protein. Infection, 16(5): 288-292. https://doi.org/10.1007/BF01645074
Schultze, B., H.J. Gross, R. Brossmer and G. Herrler. 1991. The S protein of bovine Coronavirus is a hemagglutinin recognizing 9-O-acetylated sialic acid as a receptor determinant. J. Virol., 65: 6232–6237. https://doi.org/10.1128/JVI.65.11.6232-6237.1991
Selim, S.A., K.M.S. Aziz, A.J. Sarker and H. Rahman. 1991. Rotavirus infection in calves in Bangladesh. Res. Opin. Anim. Vet. Sci., 3(8): 225-234.
Stair, S.L., M.B. Rhodes, R.G. White and C.A. Mebus. 1972. Neonatal calf diarrhea: Purification and electron microscopy of a coronavirus-like agent. Am. J. Vet. Res., 33: 1147-1156.
Tamura, K., G. Stecher, D. Peterson, A. Filipski and S. Kumar. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30: 2725–2729. https://doi.org/10.1093/molbev/mst197
Tektoff, J., M. Dauvergne, M. Durafour and J.P. Soulebot. 1983. Propagation of bovine coronavirus on VERO cell line: Electron microscopic studies. J. Dev. Biol. Stand., 53: 299-310.
Tsunemitsu, H. and L.J. Saif. 1995. Antigenic and biological comparisons of bovine coronaviruses derived from neonatal calf diarrhea and winter dysentery of adult cattle - brief report. Arch. Virol., 140: 1303-1311. https://doi.org/10.1007/BF01322757
Uhde, F.L., T. Kaufmann, H. Sager, S. Albini, R. Zanoni, E. Schelling and M. Meylan. 2008. Prevalence of four enteropathogens in the feces of young diarrhoeic dairy calves in Switzerland. Vet. Rec., 163: 362-366. https://doi.org/10.1136/vr.163.12.362
Yoo, D.W., M.D. Parker and L.A. Babiuk. 1991. The S2 subunit of the spike glycoprotein of bovine coronavirus mediates membrane fusion in insect cells. Virology, 180: 395–399. https://doi.org/10.1016/0042-6822(91)90045-D
Yoo, D. and D. Deregt. 2001. A single amino acid change within antigenic domain II of the spike protein of bovine coronavirus confers resistance to virus neutralization. Clin. Diagn. Lab Immunol., 8: 297–302. https://doi.org/10.1128/CDLI.8.2.297-302.2001