Complete Mitochondrial Genome of Fulvetta cinereiceps (Sylviidae: Passeriformes) and Consideration of its Phylogeny within Babblers
Jie Gao1, Guannan Wang1, Chuang Zhou1, Megan Price2, Jinnan Ma1, Xiaohong Sun1, Benping Chen3, Xiuyue Zhang2 and Bisong Yue1*
1Key Laboratory of Bioresources and Ecoenvironment (Ministry of Education), College of Life Sciences, Sichuan University, Chengdu, 610064, PR China
2Sichuan Key Laboratory of Conservation Biology of Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu, 610064, PR China
3Laojunshan National Nature Reserve, Yibin, 645350, PR China
ABSTRACT
Fulvetta cinereiceps (grey-hooded fulvetta) has been classified as belonging to the multi-clade babblers within Passeriformes. The complete mitochondrial genome of F. cinereiceps is lacking although there has been considerable phylogenetic research on babblers. Therefore, we aimed to determine F. cinereiceps’ mitogenome and investigate its phylogenetic relationships within the babblers and superfamily Sylvioidea. F. cinereiceps’ mitogenome is typically circular, 16,969 bp in size with a rich A+T content (52.7%), 13 protein-coding genes (PCGs), 22 tRNAs genes, 2 rRNA genes, a control region (CR) and a non-coding region (NC). We found strong support for F. cinereiceps being placed within Sylviidae (superfamily Sylvioidea) and for babblers being separated into two families, Sylviidae and Timaliidae, with four subfamilies within Timaliidae. This is one of many taxonomic arrangements for babblers and there is likely to be continuous debate until a consensus is reached. Consequently, our study’s complete mitochondrial genome of F. cinereiceps can be added to newly sequenced complete mitochondrial genomes and allow babbler taxonomy to be mapped with confidence.
Article Information
Received 24 May 2018
Revised 23 July 2020
Accepted 03 March 2020
Available online 10 September 2021
Authors’ Contribution
JG and CZ designed the research. BC collected the samples. JG, GW and XS conducted the experiment. JG and MP wrote the manuscript, and GW, CZ, JM, XZ and BY revised the manuscript.
Key words
Fulvetta cinereiceps, Babblers, Mitochondrial genome, Phylogeny, Gene order
DOI: https://dx.doi.org/10.17582/journal.pjz/20180524050555
* Corresponding author: [email protected]
0030-9923/2021/0006-2091 $ 9.00/0
Copyright 2021 Zoological Society of Pakistan
INTRODUCTION
Fulvetta cinereiceps (grey-hooded fulvetta) is a Chinese fulvetta found in central and south-east China (BirdLife International, 2019). The medium-sized (12 cm) fulvetta is grouped with the babblers and is common and widespread, inhabiting undergrowth and thickets of forests (Collar and Robson, 2019). Despite considerable research on babblers, the complete mitochondrial genome of F. cinereiceps is lacking. Additionally, there has been taxonomic uncertainty regarding its place within the multi-clade babblers. Fulvetta cinereiceps was originally classified as Siva cinereiceps (Global Biodiversity Information Facility, 2020), family Timaliidae, and later within the genus Alcippe (Pasquet et al., 2006). However, Cibois (2003a) argued that Alcippe was polyphyletic, which was supported by Pasquet et al. (2006) and Huang et al. (2015), forming a clade with Alcippe ruficapilla, Alcippe striaticollis and Alcippe vinipectus. Pasquet et al. (2006) and Moyle et al. (2012) assigned F. cinereiceps to Fulvetta and Moyle et al. (2012) stated that F. cinereiceps should be more correctly allocated to the family Sylviidae, along with Sylvia and Paradoxornis. However, Cai et al. (2019) propose that Fulvetta be placed in Paradoxornithidae along with Paradoxornis and Suthora, with only Sylvia and Curruca remaining in Sylviidae.
The phylogenetic uncertainty of F. cinereiceps is unsurprising given the debate surrounding the multi-clade babblers (>450 species; ~5 families) (Moyle et al., 2012; Gill and Donsker, 2019). The babblers are a widely distributed and morphologically diverse Passerine taxonomic grouping with species found mostly in Africa, Indo-China and South-east Asia, with a few in the Palearctic and New World (del Hoyo et al., 2016; Gill and Donsker, 2019). Morphological characteristics vary considerably across the babblers, such as size, bill shape and plumage coloration (Cibois, 2003a). The pre-molecular babblers were often referred to as the “scrap basket” because the birds did not fit well within other taxa and were therefore grouped in a ‘miscellaneous’ family, Timaliidae (Mayr and Amadon, 1951). With the rapid development of molecular biology, the traditional morphological classification of babblers has been challenged across several studies with many genera and species being added or removed and shifts of internal phylogenetic relationships. For example, Sibley and Ahlquist (1992; as cited in Cibois 2003a), Cibois (2003a), Alström et al. (2006) and Pasquet et al. (2006) have used varying molecular techniques to map the phylogenetic relationships of these taxa. The most recent phylogenetic analysis of the babblers mapped the relationships of 402 species (ca. 89%) and have proposed a taxonomic revision with seven families and 64 genera (Cai et al., 2019).
Reduction of phylogenetic uncertainty requires additional genetic information be mapped and published. Previous phylogenetic trees including F. cinereiceps were constructed using a single mitochondrial gene or mitochondrial DNA fragments (e.g. Cytochrome b, 12S rRNA, 16S rRNA, ND2 and COI) and would inevitably result in erroneous conclusions. Thus, we aimed to determine the complete mitochondrial genome of F. cinereiceps and investigate its phylogenetic relationships within the multi-clade babblers and superfamily Sylvioidea. Our study will provide more detailed information needed to better understand F. cinereiceps’ phylogeny and future studies on babbler taxonomy.
MATERIALS AND METHODS
Sample collection and DNA extraction
A sample of muscle tissue was collected from an individual of F. cinereiceps that had died of natural causes from Laojunshan National Nature Reserve (Pingshan County, Yibin, Sichuan Province, China). The total genomic DNA was obtained from the muscle tissue according to the instructions of the DNA Extraction Kit (Tiangen, Beijing, China).
Amplification and sequencing
The entire mitochondrial genome of F. cinereiceps was amplified using Polymerase Chain Reaction (PCR). A total of 11 primer pairs (Table I). Primers A1, A2, A7, A10 and A11, were acquired from Zhou et al. (2017), the other primers were designed by aligning with the relatively conserved areas of Alcippe morrisonia hueti (KX376475.1). PCR (25 μl) was undertaken as follows: 0.5 μl total genomic DNA, 1 μl of each of the upstream and downstream primers, 12.5 μl T3 Super PCR Mix (TSINGKE, Beijing, China), and 10 μl ddH2O. The PCR conditions were: 2 mins at 98oC (pre-denaturation), running 35 cycles with a temperature profile including 10 s at 98oC, 15 s at 55oC, and 15~60 s (determined by the length of the assumed fragments) at 72oC, followed by 5 mins extension period at 72oC. The PCR products were sequenced in Tsingke Biotecnology Company (Chengdu, Sichuan Province, China).
Sequence analysis
The amplified sequences were assembled into a complete circular mitochondrial genome by SeqMan and SeqBuilder program (DNAStar Inc., Madison, Wisc.). The position of 13 PCGs and two rRNA genes were determined by comparison with related sequences (A. morrisonia hueti and Paradoxornis gularis: KX397391). The analysis of the complete mitochondrial genome sequence of F. cinereiceps was completed using software MEGA 6.0 (Tamura et al., 2013). The AT skew was calculated using the formula AT skew = [A - T]/[A + T] (Perna and Kocher 1995). Using the tRNAscan-SE 2.0 (http://lowelab.ucsc.edu/tRNAscan-SE/), the possible cloverleaf structures of tRNA genes were identified (Lowe and Chan, 2016).
Rates and patterns of protein-coding gene evolution across the 22 babbler species
Using MEGA 6.0 (Tamura et al., 2013), the variable sites (var. sites), transition-to-transversion ratios (ts/tv), model, nucleotide diversity (π), nonsynonymous rates (dN), synonymous substitution rates (dS) and nonsynonymous to synonymous ratio (dN/dS; ω) of 13 PCGs were calculated based on the mitogenomes of 22 babbler species (see Table II, including F. cinereiceps). Babblers were α-priori classified according to international ornithological authorities del Hoyo et al. (2019) and Gill and Donsker (2019) within families Sylviidae, Zosteropidae, Timaliidae, Pellorneidae and Leiothrichidae.
Control region and gene order
The control regions (positions and the fragment lengths) and gene orders of 54 species (see Table II for species list) from GenBank that were used to construct the phylogenetic trees were summarized. The 54 species included the 36 species from the superfamily Sylvioidea (i.e. 22 babblers + 14 non-babblers) and 18 passerine species from other superfamilies. And sequence identity (%) analyses were conducted using DNAMAN to identify distinct control regions within species from Sylvioidea.
Phylogenetic analysis
The nucleotide sequences of the 13 PCGs from 53 available mitochondrial genomes of Passeriformes species (Table II excluding F. cinereiceps) were extracted and translated into amino acid sequences for alignment with the amino acid sequences of the PCGs of F. cinereiceps by using MEGA 6.0 with the default settings (Nikaido et al., 2001).
Table I. The primers used to amplify the mitochondrial genome of F. cinereiceps.
|
Primer name |
F (5’ to 3’) |
R (5’ to 3’) |
Location (bp) from to |
|
A1a |
TACATGCAAGTATCCGCG |
TTGCTCCCATTCCATAGG |
1 686 |
|
A2a |
AACTCTAAGGACTTGGCGG |
CCTCGTTTAGCCATTCATACT |
479 1985 |
|
A3 |
AACCCGACAGAGGAGCGT |
GGATGGCGATGGAGATGT |
1753 4862 |
|
A4 |
GAACGCCATAAGGGTCAC |
ATCGGTTAATGAATGTCACAGGTA |
3682 5057 |
|
A5 |
AAGACCCGCAGGACATTA |
GTTTATGCGGTTGGCTTG |
5001 6887 |
|
A6 |
TGCCACGACGATACTCAG |
GAAGATTCGTTTGCGGAT |
6600 10438 |
|
A7a |
AAGACAGTTGATTTCGGC |
CTTTCACTTGGATTTGCAC |
9810 11736 |
|
A8 |
TAAACAACCTCCACTACCC |
ATCATGTTGCGAATTGTAG |
10914 12063 |
|
A9 |
CCCCATTATCTTTCCA |
TTGAGCGTAGTTTGGA |
11798 14512 |
|
A10a |
GACCCAGAAAATTTCACGC |
AACTCCTGCTACGCACTGG |
14323 15518 |
|
A11a |
GCATACTTTCCCTCTTACCC |
AACTACTGCTAATACCCGT |
15294 131 |
a. From Zhou et al. (2017).
Stop codon, gaps, and ambiguous sites adjacent to gaps were removed. Pericrocotus ethologus (NC_024257.1) and Nucifraga columbiana (NC_022839.1) were treated as an out-group. The Bayesian phylogenetic analysis, running for 10,000,000 generations sampling per 1,000 generations, was performed using MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). According to the Akaike Information Criterion (AIC) (Posada and Buckley, 2004), GTR + I + G was chosen as the best nucleotide substitution by using jModelTest V.2.1.1 (Darriba et al., 2012) model for Bayesian analysis. The Bayesian posterior probabilities estimation was performed using the Markov chain Monte Carlo (MCMC) sampling method. The GTR (best-fitting model) was chosen and 1,000 ML bootstrap replicates were estimated to implement Maximum Likelihood (ML) analysis using PhyML 3.0 (Guindon, 2010). A majority-rule consensus tree was obtained from the remaining trees.
The genetic distances between 13 PCG sequences from the 22 babbler species were calculated by Kimura 2-parameter model using MEGA 6.0 to better demonstrate the phylogenetic relationship between F. cinereiceps and other babbler species.
RESULTS
F. cinereiceps sequence composition
The complete circular mitochondrial genome of F. cinereiceps consisted of 16,969 bp (Genbank accession number: MG833030), and its base composition was G 15.0%, T 23.8%, A 28.9%, and C 32.2% with a greater content of A+T (52.7%). We found the same high A + T content in all the 54 Passeriformes species’ mitochondrial genomes, which ranged from 51.6% (Garrulax ocellatus) to 57.7% (Pericrocotus ethologus) (Table II).
The mitogenome of F. cinereiceps contained 22 tRNAs, two rRNAs, 13 PCGs, a control region (CR) and a non-coding (NC) region (Fig. 1). The tRNAThr possessed the highest A+T content (68.6%), while the COX3 lowest (48.2%; Table III). The AT skew of the F. cinereiceps mitogenome was 0.095. The highest AT skew was observed in ND6 (0.417), while the lowest in CR (-0.099), and tRNALeu (UUR) showed no AT skew (AT skew = 0). Most of the PCGs and tRNA genes were located on the H-strand, but ND6 and 8 tRNA genes (tRNAGln, tRNAAla, tRNAAsn, tRNACys, tRNATyr, tRNASer (UCN), tRNAPro and tRNAGlu) were encoded on the L-strand. The lengths of 12S rRNA and 16S rRNA were 983 bp and 1,597 bp, respectively. The A+T content and AT skew of 16S rRNA were greater than 12S rRNA. The longest intergenic spacer was between tRNALeu (UUR) and ND1 (15 bp). Several genes shared 1~8 bp with each other (Table III).
F. cinereiceps protein coding genes
A total of 3,789 codons (excluding termination codons) were identified. The codons CUA (7.15%) and AUC (5.38%) were most common, and codon AGU was the least frequent (0.13%). The frequency of the four bases were similar at the first codon position (U 20.5%, G 23.9%, A 27.4%, C 28.2%). Base U (40.2%) had the highest and G (12.8%) the lowest frequency at the second codon position. While at the third position, G was the least common base (G 7.0%, U 13.8%, A 35.6%, C 43.6%). Leu was the most common amino acid, accounting for 17.21% of all amino acids.
Table II. The A + T (%) content and control regions (CR) of the 54 Passerine species (F. cinereiceps + 53 species’ sequences obtained from GenBank) used for phylogenetic analysis. The 21 additional babbler species are listed below F. cinereiceps, with current babbler families denoted by lettered subscripts (α-priori taxa del Hoyo et al., 2019; Gill and Donsker, 2019). Species in the left section of the table belong to the superfamily Sylvioidea, while the species on the right are Passerines from other superfamilies.
|
Species |
A+T (%) |
CR1 (bp) |
CR2 or NC (bp) |
Identity |
Species |
A+T (%) |
CR (bp) |
|
between tRNAThr and tRNAPro |
between tRNAGlu and tRNAPhe |
between tRNAGlu and tRNAPhe |
|||||
|
52.7 |
1215 |
250 |
9.69% |
Sylviparus modestus |
53.0 |
1493 |
|
|
Paradoxornis webbianusa |
53.8 |
1134 |
255 |
10.18% |
Parus major |
52.3 |
1186 |
|
Paradoxornis fulvifronsa |
53.9 |
1235 |
269 |
8.01% |
Parus monticolus |
52.2 |
1187 |
|
Paradoxornis nipalensisa |
54.5 |
1167 |
268 |
10.50% |
Ficedula zanthopygia |
53.2 |
1213 |
|
55.5 |
1107 |
1260 |
91.22% |
Cyanoptila cyanomelana |
53.0 |
1241 |
|
|
Sylvia crassirostrisa |
53.8 |
1116 |
524 |
19.68% |
Sturnus cineraceus |
52.5 |
1249 |
|
Yuhina diadematab |
54.1 |
1077 |
1184 |
86.84% |
Gracula religiosa |
52.4 |
1249 |
|
Zosterops poliogastrusb |
54.3 |
1087 |
1149 |
73.39% |
Turdus migratorius |
52.1 |
1110 |
|
Pomatorhinus ruficollisc |
53 |
1055 |
385 |
16.20% |
Turdus naumanni naumanni |
52.8 |
1199 |
|
Stachyris ruficepsc |
54.1 |
1092 |
231 |
13.20% |
Turdus eunomus |
52.7 |
1182 |
|
Alcippe morrisonia huetid |
53.6 |
1090 |
1131 |
88.76% |
Turdus hortulorum |
52.6 |
1204 |
|
Napothera epilepidotad |
53.9 |
1094 |
1236 |
83.44% |
Turdus merula |
52.7 |
1177 |
|
Minla ignotinctae |
54 |
1123 |
1174 |
92.37% |
Turdus rufiventris |
52.3 |
1113 |
|
Leiothrix luteae |
54 |
1077 |
958 |
72.55% |
Luscinia calliope |
52.3 |
1257 |
|
Leiothrix argentaurise |
53.9 |
1093 |
1164 |
88.93% |
Regulus regulus |
55.5 |
1257 |
|
Garrulax formosuse |
54.1 |
1136 |
1155 |
93.10% |
Nucifraga columbiana |
55.8 |
1318 |
|
Garrulax affinise |
53.1 |
1135 |
1158 |
92.58% |
Pericrocotus ethologus |
57.7 |
1329 |
|
Garrulax elliotiie |
53.3 |
1137 |
1163 |
89.03% |
Turdus philomelos |
53.3 |
1191 |
|
Garrulax canoruse |
52.2 |
1109 |
1152 |
92.33% |
|||
|
Garrulax sannioe |
52.2 |
1129 |
1147 |
91.90% |
|||
|
Garrulax ocellatuse |
51.6 |
1092 |
1148 |
90.42% |
|||
|
Garrulax cineraceuse |
52.3 |
1086 |
1156 |
89.73% |
|||
|
Megalurus pryeri |
53.7 |
1128 |
1265 |
87.51% |
|||
|
Megalurus punctatus |
53.7 |
1120 |
1274 |
76.28% |
|||
|
Megalurus punctatus |
52.1 |
1122 |
1206 |
90.96% |
|||
|
Pycnonotus sinensis |
54.0 |
1112 |
229 |
10.20% |
|||
|
Pycnonotus melanicterus |
55.1 |
1117 |
315 |
12.22% |
|||
|
Pycnonotus xanthorrhous |
54.4 |
1113 |
260 |
11.83% |
|||
|
Spizixos semitorques |
55.5 |
1100 |
360 |
16.09% |
|||
|
Hirundo rustica gutturali |
54.1 |
1195 |
1290 |
80.87% |
|||
|
Progne chalybea |
53.2 |
1071 |
1380 |
72.93% |
|||
|
Tachycineta albilinea |
53.4 |
1079 |
1267 |
78.58% |
|||
|
Alauda arvensis |
52.3 |
1152 |
327 |
13.53% |
|||
|
Phylloscopus inornatu |
53.5 |
1071 |
239 |
10.70% |
|||
|
Aegithalos bonvaloti |
54.5 |
1159 |
1209 |
87.62% |
|||
|
Aegithalos caudatus |
54.5 |
1155 |
1205 |
86.17% |
a Sylviidae; b Zosteropidae; c Timaliidae; d Pellorneidae; e Leiothrichidae.
Table III. Characteristics of the F. cinereiceps mitogenome, containing 22 tRNAs, two rRNAs, 13 protein coding genes (PCGs), a control region (CR) and a non-coding region (NC). The length, location, A+T content and AT skew of different regions are shown.
|
Gene |
Size (bp) |
Inc |
Location (bp) |
Anticodon |
Codon |
Skewness |
A+T (%) |
Strand |
||
|
From |
To |
Start |
Stop |
AT |
||||||
|
tRNAphe |
70 |
1 |
70 |
GAA |
0.258 |
50.0 |
H |
|||
|
12S rRNA |
983 |
71 |
1053 |
0.171 |
50.9 |
H |
||||
|
tRNAVal |
70 |
1054 |
1123 |
TAC |
0.056 |
51.4 |
H |
|||
|
16S rRNA |
1597 |
2 |
1124 |
2720 |
0.223 |
54.7 |
H |
|||
|
tRNALeu (UUR) |
75 |
15 |
2723 |
2797 |
TAA |
0 |
53.3 |
H |
||
|
ND1 |
978 |
6 |
2813 |
3790 |
ATG |
AGA |
0.004 |
49.9 |
H |
|
|
tRNAIle |
74 |
6 |
3797 |
3870 |
GAT |
0.095 |
56.8 |
H |
||
|
tRNAGln |
71 |
-1 |
3877 |
3947 |
TTG |
0.116 |
60.6 |
L |
||
|
tRNAMet |
69 |
3947 |
4015 |
CAT |
0.134 |
53.6 |
H |
|||
|
ND2 |
1041 |
-1 |
4016 |
5056 |
ATG |
TAA |
0.054 |
52.0 |
H |
|
|
tRNATrp |
70 |
1 |
5056 |
5125 |
TCA |
0.171 |
58.6 |
H |
||
|
tRNAAla |
69 |
10 |
5127 |
5195 |
TGC |
0.111 |
52.2 |
L |
||
|
tRNAAsn |
73 |
2 |
5206 |
5278 |
GTT |
0.077 |
53.4 |
L |
||
|
tRNACys |
66 |
5281 |
5346 |
GCA |
0.295 |
51.5 |
L |
|||
|
tRNATyr |
70 |
1 |
5347 |
5416 |
GTA |
0.350 |
57.1 |
L |
||
|
COX1 |
1551 |
-8 |
5418 |
6968 |
GTG |
AGG |
0.046 |
52.2 |
H |
|
|
tRNASer (UCN) |
73 |
2 |
6960 |
7032 |
TGA |
0.100 |
54.8 |
L |
||
|
tRNAAsp |
69 |
7 |
7035 |
7103 |
GTC |
0.158 |
55.1 |
H |
||
|
COX2 |
684 |
5 |
7111 |
7794 |
ATG |
TAA |
0.149 |
50.9 |
H |
|
|
tRNALys |
70 |
1 |
7796 |
7865 |
TTT |
0.235 |
48.6 |
H |
||
|
ATP8 |
168 |
-8 |
7867 |
8034 |
ATG |
TAA |
0.053 |
56.5 |
H |
|
|
ATP6 |
684 |
6 |
8025 |
8708 |
ATG |
TAG |
0.047 |
53.1 |
H |
|
|
COX3 |
784 |
8715 |
9498 |
ATG |
T |
-0.005 |
48.2 |
H |
||
|
tRNAGly |
69 |
9499 |
9567 |
TCC |
0.043 |
66.7 |
H |
|||
|
ND3 |
351 |
1 |
9568 |
9918 |
ATA |
TAA |
-0.027 |
53.3 |
H |
|
|
tRNAArg |
70 |
1 |
9920 |
9989 |
TCG |
0.023 |
61.4 |
H |
||
|
ND4L |
297 |
-7 |
9991 |
10287 |
ATG |
TAA |
0.053 |
50.5 |
H |
|
|
ND4 |
1378 |
10281 |
11658 |
ATG |
T |
0.089 |
52.2 |
H |
||
|
tRNAHis |
70 |
-2 |
11659 |
11728 |
GTG |
0.131 |
65.7 |
H |
||
|
tRNASer (AGY) |
66 |
11729 |
11794 |
GCT |
0.177 |
51.5 |
H |
|||
|
tRNALeu (CUN) |
71 |
-2 |
11795 |
11865 |
TAG |
0.116 |
60.6 |
H |
||
|
ND5 |
1824 |
4 |
11866 |
13689 |
ATG |
TAA |
0.095 |
53.2 |
H |
|
|
CytB |
1143 |
3 |
13694 |
14836 |
ATG |
TAA |
0.054 |
52.0 |
H |
|
|
tRNAThr |
70 |
14840 |
14909 |
TGT |
0.042 |
68.6 |
H |
|||
|
CR |
1146 |
14910 |
16055 |
-0.099 |
53.3 |
H |
||||
|
tRNAPro |
70 |
6 |
16056 |
16125 |
TGG |
0.210 |
61.4 |
L |
||
|
ND6 |
519 |
16132 |
16650 |
ATG |
TAG |
0.417 |
52.2 |
L |
||
|
tRNAGlu |
69 |
16651 |
16719 |
TTC |
0.022 |
62.3 |
L |
|||
|
NC |
250 |
16720 |
16969 |
0.401 |
58.8 |
H |
||||
|
Overall of genome |
16969 |
1 |
16969 |
0.095 |
52.7 |
Table IV. Rates of mitochondrial protein coding gene (PCG) evolution across the 22 babbler species.
|
Var. sites |
ts/tv |
Model |
π |
dN |
dS |
dN/dS |
|
|
ND1 |
446 (0.4574) |
1.958 |
HKY+G+I |
0.168205 |
0.038 |
0.920 |
0.041 |
|
ND2 |
739 (0.7310) |
2.016 |
TN93+G+I |
0.221505 |
0.223 |
0.921 |
0.242 |
|
COX1 |
534 (0.3450) |
1.95 |
GTR+G+I |
0.121459 |
0.010 |
0.704 |
0.014 |
|
COX2 |
306 (0.4513) |
2.034 |
GTR+G+I |
0.161246 |
0.061 |
0.744 |
0.082 |
|
ATP8 |
90 (0.5455) |
1.594 |
TN93+G |
0.187249 |
0.112 |
0.730 |
0.153 |
|
ATP6 |
321 (0.4714) |
1.686 |
HKY+G+I |
0.164248 |
0.046 |
0.781 |
0.059 |
|
COX3 |
305 (0.3895) |
1.781 |
GTR+G+I |
0.140909 |
0.035 |
0.727 |
0.048 |
|
ND3 |
176 (0.5057) |
1.93 |
HKY+G+I |
0.167351 |
0.070 |
0.724 |
0.097 |
|
ND4L |
140 (0.4762) |
2.057 |
HKY+G+I |
0.159715 |
0.041 |
0.818 |
0.050 |
|
ND4 |
646 (0.4691) |
1.879 |
GTR+G+I |
0.158412 |
0.052 |
0.723 |
0.072 |
|
ND5 |
864 (0.4768) |
1.772 |
HKY+G+I |
0.161831 |
0.058 |
0.753 |
0.077 |
|
CYTB |
458 (0.4018) |
1.599 |
GTR+G+I |
0.143405 |
0.036 |
0.726 |
0.050 |
|
ND6 |
267 (0.5164) |
2.219 |
HKY+G+I |
0.182867 |
0.074 |
0.809 |
0.091 |
See Table II for babbler species names. Rates of the 13 PCGs are represented by variable sites (var. sites), transition-to-transversion ratio (ts/tv), nucleotide diversity (π), nonsynonymous rate (dN), synonymous rate (dS) and non-synonymous-to-synonymous substitution rates (dN/dS). Model abbreviations refer to HKY (Hasegawa et al., 1985), TN93 (Tamura and Nei, 1993), I (evolutionarily invariable), GTR (General Time Reversible) and G (γ distribution). CYTB refers to cytochrome B; COX1, COX2 and COX3 refer to the cytochrome C oxidase subunit 1, 2 and 3, respectively; ATP refers to ATP synthase subunit gene; and ND (4L, 1-6) refers to the NADH dehydrogenase subunit (4L, 1-6) gene.
ATG was the most frequent start codon, although COXI started with GTG and ND3 began with ATA. Most protein genes terminated with TAA, whereas ND1 terminated with AGA, COXI ended with AGG, TAG was the stop codon of ATP6 and ND6, and COX3 and ND4 terminated with T (incomplete stop codon).
F. cinereiceps tRNA genes
The A nucleotide content was more than the T content in the 22 tRNA genes (0.022≤AT skew≤0.350, Table III). The greatest A+T content was discovered in tRNAThr (68.6%), and the lowest was found in tRNALys (48.6%). We predicted the secondary structure of the 22 tRNAs (Fig. 2) and they ranged in length from 66 bp to 74 bp. The 22 tRNAs fold into the typical clover leaf structure, except for tRNASer (AGN) lacking the dihydrouridine arm (DHU arm).
Rates and patterns of protein coding gene evolution across the 22 babbler species
The COX1 gene had the lowest variable sites proportion, π, dN, dS, dN/dS, while the highest of these same values were observed in ND2 gene (Table IV). The transversion ratio (ts/tv) was highest in ND6 (2.219) and lowest in ATP8 (1.594) (Table IV). We found that dN/dS ratio was <1 for all 13 PCGs (Fig. 3).
Control region and gene order
We found that the 36 species of Sylvioidea either had one single region (CR1 located between tRNAThr and tRNAPro) with a NC (located between tRNAGlu and tRNAPhe), or two control regions (CR1 located between tRNAThr and tRNAPro; CR2 located between tRNAGlu and tRNAPhe) with little difference in length (Table II). Non-Sylvioidea species’ control region (CR) was found between tRNAGlu and tRNAPhe.
The mitogenome of G. formosus had two control regions with the highest sequence identity (93.1%; Table II). Other species with sequence identities >90% were S. atricapilla (91.22%), Minla ignotincta (92.37%), G. affini (92.58%), G. canorus (92.33%), G. sannio (91.90%), G. ocellatus (90.42%) and Me. punctatus (90.96%). No species had identities >95%. F. cinereiceps control regions had low sequence identity (9.69%).
Table V. Genetic distances between 13 protein coding genes (PCGs) of 22 babbler species (see Table II for list) computed by Kimura 2-parameter model. Pairwise genetic distances are shown below the diagonal and the upper numbers are standard error estimates.
The 36 Sylvioidea species shared a common gene order of “CYTB / tRNAThr / CR1 / tRNAPro / ND6 / tRNAGlu / CR2 (or NC) / tRNAPhe” (GO1 Fig. 6). We found that “CYTB / tRNAThr / tRNAPro / ND6 / tRNAGlu / CR / tRNAPhe” was a shared by Regulidae, Paridae and other species of Muscicapoidea (18 non-Sylvioidea species; GO2 Fig. 6). The exception to this was Turdus philomelos from Muscicapoidea who had the gene order of “CYTB / tRNAThr / tRNAPro / ND6 / tRNAGlu / CR1 / tRNAPro / ND6 / tRNAGlu / CR2 / tRNAPhe” (GO3).
Phylogenetic relationships
The phylogenetic trees were constructed using 13 PCGs of the 54 complete mitochondrial genomes from Passeriformes (Fig. 4 and Fig. 5). We found there was strong support for babblers being separated into two families, including five primary Clades (distinct from minor/macro clades by the use of “Clade” ① to ⑤). These two groups have been classified here as Sylviidae (Clade ①) and Timaliidae (Clades ②~⑤; BI = 1.00, ML = 1000), with subfamilies forming Clades ②~⑤. The clade consisting of F. cinereiceps and Paradoxornis (BI = 1.00, ML = 1000) was a sister to the Sylvia (BI = 1.00, ML = 1000), which together formed Clade ①. Within Timaliidae, Clade ② was composed of Yuhina and Zosterops (subfamily Zosteropinae), which was deeply nested in the basal position of Timaliidae as the sister group of Clade ③ + (Clade ④ + Clade ⑤). Clade ③ included the Stachyris and Pomatorhinus (BI = 1.0, ML = 990; subfamily Timaliinae). Clade ⑤ comprising Garrulax + (Leiothrix + Minla) (subfamily Leiothrichinae) was sister to the Clade ④ (A. morrisonia hueti + Napothera epilepidota) (BI = 0.99, ML = 444; subfamily Pellorneinae).
The genetic distance between F. cinereiceps and other species of Sylviidae was shorter (0.162 ~ 0.195; average: 0.174) than between F. cinereiceps and species Timaliidae (Table V). The genetic distance between F. cinereiceps and species of Timaliidae ranged from 0.184 to 0.203 (average: 0.191).
The babblers (Sylviidae + Timaliidae), Pycnonotidae, Hirundinidae, Acrocephalidae, Aegithalidae, Phylloscopidae, Megaluridae and Alaudidae were clustered into a clade constituting Sylvioidea (BI=1.00, ML=937), which formed the sister clade of Paridae (BI=1, ML=726). Within Sylvioidea families, the position of Acrocephalidae was variable with low support, either as a sister to Megaluridae (Fig. 4) or as the sister to Hirundinidae + Pycnotidae (Fig. 5). The Muscicapoidea consisted of Turdidae, Muscicapidae and Sturnidae, and was situated in the basal position of Sylvioidea and Paridae (BI=0.83, ML=693).
DISCUSSION
F. cinereiceps sequence composition, PCGs and tRNA genes
We found that F. cinereiceps has a circular mitochondrial genome (16,969 bp) with a greater A+T (52.7%) content and this A+T bias was reflected in the 53 other Passeriformes species’ mitochondrial genomes (51.6-57.7%). This A+T rich pattern is normal and widespread in most vertebrates (Sun et al., 2005). The frequency of nucleotide bases in F. cinereiceps mitochondrial genome is C > A > T > G with Guanine being the least common nucleotide. F. cinereiceps has a typical vertebrate mitogenome with 22 tRNAs, two rRNAs, 13 PCGs, a control region (CR) and a non-coding (NC) region. Several genes shared a few bases with each other (1~8 bp) and consequently mitochondrial genome sequences were quite compact (Curole and Kocher, 1999). A total of 3,789 codons were identified within the PCGs, where Guanine was the least common base at the third codon position as has been demonstrated in other studies (Webb and Moore, 2005). Similarly, start and stop codons were in congruence with other species, where F. cinereiceps stop codons TAA, AGA, AGG, TAG and T (incomplete stop codon) are very common in birds (Wen and Liao, 2016; Liu et al., 2017). Our finding that tRNASer (AGN) lacked the DHU arm has been found in other animals, such as birds (Liu et al., 2017) and insects (Du et al., 2015).
Rates and patterns of PCG evolution in the 22 babbler species
We found that five of the six (excluding ts/tv) rates of variation in mitochondrial PCGs were highest in ND2 and lowest in COX1, while the ts/tv was highest in ND6 and lowest in ATP8. Marshall et al. (2013) and Kerr (2011) also found that COX1 had the lowest non-synonymous-to-synonymous substitution ratios (dN/dS or ω), confirming these authors conclusions that functional constraints are strong for this gene rather than the earlier suggestion of recurrent bouts of positive selection. In addition, we found that ω<1 for all 13 PCGs indicating purifying selection (Jiggins et al., 2002) of these PCGs across the 22 babbler species.
Control region and gene order
We found that the 36 species of Sylvioidea either had one single region (CR1) with a NC, or two control regions (CR1 and CR2). Non-Sylvioidea species’ control region (CR) was found between tRNAGlu and tRNAPhe. F. cinereiceps control regions had low sequence identity (9.69%), while G. formosus had two control regions with the highest sequence identity (93.1%). Meanwhile, Sylvia crassirostris with the NC and Sylvia atricapilla with the CR2 shared the identical phylogenetic position (Table II and Fig. 6). Therefore, the control regions may had multiple independent origins in Sylvioidea.
The 36 Sylvioidea species shared a common gene order (Fig. 6). The 18 passerine non-Sylvioidea species also shared gene order, except for T. philomelos (Muscicapoidea). Accordingly, the gene order can provide a meaningful reference for phylogenetic analysis to a certain extent.
Phylogenetic relationships
We found strong support for babblers being separated into two families, Sylviidae and Timaliidae, with F. cinereiceps belonging to Sylviidae. Our results indicated that Timaliidae should be separated into the subfamilies Zosteropinae, Timaliinae Leiothrichinae and Pellorneinae, contrary to current ornithological authorities who have classified these subfamilies as families (del Hoyo et al., 2019; Gill and Donsker, 2019). Previous studies have found support for a range of varying classifications (e.g. Alström et al., 2006; Cibois, 2003b; Pasquet et al., 2006; Cai et al., 2019), consequently the taxonomy of the babblers has been extensively debated. There has been no consensus and a recent phylogenetic analysis of the babblers has proposed a new taxonomic revision with seven families and 64 genera (Cai et al., 2019), rather than confirming an existing arrangement and at odds with our study. Our results are supported by Gelang et al. (2009) who found strong support for the babblers being from families Sylviidae and Timaliidae. Gelang et al. (2009) also divided Timaliidae into the subfamilies Zosteropinae, Timaliinae, Pellorneinae and Leiothrichinae. Given that our results are contrary to many other studies, yet they support Gelang et al., (2009), and our study is based on fewer babbler species than, for example Cai et al. (2019), we cannot make certain conclusions regarding the phylogeny of babblers. It is assumed that as there has been no consensus across more than a few studies, the broader debate of babbler taxonomy will continue.
We found that F. cinereiceps was genetically closer and may be more morphologically (including plumage) similar to other Sylviidae species (Pasquet et al., 2006; Zhang et al., 2014). F. cinereiceps is too genetically distant from Timaliidae to be placed in that family. Consequently, we argue that F. cinereiceps should be placed within Sylviidae. Although F. cinereiceps was previously classified as belonging to genus Alcippe, we confirmed the finding of Moyle et al. (2012) that F. cinereiceps is more closely related to Paradoxornis and Sylvia than Alcippe.
Mayr and Bock (2002) and Gill et al. (2005) stated that a significant criterion for a well-defined taxon was monophyly (Dong et al., 2010). However, we found several instances of polyphyly within genera. The polyphyly of Sylviidae genera prompted the reclassification of F. cinereiceps into Fulvetta and other species into new/old genera (e.g. Cibois, 2003a; Dong et al., 2010; Huang et al., 2015). Similar to the debate surrounding the higher hierarchical classification of babblers, it is likely that genera classifications within Sylviidae will continue. Nevertheless, our results strongly support classification of F. cinereiceps within Sylviidae and our mapping of the complete mitogenome of F. cinereiceps will assist with reducing taxonomic uncertainty in future studies. The debate surrounding babbler phylogeny will continue until more species’ genomes are mapped and more comprehensive phylogenetic analyses are undertaken.
Similarly, higher hierarchical classifications are not certain, although not as contentious as within the babblers. We found that Sylvioidea consisted of the babblers (Sylviidae + Timaliidae), Pycnonotidae, Hirundinidae, Acrocephalidae, Aegithalidae, Phylloscopidae, Megaluridae and Alaudidae (Figs. 4, 5, 6; GO1). The position of Acrocephalidae is either as a sister to Megaluridae or Hirundinidae + Pycnotidae. Although previously classified in Paridae, the results of phylogenetic analysis and gene order confirmed that Aegithalidae should be classified in Sylvioidea as has been accepted in other studies (Alström et al., 2006, 2014). We also confirmed that Muscicapoidea consisted of Turdidae, Muscicapidae and Sturnidae, and was situated in the basal position of Sylvioidea and Paridae, while Regulidae should be excluded from Sylvioidea.
We suggest that gene order can be a useful for confirming results of phylogenetic analyses. However, we question whether gene orders of mitochondrial genomes can distinguish between higher taxa, as has been suggested to separate Passeriformes suborders, such as Passeri (Oscines: songbirds) and Tyranni (Suboscines) (Mindell et al., 1998). For example, we found three distinct gene orders (GO1-GO3) within our study only using birds from Passeri. If a study only used gene order to separate (e.g.) Zosterops poliogastrus (GO1) and Parus major (GO2) they would incorrectly conclude they were from different suborders. Additionally, using gene order may be limited in some instances because we found that one species (T. philomelos) had a distinct gene order (GO3) from its congenerics. Therefore, gene order should be used in conjunction with phylogenetic analyses when classifying taxa.
CONCLUSIONS
Our findings provide the first complete mitochondrial genome of F. cinereiceps and we found strong support for F. cinereiceps being placed within Sylviidae (superfamily Sylvioidea). Of the 36 sampled species of Sylvioidea, we identified that all had the same gene order. However, gene order is limited as a stand-alone taxonomic analysis tool because we also found that species of the same genus and higher taxonomic classifications had differing gene orders (non-Sylvioidea species). Within Sylvioidea, we found strong support for babblers being separated into two families, Sylviidae and Timaliidae, with four subfamilies within Timaliidae. This is one of many taxonomic arrangements for babblers and there is likely to be continuous debate regarding the taxonomy of babblers until a consensus is reached. Therefore, the complete mitochondrial genome of F. cinereiceps that we have provided should reduce uncertainty and with additional complete mitochondrial genomes babbler taxonomy can be mapped with confidence.
ACKNOWLEDGMENTS
The F. cinereiceps individual was identified by Guo Cai of Sichuan University and the manuscript was internally reviewed by Dr. Ting Huang and Dr. Yingjie Song. This study was supported by National Key Programme of Research and Development, Ministry of Science and Technology (2016YFC0503200).
Statement of conflict of interest
All authors declared no conflict of interest.
REFFERENCES
Alström, P., Ericson, P.G., Olsson, U. and Sundberg, P., 2006. Phylogeny and classification of the avian superfamily Sylvioidea. Mol. Phylogen. Evolut., 38: 381-397. https://doi.org/10.1016/j.ympev.2005.05.015
Alström, P., Hooper, D.M., Liu, Y., Olsson, U., Mohan, D., Gelang, M., Le, M.H., Zhao, J., Lei, F. and Price, T.D., 2014. Discovery of a relict lineage and monotypic family of passerine birds. Biol. Lett., 10: 20131067. https://doi.org/10.1098/rsbl.2013.1067
Bird Life International, 2019. Species factsheet: Fulvetta cinereiceps. Available at: http://www.birdlife.org (accessed 10 Jul 2019).
Cai, T., Cibois, A., Alström, P., Moyle, R.G., Kennedy, J.D., Shao, S., Zhang, R., Irestedt, M., Ericson, P.G., Gelang, M., and Qu, Y., 2019. Near-complete phylogeny and taxonomic revision of the world’s babblers (Aves: Passeriformes). Mol. Phylogen. Evolut., 130: 346-356. https://doi.org/10.1016/j.ympev.2018.10.010
Castro, J.A., Picornell, A. and Ramon, M., 1998. Mitochondrial DNA: A tool for populational genetics studies. Int. Microbiol. Off. J. Spanish Soc. Microbiol., 1: 327-332.
Cibois, A., 2003a. Mitochondrial DNA phylogeny of babblers (Timaliidae). Auk, 120: 35-54. https://doi.org/10.1642/0004-8038(2003)120[0035:MDPOBT]2.0.CO;2
Cibois, A., 2003b. Sylvia is a babbler: Taxonomic implications for the families Sylviidae and Timaliidae. Bull. Br. Ornithol. Club, 123: 257-261.
Collar, N. and Robson, C., 2019. Grey-hooded Fulvetta (Fulvetta cinereiceps). In: Handbook of the birds of the world alive (eds. J. del Hoyo, A. Elliott, J. Sargatal, D.A. Christie and E. de Juana). Lynx Edicions, Barcelona. Available at: https://www.hbw.com/node/59394 (accessed 10 Jul 2019). https://doi.org/10.2173/bow.sttful1.01
Curole, J.P. and Kocher, T.D., 1999. Mitogenomics: Digging deeper with complete mitochondrial genomes. Trends Ecol. Evolut., 14: 394-398. https://doi.org/10.1016/S0169-5347(99)01660-2
Darriba, D., Taboada, G.L., Doallo, R. and Posada, D., 2012. Jmodeltest 2: More models, new heuristics and parallel computing. Nature Methods, 9: 772-772. https://doi.org/10.1038/nmeth.2109
del Hoyo, J., Collar, N.J., Christie, D.A., Elliott, A., Fishpool, L.D.C., Boesman, P. and Kirwan, G.M., 2016. HBW and bird life international illustrated checklist of the birds of the world. Volume 2: Passerines. CABI, UK.
del Hoyo, J., Elliott, A., Sargatal, J., Christie, D.A. and de Juana, E., 2019. Handbook of the birds of the world alive. Lynx Edicions, Barcelona. (retrieved from https://www.hbw.com/node/58952 on 17 July 2019).
Du, C., He, S., Song, X., Liao, Q., Zhang, X. and Yue, B., 2015. The complete mitochondrial genome of Epicauta chinensis (Coleoptera: Meloidae) and phylogenetic analysis among Coleopteran insects. Gene, 578: 274-280. https://doi.org/10.1016/j.gene.2015.12.036
Dong, F., Li, S.H. and Yang, X.J., 2010. Molecular systematics and diversification of the Asian scimitar babblers (Timaliidae, Aves) based on mitochondrial and nuclear DNA sequences. Mol. Phylogen. Evolut., 57: 1268-1275. https://doi.org/10.1016/j.ympev.2010.09.023
Global Biodiversity Information Facility, 2020. Fulvetta cinereiceps. Available at: https://www.gbif.org/. (Accessed 11 May 2020)
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W. and Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of phyml 3.0. Syst. Biol., 59: 307-321. https://doi.org/10.1093/sysbio/syq010
Gelang, M., Cibois, A., Pasquet, E., Olsson, U., Alström, P. and Ericson, P.G.P., 2009. Phylogeny of babblers (Aves, Passeriformes): major lineages, family limits and classification. Zool. Scr., 38: 225-236. https://doi.org/10.1111/j.1463-6409.2008.00374.x
Gill, F.B., Slikas, B. and Sheldon, F.H., 2005. Phylogeny of titmice (Paridae): II. species relationships based on sequences of the mitochondrial cytochrome-b gene. Auk, 122: 121-143. https://doi.org/10.1093/auk/122.1.121
Gill, F. and Donsker, D., 2019. IOC world bird list (v 9.2). Available at: (accessed 10 Jul 2019).
Hasegawa, M., Kishino, H. and Yano, T., 1985. Dating of human–ape splitting by a molecular clock of mitochondrial DNA. J. mol. Evolut., 22: 160–174. https://doi.org/10.1007/BF02101694
Huang, Z.H. and Ke, D.H., 2015. DNA barcoding and phylogenetic relationships in Timaliidae. Genet. mol. Res., 14: 5943-5949. https://doi.org/10.4238/2015.June.1.11
Jiggins, F.M., Hurst, G.D. and Yang, Z., 2002. Host-symbiont conflicts: positive selection on an outer membrane protein of parasitic but not mutualistic Rickettsiaceae. Mol. Biol. Evolut., 19: 1341-1349. https://doi.org/10.1093/oxfordjournals.molbev.a004195
Kerr, K.C.R., 2011. Searching for evidence of selection in avian DNA barcodes. Mol. Ecol. Resour., 11: 1045-1055. https://doi.org/10.1111/j.1755-0998.2011.03049.x
Lowe, T.M. and Chan, P.P., 2016. tRNAscan-SE On-line: integrating search and context for analysis of transfer RNA genes. Nucl. Acids Res., 44 (Web Server issue): W54-W57. https://doi.org/10.1093/nar/gkw413
Liu, G., Li, C., Du, Y. and Liu, X., 2017. The complete mitochondrial genome of Japanese sparrowhawk (Accipiter gularis) and the phylogenetic relationships among some predatory birds. Biochem. Syst. Ecol., 70: 116-125. https://doi.org/10.1016/j.bse.2016.11.007
Lin, Y.H., Waddell, P.J. and Penny, D., 2002. Pika and vole mitochondrial genomes increase support for both rodent monophyly and glires. Gene, 294: 119-129. https://doi.org/10.1016/S0378-1119(02)00695-9
Mayr, E. and Amadon, D., 1951. A classification of recent birds. Am. Mus. Novit. N. Y. Am. Museum natl. Hist., 1496: 1-42.
Moyle, R.G., Andersen, M.J., Oliveros, C.H., Steinheimer, F.D. and Reddy, S., 2012. Phylogeny and biogeography of the core babblers (Aves: Timaliidae). Syst. Biol., 61: 631-651. https://doi.org/10.1093/sysbio/sys027
Marshall, H.D., Baker, A.J. and Grant, A.R., 2013. Complete mitochondrial genomes from four subspecies of common chaffinch (Fringilla coelebs): New inferences about mitochondrial rate heterogeneity, neutral theory and phylogenetic relationships within the order Passeriformes. Gene, 517: 37-45. https://doi.org/10.1016/j.gene.2012.12.093
Mayr, E. and Bock, W.J., 2002. Classifications and other ordering systems. J. Zool. Syst. Evolut. Res., 40: 169-194. https://doi.org/10.1046/j.1439-0469.2002.00211.x
Mindell, D.P., Sorenson, M.D. and Dimcheff, D.E., 1998. Multiple independent origins of mitochondrial gene order in birds. Proc. natl. Acad. Sci. U. S. A., 95: 10693-10697. https://doi.org/10.1073/pnas.95.18.10693
Nikaido, M., Kawai, K., Cao, Y., Harada, M., Tomita, S., Okada, N. and Hasegawa M., 2001. Maximum likelihood analysis of the complete mitochondrial genomes of Eutherians and a reevaluation of the phylogeny of Bats and Insectivores. J. mol. Evolut., 53: 508-516. https://doi.org/10.1007/s002390010241
Pasquet, E., Bourdon, E., Kalyakin, M.V., and Cibois, A., 2006. The fulvettas (Alcippe, Timaliidae, Aves): A polyphyletic group. Zool. Scr., 35: 559-566. https://doi.org/10.1111/j.1463-6409.2006.00253.x
Perna, N.T. and Kocher, T.D., 1995. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. mol. Evolut., 41: 353-358. https://doi.org/10.1007/BF01215182
Posada, D. and Buckley, T.R., 2004. Model selection and model averaging in phylogenetics: advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Syst. Biol., 53: 793-808. https://doi.org/10.1080/10635150490522304
Ronquist, F. and Huelsenbeck, J.P., 2003. Mrbayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Sibley, C.G. and Ahlquist, J.E., 1992. Phylogeny and classification of birds. Study Mol. Evolut., 94: 304-307. https://doi.org/10.2307/1368826
Sun, Y., Ma, F., Xiao, B., Zheng, J., Yuan, X., Tang, M., Wang, L., Ye, F. and Li, Q., 2005. The complete mitochondrial genomes sequences of Asio flammeus and Asio otus and comparative analysis. Sci. China Ser. C Life Sci., 47: 510-520. https://doi.org/10.1360/04yc0117
Tamura, K. and Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evolut., 10: 512–526.
Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evolut., 30: 2725-2729. https://doi.org/10.1093/molbev/mst197
Webb, D.M. and Moore, W.S., 2005. A phylogenetic analysis of woodpeckers and their allies using 12s, Cyt b, and COI nucleotide sequences (class Aves; order Piciformes). Mol. Phylogen. Evolut., 36: 233-248. https://doi.org/10.1016/j.ympev.2005.03.015
Wen, L. and Liao, F., 2016. Complete mitochondrial genome of Pycnonotus xanthorrhous (Passeriformes, Pycnonotidae) and phylogenetic consideration. Biochem. Syst. Ecol., 69: 83-90. https://doi.org/10.1016/j.bse.2016.08.009
Zhang, H., Li, Y., Wu, X., Xue, H., Yan, P. and Wu, X.B., 2014. The complete mitochondrial genome of Paradoxornis webbianus (Passeriformes, Muscicapidae). Mitochond. DNA, 26: 879-880. https://doi.org/10.3109/19401736.2013.861440
Zhou, C., Hao, Y., Ma, J., Zhang, W., Chen, Y., Chen, B., Zhang, X. and Yue, B., 2017. The first complete mitogenome of Picumnus innominatus (Aves, Piciformes, Picidae) and phylogenetic inference within the Picidae. Biochem. Syst. Ecol., 70: 274-282. https://doi.org/10.1016/j.bse.2016.12.003