Pathology and Molecular Characterization of Eimeria tenella Isolated from Clinically Infected Broiler Chickens in District Lahore, Pakistan
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
1Department of Pathology, Faculty of Veterinary Science, University of Veterinary and Animal Sciences, Lahore
2Department of Physiology, Faculty of Bio-Sciences, University of Veterinary and Animal Sciences, Lahore
3Department Veterinary Medicine, Faculty of Veterinary Science, University of Veterinary and Animal Sciences, Lahore
ABSTRACT
Coccidiosis caused by Eimeria tenella is a parasitic disease affecting chickens. In Pakistan, there has been no previously published report on phylogenetic analysis of Eimeria tenella. In this retrospective study, tissue samples were collected from a flock of clinically infected chicken followed by haematology, serum biochemistry, and histopathology. Species specific PCR based on polymorphic site of the ITS1 gene was developed and used to identify the organism. Haematological examination of the blood demonstrated a decrease in total erythrocytes, packed cell volume, haemoglobin concentration, and red blood cell indices. Differential leukocyte analysis revealed leukocytosis, heterophilia, eosinophilia, monocytosis, and lymphocytosis. Serum biochemistry showed marked elevation in aspartate transaminase, alkaline phosphatase and creatinine and a significant decline in alanine transaminase, total protein, total albumin, globulin, triglycerides and cholesterol values. Histopathological examination demonstrated degenerative changes, necrosis haemorrhages, and sloughing off epithelial cells of broad folds of caeca, mild lymphoplasmacytic infiltration in the periportal area of the liver and mild depletion of lymphocyte in the bursa of Fabricius. The seven clades of avian Eimeria species strongly support that E. necatrix and E. tenella were closely associated and placed in the same sister clade with high bootstrap support (98%). Our two isolates RSI and RSII showed a homology index of 99.82% (nucleotide level) and 99.47% (amino acid level) with each other. The maximum similarity percentage indicated that RSI and RSII isolates were closely related to strains reported from India and China. This study is the first report on molecular characterization of E. tenella in Pakistan highlighting the pathological potential and distribution of E. tenella.
Article Information
Received 22 June 2020
Revised 30 July 2020
Accepted 12 September 2020
Available online 06 January 2021
(early access)
Published 12 November 2021
Authors’ Contributions
RS conducted the research. AA supervised the research. MYT and HR were members of supervisory committee. SU and AA helped in writing the manuscript. MSI and MZI helped in laboratory work. MU proofread the manuscript.
Key words
Coccidiosis, Phylogenetic analysis, Haematology, Serum biochemistry, Histopathology.
DOI: https://dx.doi.org/10.17582/journal.pjz/20200622030642
* Corresponding author: [email protected]
0030-9923/2022/0001-0047 $ 9.00/0
Copyright 2022 Zoological Society of Pakistan
Introduction
Avian coccidiosis is a parasitic disease caused by genra Eimeria and Isospora, which have a complex life cycle and belong to the phylum Apicomplexa. Members of Apicomplexa mainly affect the intestine of mammals and birds (Murakami et al., 2014). This disease has great economic significance mostly in the chicken industry as birds at the farm level are reared together in high densities where chances of a disease outbreak are prominent. The economic importance of coccidiosis is attributed to a decrease in production, the cost involved in the treatment and control of disease, and a high mortality rate. Worldwide, the annual loss inflicted by coccidiosis to the poultry industry has been estimated at USD 3 billion (Jatau et al., 2014). The most common mode of transmission is mechanical, by a person who moves through the pens, houses, and farms. Infection is usually self-limiting and depends on the number of oocysts ingested and the immune status of the birds. According to surveys, coccidia have been found in litter samples of all farms in America, Europe, and Asia (Fornace et al., 2013).
So far about 1800 species of genus Eimeria are reported that affect the intestinal mucosa of birds and animals (Haug et al., 2008). Nine species of coccidia (E. brunetti E. maxima, E. necatrix, E. tenella, E. acervulina, E. mitis, E. mivati, E. praecox, and E. hagani) have been isolated from chickens, each with specific tissue tropism and pathogenicity (Jadhav et al., 2011; Morgan et al., 2009; Nematollahi et al., 2008). In Pakistan, the prevalence of E. maxima (22.42-34.10%), E. tenella (27.04-30.62%), E. acervulina (19.89%), E. mitis (13.95%) and E. necatrix, (4.02-7.75%) has been documented (Awais et al., 2012; Khan et al., 2006) but the most commonly found pathogenic species accounting for high mortality in the poultry industry of Pakistan is E. tenella. The highest prevalence of coccidiosis is evident in September (73.33%) while the lowest is during April (42.86%) (Bachaya et al., 2012).
E. tenella is the most recorded coccidia in poultry known for its recognizable lesions and remarkable losses in young broilers and layer pullets (Zaman et al., 2012). It inhabits the caeca and causes a severe disease which is characterized by intestinal bleeding, high morbidity, high mortality, a decrease in weight gain with emaciation, loss of skin pigmentation, and bloody cores that accompany clusters of large schizonts and oocysts in the caecum (Habibi et al., 2016). The diagnosis and differential diagnosis between other species are usually carried out by observing the clinical signs of the disease, the morphology of the parasites, location of development of oocytes within the intestine and their natural appearance in faeces, endogenous stages in the caecal and intestinal mucosa, postmortem analysis of birds (Carvalho et al., 2011).
Recently, coccidian parasites of both humans and mammals have been differentiated through the amplification of DNA. An ideal genomic DNA target for polymerase chain reaction (PCR) is the internal transcribed spacer 1 (ITS-1) gene of ribosomal DNA (rDNA) (Lew et al., 2003). This spacer gene separates the 3’ of 16S-ribosomal RNA from 5’ of 5.8S-ribosomal RNA within individual rDNA. Due to base sequences and heterology of the ITS-1 gene, it tends to be suitable to design specific primers and hence provides multiple copies of potential PCR targets (Kumar et al., 2015).
In this study, we investigated the pathological changes induced in broiler chickens naturally infected with E. tenella. The infection was confirmed using a molecular technique (PCR) targeting the ITS-1 gene of rDNA. No previous information has been reported on genetic diversity in the ITS-1 gene of E. tenella infection in Pakistan. Therefore, nucleotide sequences of field isolates were generated to investigate the ITS-1 based phylogenetic relationship of E. tenella prevailing in Pakistan with those reported in various geographical areas of the world.
Materials and methods
Sample collection
Blood and tissue samples (caeca, bursa of Fabricius and liver) of apparently healthy birds (n=25) and those (n=25) showing clinical signs of bloody diarrhoea, retarded growth, dullness, and reluctance to move were collected from a flock of approximately 3,000 three-week-old broilers suspected to have caecal coccidiosis in the farm located in the surroundings of Lahore district. The day-old-birds were vaccinated against Newcastle disease, infectious bursal disease, and infectious bronchitis. The farm had a previous history of impaired conditions and clinical symptoms compatible with caecal coccidiosis, accompanied by an increase in mortality rate reaching 0.3% per day, with a cumulative mortality rate of 14.7%. The economic losses due to retarded growth were evident for over a week. The blood sample was collected in a five mL syringe and shifted equally into ethylenediaminetetraacetic acid (EDTA) and gel containing vacutainers. Then, birds were euthanized through cervical dislocation to examine the postmortem changes in caeca, small intestine, and large intestines. For histopathological examinations, tissue samples of 4×4 mm were fixed in 10% neutral buffered formalin.
Isolation and sporulation of oocysts of E. tenella
Caeca samples were rinsed with normal saline, homogenized, and transferred to 35% sodium chloride solution to induce the floatation of oocysts. The supernatant was separated to collect the oocysts and observed under a light microscope. The oocysts were treated with 2.5% potassium dichromate for sporulation (Ogedengbe et al., 2011).
Haematological analysis
Haematological parameters, including total erythrocytes (TE) and leukocytes, differential leukocyte count (DLC), packed cell volume (PCV) and haemoglobin concentration (Hb) were measured according to methodology as described by Akhtar et al. (2015). The red blood cell indices [mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH) and mean corpuscular haemoglobin concentrations (MCHC)], were calculated from RBC, PCV, and Hb percentage, respectively (Adamu et al., 2013).
Serum biochemistry profile
The serum biochemistry was analyzed in a spectrometer (Pharmacia Biotech, Sweden). Blood samples in a gel containing vacutainer were centrifuged for 10 min at 3,000 g to separate the serum samples. The concentration of liver enzymes [alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP)], total protein (TP), total albumin (TA), globulin, cholesterol, triglycerides (TG), and creatinine was evaluated using specific kits (Roche Diagnostics, Switzerland) as described by Dar et al. (2014) and Mohammed (2012).
Histopathological examination
For histopathological examination, tissue samples fixed in 10% neutral buffered formalin were hydrated, dehydrated in ethanol in ascending order, cleared with xylene, embedded in paraffin, and sectioned off 4 µm with a microtome (SLEE, Germany). Paraffin tissue sections were then deparaffinized using xylene and hydrated in descending concentration of alcohol. Tissue sections were observed under a light microscope (Olympus, Japan) after staining with hematoxylin and eosin (H and E) dye.
DNA extraction of oocysts of E. tenella
For extraction of DNA, the purified sporulated oocysts were centrifuged at 12,000 g for 5 min (four times) with autoclaved phosphate-buffered saline (PBS) solution to remove the debris. The pellet was suspended in 100 µL of 5.75% hypochlorite after an incubation of 30 min on ice. The suspension was further diluted in 500 µL of double distilled water and pelleted after centrifugation. The pellet was also washed (four times) with PBS and diluted in 500 µL of double-distilled water. The oocysts were disrupted through speed sonication using the ultra-sonicator (Thomas Scientific, United States). The genome was extracted from the rigid oocysts and analyzed by agarose gel electrophoresis (Patra et al., 2010).
ITS-1 gene amplification and polymerase chain reaction
For ITS-1 gene amplification, previously reported oligonucleotide primer sequences for E. tenella; forward (5’- CCGCCCAAACCAGGTGTCACG -3’) and reverse (5’- CCGCCCAAACATGCAAGATGGC -3’) were used for amplification of ITS-1 gene with a predicted amplicon size of 539 bp (Gadelhaq et al., 2015). Each 40 µL reaction mixture consisted of 20 μL master mix (PrimeSTAR Max DNA polymerase, catalogue number: R045A), 1.5 μL primer (forward and reverse each), one μL DNA template and 16 μL nuclease-free water. The tubes were then placed in Veriti™ 96-Well Thermal Cycler (Applied Biosystems™, United States) with following reaction conditions; a single cycle of initial denaturation (95°C, 5 min), and 35 cycles of each [denaturation (94°C, 30 s), annealing (57.5°C, 30 s) extension (72°C, 90 s)], and a final extension (72°C, 10 min). The PCR product was separated on agarose gel (1.5% w/v) stained with 0.5 μg/mL ethidium bromide, run in gel electrophoresis at 110V, 230mA for 20 min and then visualized in a gel documentation system (Bio-Rad Laboratories, United States).
The PCR products were submitted for DNA sequencing to Comate Bioscience Co., Ltd., China. The oligonucleotide sequences were aligned using ClustalW with BioEdit software. The phylogenetic tree was constructed and inferred through the Maximum likelihood-method with statistical analysis based on 1,000 bootstrap replicates performed on MEGA-X software. Nucleotide and amino acid percentage identity was compared with the Geneious prime software. Nucleotide sequences of other Eimeria species were retrieved from the NCBI-GenBank database to conduct phylogenetic analysis.
The sequences were submitted to the NCBI GenBank database and are available under the accession numbers MN883392.1 [Eimeria tenella isolate PAK-UVAS-PATH-RSI (RSI)] and MN883393.1 [Eimeria tenella isolate PAK-UVAS-PATH-RSII (RSII)].
Results and discussion
Haematological analysis depicted a significant decrease (P<0.05) in TE (106/µL), PCV (%), Hb concentration, MCV (fL), MCH (pg), and MCHC (g/L) in infected birds. A significant increase (P<0.05) in leukocytes 103/µL, heterophils, eosinophils, and lymphocytes were observed in diseased birds (Table I). A decline in red blood cell indices is in concurrence with the reports of many researchers (Bogado et al., 2010; Jatau et al., 2014; Singh et al., 2013). The decrease in TE and Hb could be due to haemorrhages in caeca. The reduction in MCV, MCH and MCHC can be associated with microcytic hypochromic anaemia (Adamu et al., 2013). The activated macrophages release several pro-inflammatory cytokines that mediate the alterations in blood glucocorticoids level (Krams et al., 2012). Therefore, an increased level of corticosterone
Table I.- Haematological analysis of E. tenella infected and non-infected broiler chickens.
|
Parameters |
Normal |
Infected |
P-value (P<0.05) |
|
TE (106/µL) |
2.94±0.19b |
1.72±0.25a |
<0.0001 |
|
PCV (%) |
43.20±6.43b |
23.39±2.42a |
<0.0001 |
|
Hb (g/L) |
10.83±1.33b |
8.80±0.96a |
0.0030 |
|
MCV (fL) |
131.40±14.55b |
85.93±14.01a |
0.0001 |
|
MCH (pg) |
43.72±4.28b |
33.75±6.73a |
0.0050 |
|
MCHC (g/L) |
321.10±15.49b |
169.70±4.55a |
<0.0001 |
|
Leukocytes (103/µL) |
13.69±1.49a |
20.35±1.66b |
<0.0001 |
|
Heterophils (103/µL) |
4.22±0.32a |
6.63±0.70b |
<0.0001 |
|
Eosinophils (103/µL) |
0.80±0.01a |
0.90±0.01b |
<0.0001 |
|
Lymphocytes (103/µL) |
8.81±0.87a |
12.50±0.81b |
<0.0001 |
|
Monocytes (103/µL) |
1.15±0.35 |
1.24±0.20 |
0.3169 |
TE, total erythrocytes; PCV, packed cell volume; Hb, haemoglobin; MCV, mean corpuscular volume; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentrations. a,b within a row, values having different superscripts are different significantly (P<0.05).
in blood circulation can induce changes in haematological parameters (Duckworth et al., 2001; Shini et al., 2009). The significant increase (P<0.05) in heterophils, eosinophils and lymphocytes could be associated with the parasitic infestations that agree with the conclusions of Ahmed El-Shazly et al. (2020) and Khaligh et al. (2019). Heterophils are one of the granulocytic leukocytes and contribute as the first line of defense against pathogens. Heterophilia and monocytosis are often associated with acute and chronic inflammatory responses, respectively. Macrophages, monocytes, and dendritic cells are the essential hematopoietic cells and have a crucial rule in the defense system of the body. Eosinophilia is associated with the parasitic infestation and rarely reported in birds (Adamu et al., 2013).
Concerning the serum biochemistry profile of E. tenella infected birds, a marked elevation in AST, ALP, and creatinine was obtained which is in concurrence with the findings of many researchers (Ahmed El-Shazly et al., 2020; Mondal et al., 2011). A significant decrease (P<0.05) in serum ALT, TP, TA, globulin, TG and cholesterol agrees with the results of Ahmed El-Shazly et al. (2020) and Mondal et al. (2011). The higher values of serum AST and ALP may be attributed to protein malabsorption due to tissue damage produced by E. tenella. The inadequate feed intake and protein absorption resulted in elevated protein catabolism which subsequently leads to severe muscle degradation, and eventually elevated level of serum AST and ALP (Rajman et al., 2006). The increased level of ALP in serum might be due to metabolic alteration and damage of bone marrow due to blood loss or haemorrhages. Any injury to bone marrow may result in bone marrow hyperactivity eventually in elevated ALP level in serum (Adamu et al., 2013). Hypo-proteinemia, hypo-albuminemia, and hypo-globulinemia are may be due to acute stress resulted in the release of cortisol and protein catabolism (Mohammed, 2012). The haemorrhages and seepage of plasma protein into intestine due to tissue damage to caecum may cause the malabsorption of protein and other nutrients from feed (Williams, 2005). The decrease in serum TG and cholesterol may be associated with the anorexia, malabsorption of nutrients and severe tissue damage to the caecum by E. tenella infection (Fukata et al., 1997). In malnutrition, fat mobilization from fat depots, the disappearance of fatty acids, and hindering in lipogenesis due to disturbances in vitamin-B caused by coccidiosis are evident (Allen, 1988).
Histopathological examination demonstrated inflammatory cell aggregation in mucosa and submucosa of caeca. Caecal mucosa was destroyed with necrosis and disintegration of epithelial cells. Put together, broad folds in the mucosal layer were degenerated and sloughed off, and submucosa was exposed. The lumen of caeca was filled with enterocytes, the debris of epithelial layer cells, and remnants of lamina propria (Fig. 1B). The infiltration of heterophils, macrophages, and lymphocytes in mucosa indicates the acute and chronic inflammatory response which is caused by concurrent lodging of E. tenella, and this is in concurrence with the results of Zhang et al. (2012). The histopathological findings of the current study are similar to those reported by Adamu et al. (2013). They demonstrated that most pathogenic second-generation schizonts of E. tenella induce tissue damage, haemorrhages, and degenerative changes in the mucosa, and muscularis of caeca. There was focal lymphoplasmacytic infiltration in the liver (Fig. 1D) and marked lymphocytic depletion in BF (Fig. 1F) as outlined by Ogbe et al. (2010). No specific microscopic lesions were observed in caeca (Fig. 1A), liver (Fig. 1C) and BF (Fig. 1E) of normal birds.
Table II.- Serum biochemistry profile of E. tenella infected and non-infected broiler chickens.
|
Parameters |
Normal |
Infected |
P value (P<0.05) |
|
ALT (U/L) |
15.66±2.66b |
6.24±1.62a |
<0.0001 |
|
AST (U/L) |
122.40±21.65 |
130.50±18.36 |
0.4392 |
|
ALP (U/L) |
77.58±12.83a |
99.93±11.92b |
0.0006 |
|
Creatinine (mg/dL) |
0.29±0.04a |
0.49±0.06b |
<0.0001 |
|
TP (g/dL) |
4.81±0.26b |
4.30±0.47a |
0.0123 |
|
TA (g/dL) |
2.05±0.21b |
1.76±0.15a |
0.0035 |
|
Globulin (g/dL) |
2.83±0.43b |
2.29±0.37a |
0.0267 |
|
TG (mg/dL) |
78.53±1.32b |
69.10±0.67a |
<0.0001 |
|
Cholesterol (mg/dL) |
142.70±4.98b |
93.96±3.08a |
<0.0001 |
ALT, alanine transaminase; AST, aspartate transaminase; ALP, alkaline phosphatase; TP, total protein; TA, total albumin; TG, triglycerides. a,b within a row, values having different superscripts are different significantly (P< 0.05).
After the ITS-1 gene sequence alignment, all 25 sequences were grouped into two isolates; RSI and RSII. The deduced nucleotide and amino acid sequences of the ITS-1 gene for isolate RSI and RSII were aligned with other strains reported in different geographical regions to calculate the percentage homology. Despite the high similarities, minor alterations in the ITS-1 gene of Pakistan isolate were noted. Isolate RSI showed similarity with RSII at the nucleotide level (99.82%) and the amino acid level (99.47%) (Table III). The identity range of RSI and RSII isolates was 94.17 to 99.82% at the nucleotide level and 57.89 to 99.47 at the amino acid level when compared with the sequences available in the public domain of NCBI GenBank database (Table III). Sequencing demonstrated high levels of identity in nucleotides and amino acids of our isolates with the strains reported in India, China, USA,
Table III.- The nucleotide and deduced amino acid identities of RSI and RSII isolates.
|
Accession No. |
Country |
Nucleotide identity (%) |
Amino acid identity (%) |
||
|
RSI |
RSII |
RSI |
RSII |
||
|
MN830381 |
Pakistan |
99.82 |
99.65 |
99.47 |
98.94 |
|
MN830382 |
Pakistan |
99.11 |
98.94 |
98.40 |
97.87 |
|
GQ856310 |
India |
98.76 |
98.58 |
97.87 |
97.34 |
|
GQ856299 |
India |
98.23 |
98.05 |
96.28 |
95.74 |
|
GQ856300 |
India |
97.52 |
97.34 |
95.74 |
95.21 |
|
JX853830 |
India |
99.82 |
99.65 |
99.47 |
98.94 |
|
JX853825 |
India |
99.29 |
99.11 |
98.94 |
98.40 |
|
KM382066 |
India |
99.29 |
99.11 |
98.94 |
98.40 |
|
GQ856308 |
India |
98.94 |
98.76 |
98.40 |
97.87 |
|
JX853831 |
India |
98.94 |
98.76 |
98.94 |
98.40 |
|
GQ856297 |
India |
97.70 |
97.52 |
95.74 |
95.21 |
|
LN609975 |
India |
98.58 |
98.40 |
97.34 |
96.81 |
|
LN609974 |
India |
99.29 |
99.11 |
98.94 |
98.40 |
|
FJ449691 |
China |
98.94 |
98.76 |
99.47 |
98.94 |
|
GQ153633 |
China |
98.76 |
98.58 |
97.87 |
97.34 |
|
GQ153630 |
China |
96.64 |
96.46 |
78.42 |
77.89 |
|
GQ153632 |
China |
96.64 |
96.46 |
78.42 |
77.89 |
|
GQ153636 |
China |
97.87 |
97.70 |
96.28 |
95.74 |
|
GQ153634 |
China |
98.23 |
98.06 |
67.02 |
66.49 |
|
LN609835 |
Nigeria |
98.76 |
98.58 |
97.87 |
97.34 |
|
LN609828 |
Nigeria |
98.76 |
98.58 |
97.87 |
97.34 |
|
LN609784 |
USA |
98.40 |
98.23 |
97.87 |
97.34 |
|
AY779514 |
USA |
98.94 |
98.76 |
98.94 |
98.40 |
|
AF026388 |
UK |
98.40 |
98.23 |
57.89 |
57.89 |
|
LN609785 |
UK |
98.05 |
97.87 |
95.74 |
95.21 |
|
LN609774 |
France |
98.76 |
98.58 |
97.87 |
97.34 |
|
LN609773 |
France |
96.99 |
96.81 |
78.95 |
78.42 |
|
LN609946 |
Libya |
98.40 |
98.23 |
57.89 |
57.89 |
|
LN609948 |
Libya |
99.29 |
99.11 |
99.47 |
98.94 |
|
LN609952 |
Libya |
96.64 |
96.46 |
77.89 |
77.37 |
|
LN609888 |
Uganda |
99.29 |
99.11 |
99.47 |
98.94 |
|
LN609903 |
Uganda |
98.94 |
98.76 |
98.94 |
98.40 |
|
LN609880 |
Uganda |
98.58 |
98.40 |
97.87 |
97.34 |
|
LN609776 |
Germany |
98.76 |
98.58 |
97.87 |
97.34 |
|
LN609777 |
Germany |
96.03 |
95.85 |
95.34 |
94.82 |
|
AF446074 |
Australia |
98.23 |
98.05 |
96.81 |
96.28 |
|
HQ680474 |
Turkey |
94.35 |
94.17 |
73.54 |
73.02 |
|
LN609809 |
Japan |
98.58 |
98.40 |
97.87 |
97.34 |
UK, Germany, France, Japan, Australia, Nigeria, Libya, and Uganda (Table III).
The phylogenetic tree was constructed through the Maximum Likelihood method (Fig. 2). The two nucleotide sequences produced in this study and fifty-eight sequences of Eimeria available in NCBI GenBank, reported in Asia, Europe, Africa, Australia, and America were used for phylogenetic analysis. The nucleotide sequences of E. acervuline, E. brunetti, E. praecox, E. maxima, E. mitis, E. necatrix and E. tenella were clustered separately irrespective of their geographical distribution. Our two isolates RSI and RSII were located in a clade formed by ITS-1 gene sequences of E. tenella (Fig. 2). E. necatrix and E. tenella were closely associated and placed in the same sister clade with high bootstrap support (98%). Likewise, E. praecox and E. brunetti were closely linked and placed in the same sister clade with high bootstrap support (96%). The maximum likelihood tree revealed that our isolates are grouped with other Pakistani, Indian and Chinese strains which are in concurrence with Kumar et al. (2015).
Conclusion
In conclusion, the results of the current study depicted that haematological parameters and serum biochemistry profile were adversely altered in broiler chickens naturally infected with E. tenella. Moreover, genetic diversity among our isolates undoubtedly throws some light on the genetic makeup of E. tenella. However, the immunological diversity of E. tenella in Pakistan requires to be further investigated to manufacture an anticoccidial vaccine that can prove equally effective against the genetically diverse population of E. tenella around the globe.
Acknowledgment
Authors are thankful to the Chairman, Department of Pathology, University of Veterinary and Animal Sciences Lahore, Pakistan, for providing laboratory and other necessities towards completion of research work.
Statement of conflict of interest
The authors have declared no conflict of interests.
References
Adamu, M., Boonkaewwan, C., Gongruttananun, N. and Vongpakorn, M., 2013. Hematological, biochemical and histopathological changes caused by coccidiosis in chickens. Kasetsart J. nat. Sci., 47: 238–246.
Ahmed El-Shazly, K., Abd El-Latif, A., Abdo, W., El-Morsey, A., Ibrahim Abd El-Aziz, M. and El-Mogazy, H., 2020. The anticoccidial activity of the fluoroquinolone lomefloxacin against experimental Eimeria tenella infection in broiler chickens. Parasitol. Res., 119: 1955–1968. https://doi.org/10.1007/s00436-020-06692-6
Akhtar, M., Awais, M.M., Anwar, M.I., Ehtisham-ul-Haque, S., Nasir, A., Saleemi, M.K. and Ashraf, K., 2015. The effect of infection with mixed Eimeria species on hematology and immune responses following Newcastle disease and infectious bursal disease booster vaccination in broilers. Vet. Q., 35: 21–26. https://doi.org/10.1080/01652176.2014.991048
Allen, P.C., 1988. The effect of Eimeria acervulina infection on plasma lipids and lipoproteins in young broiler chicks. Vet. Parasitol., 30: 17–30. https://doi.org/10.1016/0304-4017(88)90139-2
Awais, M.M., Akhtar, M., Iqbal, Z., Muhammad, F. and Anwar, M.I., 2012. Seasonal prevalence of coccidiosis in industrial broiler chickens in Faisalabad, Punjab, Pakistan. Trop. Anim. Hlth. Prod., 44: 323–328. https://doi.org/10.1007/s11250-011-0024-x
Bachaya, H., Raza, M., Khan, M., Iqbal, Z., Abbas, R., Murtaza, S. and Badar, N., 2012. Predominance and detection of different Eimeria species causing coccidiosis in layer chickens. J. Anim. Pl. Sci., 22: 597–600.
Bogado, A.L.G., Garcia, J.L., Silva, P.F.N. da, Balarin, M.R.S. and Junior, J.S.G., 2010. Post-challenge hematological evaluation with virulent strain of Eimeria tenella in broilers immunized with attenuated strain or sporozoite proteins from homologous strain. Rev. Bras. Parasitol. Vet., 19: 1-6. https://doi.org/10.1590/S1984-29612010000100002
Carvalho, F.S., Wenceslau, A.A., Teixeira, M., Matos Carneiro, J.A., Melo, A.D.B. and Albuquerque, G.R., 2011. Diagnosis of Eimeria species using traditional and molecular methods in field studies. Vet. Parasitol., 176: 95–100. https://doi.org/10.1016/j.vetpar.2010.11.015
Dar, S.A., Verma, P., Ashfaque, M., Zargar, A.A. and Mir, I.A., 2014. Effect of garlic extract on haematobiochemical changes in Eimeria tenella infected broiler chicken. Natl. Acad. Sci. Lett., 37: 311–316. https://doi.org/10.1007/s40009-014-0237-4
Duckworth, R.A., Mendonça, M.T. and Hill, G.E., 2001. A condition dependent link between testosterone and disease resistance in the house finch. Proc. R. Soc. B: Biol. Sci., 268: 2467–2472. https://doi.org/10.1098/rspb.2001.1827
Fornace, K.M., Clark, E.L., Macdonald, S.E., Namangala, B., Karimuribo, E., Awuni, J.A., Thieme, O., Blake, D.P. and Rushton, J., 2013. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS One, 8: e84254. https://doi.org/10.1371/journal.pone.0084254
Fukata, T., Komba, Y., Sasai, K., Baba, E. and Arakawa, A., 1997. Evaluation of plasma chemistry and haematological studies on chickens infected with Eimeria tenella and E. acervulina. Vet. Rec., 141: 44–46. https://doi.org/10.1136/vr.141.2.44
Gadelhaq, S.M., Arafa, W.M. and Aboelhadid, S.M., 2015. Molecular characterization of Eimeria species naturally infecting Egyptian Baldi Chickens. Iran. J. Parasitol., 10: 87–95.
Habibi, H., Firouzi, S., Nili, H., Razavi, M., Asadi, S.L. and Daneshi, S., 2016. Anticoccidial effects of herbal extracts on Eimeria tenella infection in broiler chickens: in vitro and in vivo study. J. Parasit. Dis., 40: 401–407. https://doi.org/10.1007/s12639-014-0517-4
Haug, A., Gjevre, A.G., Thebo, P., Mattsson, J.G. and Kaldhusdal, M., 2008. Coccidial infections in commercial broilers: Epidemiological aspects and comparison of Eimeria species identification by morphometric and polymerase chain reaction techniques. Avian Pathol., 37: 161–170. https://doi.org/10.1080/03079450801915130
Jadhav, B., Nikam, S., Bhamre, S. and Jaid, E., 2011. Study of Eimeria necatrix in broiler chicken from Aurangabad district of Maharashtra state India. Int. Multidiscip. Res. J., 1: 11–12.
Jatau, I.D., Odika, A.N., Thlama, M., Talba, A.M., Bisalla, M. and Musa, I.W., 2014. Response of 2 breeds of broiler chicks to experimental infection with low dose of Eimeria tenella sporulated oocysts. Turkish J. Vet. Anim. Sci., 38: 398–404. https://doi.org/10.3906/vet-1306-22
Khaligh, F., Hassanabadi, A., Nassiri-Moghaddam, H., Golian, A. and Kalidari, G., 2019. Effect of probiotic administration route and dietary nutrient density on growth performance, gut health, and some hematological variables in healthy or Eimeria infected broiler chickens. Iran. J. appl. Anim. Sci., 9: 473–485.
Khan, M., Irshad, H., Anjum, R., Jahangir, M. and Nasir, U., 2006. Eimeriosis in poultry of Rawalpindi/Islamabad area. Pak. Vet. J., 26: 85–87.
Krams, I., Vrublevska, J., Cirule, D., Kivleniece, I., Krama, T., Rantala, M.J., Sild, E. and Hõrak, P., 2012. Heterophil/lymphocyte ratios predict the magnitude of humoral immune response to a novel antigen in great tits (Parus major). Comp. Biochem. Physiol. A: Mol. Integr. Physiol., 161: 422–428. https://doi.org/10.1016/j.cbpa.2011.12.018
Kumar, S., Garg, R., Banerjee, P.S., Ram, H., Kundu, K., Kumar, S. and Mandal, M., 2015. Genetic diversity within ITS-1 region of Eimeria species infecting chickens of north India. Infect. Genet. Evol., 36: 262–267. https://doi.org/10.1016/j.meegid.2015.09.023
Lew, A.E., Anderson, G.R., Minchin, C.M., Jeston, P.J. and Jorgensen, W.K., 2003. Inter- and intra-strain variation and PCR detection of the internal transcribed spacer 1 (ITS-1) sequences of Australian isolates of Eimeria species from chickens. Vet. Parasitol., 112: 33–50. https://doi.org/10.1016/S0304-4017(02)00393-X
Mohammed, A.K., 2012. Study of hematological and some biochemical values changing with administration of Salinomycin and Poultrystar probiotics in broiler chickens challenged with Cocciodsis (Eimeria tenella). Al-Qadisiyah J. Vet. med. Sci., 11: 42–46. https://doi.org/10.29079/vol11iss3art213
Mondal, D.K., Chattopadhyay, S., Batabyal, S., Bera, A.K. and Bhattacharya, D., 2011. Plasma biochemical indices at various stages of infection with a field isolate of Eimeria tenella in broiler chicken. Vet. World, 4: 404–409. https://doi.org/10.5455/vetworld.2011.404-409
Morgan, J.A.T., Morris, G.M., Wlodek, B.M., Byrnes, R., Jenner, M., Constantinoiu, C.C., Anderson, G.R., Lew-Tabor, A.E., Molloy, J.B., Gasser, R.B. and Jorgensen, W.K., 2009. Real-time polymerase chain reaction (PCR) assays for the specific detection and quantification of seven Eimeria species that cause coccidiosis in chickens. Mol. Cell. Probes, 23: 83–89. https://doi.org/10.1016/j.mcp.2008.12.005
Murakami, A.E., Eyng, C. and Torrent, J., 2014. Effects of functional oils on coccidiosis and apparent metabolizable energy in broiler chickens. Asian-Australasian J. Anim. Sci., 27: 981–989. https://doi.org/10.5713/ajas.2013.13449
Nematollahi, A., Moghaddam, G. and Niyazpour, F., 2008. . Prevalence of Eimeria spp. among broiler chicks in Tabriz (Northwest of Iran). Res. J. Poult. Sci., 2: 72–74.
Ogbe, A.O., Atawodi, S., Abdu, P.A., Oguntayo, B. and Dus, N., 2010. Oral treatment of Eimeria tenella-infected broilers using aqueous extract of wild mushroom (Ganoderma sp): Effect on haematological parameters and histopathology lesions. Afr. J. Biotechnol., 9: 8923–8927.
Ogedengbe, J.D., Hunter, D.B. and Barta, J.R., 2011. Molecular identification of Eimeria species infecting market-age meat chickens in commercial flocks in Ontario. Vet. Parasitol., 178: 350–354. https://doi.org/10.1016/j.vetpar.2011.01.009
Patra, G., Lalsiamthara, J., Mayengbam, P., Ali, M.A., Chanu, K.V., Jonathan, L., Joy, L.K., Prava, M., Ravindran, R., Das, G. and Devi, L.I., 2010. PCR based diagnosis of Eimeria tenella infection in broiler chicken. Int. J. Poult. Sci., 9: 813–818. https://doi.org/10.3923/ijps.2010.813.818
Rajman, M., Juráni, M., Lamošová, D., Máčajová, M., Sedlačková, M., Košťál, Ľ., Ježová, D. and Výboh, P., 2006. The effects of feed restriction on plasma biochemistry in growing meat type chickens (Gallus gallus). Comp. Biochem. Physiol. A: Mol. Integr. Physiol., 145: 363–371. https://doi.org/10.1016/j.cbpa.2006.07.004
Shini, S., Shini, A. and Huff, G.R., 2009. Effects of chronic and repeated corticosterone administration in rearing chickens on physiology, the onset of lay and egg production of hens. Physiol. Behav., 98: 73–77. https://doi.org/10.1016/j.physbeh.2009.04.012
Singh, V.S., Palod, J., Vatsya, S. and Shukla, S.K., 2013. Effect of herbal vitamin E-selenium with organic chromium on growth, haematological and parasitological parameters of broiler chicken during mixed Eimeria infection. Vet. Res. Int., 1: 25–30.
Williams, R.B., 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: Rational, integrated disease management by maintenance of gut integrity. Avian Pathol., 34: 159–180. https://doi.org/10.1080/03079450500112195
Zaman, M.A., Iqbal, Z., Abbas, R.Z. and Khan, M.N., 2012. Anticoccidial activity of herbal complex in broiler chickens challenged with Eimeria tenella. Parasitology, 139: 237–243. https://doi.org/10.1017/S003118201100182X
Zhang, D.F., Sun, B.B., Yue, Y.Y., Yu, H.J., Zhang, H.L., Zhou, Q.J. and Du, A.F., 2012. Anticoccidial effect of halofuginone hydrobromide against Eimeria tenella with associated histology. Parasitol. Res., 111: 695–701. https://doi.org/10.1007/s00436-012-2889-7