Polymorphisms of the DHCR24 Gene are Associated with Carcass and Fat Deposition in Chinese Simmental Steers

Pan Ziyi1, Ambreen Iqbal1, Gao Zhen1, Liu Juan1, Fang Xibi2, Jiang Ping1* and Zhao Zhihui1*

1College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang 524088 China.

2College of Animal Science, Jilin University, Xi An Road 5333, Changchun, Jilin, China.

Pan Ziyi and Ambreen Iqbal contributed equally to this work and share the first authorship.

ABSTRACT

3-β-hydroxysteroid-Δ-24-reductase (DHCR24) gene regulates the abdominal fat of broilers and it is hypothesized that it can also play a role in the fat metabolism of cattle. A mutation in the 3’ untranslated region of the DHCR24 gene was identified that led to the differential expression of DHCR24 in cattle. In this study, we detected mutation at g.32435 from G > A in 3’UTR of DHCR24 gene in a Chinese Simmental steer population. In mutated individuals at g. 32435 G > A of DHCR24 the kidney fat weight of GG was higher than that of GA and AA individuals. Steers of the GG and AA genotype having high backfat thickness (p < 0.05) and a higher carcass fat coverage rate (p < 0.05). Furthermore, GG genotype individuals had higher marble grade than GA genotype individuals (p < 0.05). It is predicted through bioinformatics analysis that bta-miR-12059 can bind to 3’UTR of the DHCR24 gene. Our results indicate that single nucleotide polymorphisms might be used as a molecular marker for marker-assisted selection in beef cattle breeding.


Article Information

Received 31 July 2020

Revised 25 March 2021

Accepted 17 April 2021

Available online 04 August 2021

(early access)

Published 18 April 2022

Authors’ Contribution

PZ and AI conceived the idea, carried out the experiments and data analysis, and drafted the manuscript. GZ and LJ helped with sample collection and data analysis. FX helped in the bioinformatic analysis. JP and ZZ revised the manuscript.

Key words

mi-RNA, DHCR24, PCR-RFLP, Carcass, Fat deposition

DOI: https://dx.doi.org/10.17582/journal.pjz/20200731120728

* Corresponding author: [email protected]; [email protected]

0030-9923/2022/0004-1685 $ 9.00/0

Copyright 2022 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

3-β-hydroxysteroid-Δ-24-reductase (DHCR24), also known as seladin-1, was first identified by studying the effect of the DIMINUTO gene on the growth of Arabidopsis cells (Takahashi et al., 1995). In previous studies, the DHCR24 gene was thought to be involved in steroid synthesis, albeit through further extrapolation by researchers, it was found that DHCR24 was mainly involved in the conversion of lanosterol into cholesterol and played an important role in the stability of cholesterol and can act as anti-apoptosis (Kandutsch and Russell, 1960; Johnston and Bloch, 1957). Recent studies showed that the DHCR24 gene could provide a neuroprotective effect (Martiskainen et al., 2017; Hernández-Jiménez et al., 2016). Greeve et al. (2000) found that the DHCR24 gene can inhibit the activation of CASOASE3 in nerve cells and proved that DHCR24 could protect nerves. Interestingly, Giannini et al. (2008) pointed out that IGF-1 stimulation and hypoglycemia can inhibit the expression of the DHCR24 gene in neurons. It shows that DHCR24 was involved in diabetic neuropathy. Further, the results of the mouse liver proteomics and bioinformatics analysis by Kim et al. (2013) showed that the mRNA and protein levels of the DHCR24 gene in the liver of diabetic mice were 10 times higher than those of normal mice. Recently, Zhang et al. (2018) showed that the expression of DHCR24 in ovaries of estrus and non-estrus pigs was significantly higher than that of estrus pigs which indicated that the expression of the DHCR24 gene was significantly associated with the development of ovaries. Other studies have shown that DHCR24 is associated with Alzheimer’s disease, cardiovascular disease, and prostate cancer (Lämsä et al., 2007; Wu et al., 2013; Hendriksen et al., 2006).

Presently, only a few studies on single nucleotide polymorphism (SNP) of the DHCR24 gene in Chinese Simmental cattle are available with major focus on reproductive and growth traits. Mu et al., (2019) reported that DHCR24 gene expression in broiler abdominal fat was significantly higher in ovariectomized than non-ovariectomized broilers. They further reported that the DHCR24 gene was also involved in fat deposition. On the contrary, Cochran et al. (2013) reported that the DHCR24 gene was not involved in the reproductive traits of Holstein cows. The present study aimed at find the polymorphisms of the DHCR24 gene and their associated with carcass and fat deposition in Chinese Simmental steers.

MATERIALS AND METHODS

Animals and sampling

A total of 445 Chinese Simmental steers were randomly selected from 15 cattle farms from the Wulagai administrative district of Inner Mongolia in China. Steers were slaughtered at 28 months of age at the Inner Mongolia Baolongshan cattle farm (Tongliao, China). Carcass composition traits such as meat quality traits as well as fatty acid composition traits were measured at the Chinese Academy of Agricultural Sciences meat laboratory as described previously by Fang et al. (2017). Fatty acid content was extracted from longissimus muscle and stated as grams per 100g fresh tissue. Blood samples (10 mL per animal) were collected from the jugular vein with anticoagulant (acid citrate dextrose, ACD) and stored at -80ᵒC until used for performing further analysis. All animal experiments in this study were strictly abided by the ordinance for the care and use of laboratory animals of the Jilin University Animal Care and Use Committee (permit number: SYXK (Ji) pzpx 20181227083).

DHCR24 variant detection and genotyping by sequencing

DNA of leukocytes from whole blood samples was extracted using a TIANamp Blood DNA Kit (Tiangen, Beijing, China) and following the manufacturer’s protocol. The purity and concentration of the genomic DNA were determined using a NanoDropND-2000 ultraviolet spectrophotometer (Thermo Fisher Scientific Inc., USA) and the quality was verified by agarose gel electrophoresis. The PCR primers for 3’UTR polymorphism were 5’- GCATCTCCCCAATTCATGGT -3’ and 5’- AACTGTCCCACTCTATCCTG -3’. The primers were designed using Primer Premier 6.0 (Premier Bio soft International, Canada) and synthesized by GENEWIZ, Inc. (Suzhou, China). The 3’UTR sequence of DHCR24 gene was amplified by PCR in a 25 µL reaction volume including 12.5 µL of 2× Taq PCR Master Mix (Tiangen, Beijing), 0.5 µL of forward and reverse primers (10 µM), 1.0 µL of template DNA, and 10.5 µL of nuclease-free water. The PCR conditions were as follows: 95 ᵒC for 5 min; 30 cycles of 95 ᵒC for 30 s, 60 ᵒC for the 30s, and 72 ᵒC for 30 s; and a final 5 min extension at 72 ᵒC. The PCR products of the 3’UTR sequence and mRNA of the DHCR24 gene were run on 1% agarose gel and visualized under UV light (Tanon, China). The remaining PCR product was sent to Sangon Biotech (Shanghai, China) for sequencing. Sequencing data were analyzed by Chromas (Technelysium, Australia) to determine the location of SNP and genotypes.

miRNA binding site prediction for DHCR24

miRNAs that bind to the 3’UTR sequence of DHCR24 gene were predicted by miRNA binding site prediction site (http://www.mirbase.org/search.shtml), and to analyze the effect of SNPs on miRNA that may bind to 3’UTR of DHCR24 gene.

Statistical analysis

The genotype frequency and allelic frequency of each SNP were calculated according to genotyping results. The polymorphism information component (PIC) was determined through Botstein’s methods (Botstein et al., 1980). The Hardy–Weinberg equilibrium of the polymorphisms was tested with the chi-squared (x2) test. Variance effective population size Ne is defined as the size of the ideal population with the same variance. Associations between DHCR24 gene polymorphisms and economic traits of beef cattle were analyzed by two-way analysis of variance (ANOVA) using SPSS 13.0 for Windows. The fixed model was Equation 1.

Yijk =u+ysi +mj +eijk ….(1)

Where; Yijk is the observed value of the kth individual from the Simmental breed of genotype j in the ith-year season, u is the lowest square mean of the observed values, ysi is the effective value of the ith-year season, mj is the effective value of genotype j, and eijk is the random residual effect corresponding to the observed value. For SNPs that correlated with the carcass and fat-related traits, the haplotype test and linkage disequilibrium (LD) were performed and measured by D’ and r2 with the Haplo-View software (Daly Lab at the Broad Institute Cambridge, USA, ver. 3.32) (Barrett et al., 2005).

RESULTS

SNP loci in DHCR24 gene

We had screened SNP in the key functional domain of the bovine DHCR24 gene in the Chinese Simmental cattle population. Based on the sequencing results and sequencing chromatographs of PCR products, one SNP, g.32435 G > A, was identified in 3’UTR of the DHCR24 gene in a population of Chinese Simmental steers (Fig. 1). We used restriction endonuclease Ava I to digest the PCR products of the DHCR24 gene and detected by gel electrophoresis (Fig. 2). Subsequent single sample PCR product sequencing results were consistent with digestion results.

 

 

Genetic diversity of SNP in the DHCR24 gene

Values of genotypic frequencies, allelic frequencies, PIC, Ne (variance effective size), Ho (gene homozygosity), and He (gene heterozygosity) were calculated to illustrate the genetic diversity of DHCR24 in Chinese Simmental steers (Table I). The percentage of Ho in SNP was lower than that of He. The PIC value of g. 32435 G > A, 0.416, indicated an intermediate polymorphism frequency of SNP. The g. 32435 G > A fit the Hardy–Weinberg equilibrium in this population (p > 0.05).

DHCR24 polymorphisms correlation with carcass and fat deposition

The associations between variants and traits are presented in Table II. These analyses revealed that the SNP in the 3’-terminal sequence of the DHCR24 gene was significantly associated with carcass and meat quality trail. At g. 32435 G > A of DHCR24, a higher carcass weight (p<0.05) and deeper fat color (p<0.05) were observed in an individual with the GG genotype as compared to the GA genotype. The kidney fat weight of GG individuals was higher than that of GA and AA individuals. Steers of the GG and AA genotype had higher liver weight (p<0.05), thicker back fat (p<0.05), and a higher carcass fat coverage rate (p<0.05). Furthermore, GG genotype individuals have higher marble grade than GA genotype individuals (p<0.05). There was no significant correlation between the mutation site and the ocular muscle area.

miRNA binding site prediction

The prediction results showed that bta-miR-12059 might recognize (Fig. 3) possible binding sites for bta-miR-12059 and DHCR24 gene 3’UTR sequences 3’UTR sequence of DHCR24 gene containing g. 32435 G > A site. If the base of g. 32435 G > A is A, bta-miR-12059 could recognize the sequence containing the site the bta-miR-12059 is combined with DHCR24, it would reduce the translation rate of mRNA and affect the performance of body traits (Fig. 3). However, if the base of the SNP site is G, bta-miR-12059 does not recognize the sequence containing the site.

 

Table I. Genetic polymorphism analysis of DHCR24 gene g. 32435 G > A site.

Site

Gene frequency

Genotype frequency

H

Ne

χ2

PIC

G

A

GG

GA

AA

g.32435G > A

0.706

0.294

0.492(191/445)

0.553(246/445)

0.018(8/445)

0.4154

1.7107

48.05

0.416

 

χ20.05(df=2) = 5.99, χ20.01(df= 2)= 4.61, χ2>χ20.05 mean p>0.05.

 

Table II. Correlation analysis between DHCR24 gene g. 32435 G > A locus and 445 Chinese Simmental cattle traits.

Genotype

Traits

Carcass

weight /kg

Liver

weight/kg

Kidney

fat /kg

Back

fat /cm

Fat coverage /%

Eye muscle area /cm2

Marbling rating

Fat color

GG

269.72 ± 34.25a

6.48 ± 0.69a

6.19 ± 2.063a

1.29 ± 0.46a

1.98 ± 0.28a

23.61 ± 2.32

5.16 ± 0.74b

84.08 ± 12.81a

GA

246.43 ± 38.43b

5.47 ± 1.16b

3.54 ± 2.74b

0.72± 0.63b

1.69 ± 0.34b

23.51 ± 2.56

5.55 ± 0.64a

75.70 ± 11.64b

AA

272.12 ± 51.42ab

6.41 ± 0.83a

5.92 ± 2.94b

1.18± 0.54a

1.97 ± 0.37a

23.61 ± 2.70

5.40 ± 0.89ab

77.60 ± 6.35ab

 

Lowercase letters in the same column indicate a significance difference (p <0.05), lower case letters indicate the same difference was not significant (p> 0.05).

 

DISCUSSION

According to the results of SNP microarray screening, there was no significant correlation between the DHCR24 gene and reproductive traits in 550 Holstein cattle (Cochran et al., 2013). This result may suggest that the main function of the DHCR24 gene is not related with cattle reproduction. At present, the main research results showed that DHCR24 can regulate carcinogenesis and oxidative stress and play a protective role in the nerve (Crameri et al., 2006; Cecchi et al., 2008; Kuehnle et al., 2008). According to Mu et al. (2019) the DHCR24 gene is involved in the fat deposition of broilers. However, the gene expression profile of Kim et al. (2013) on human subcutaneous and visceral fat stem cells showed that the expression of DHCR24 in visceral fat was significantly higher than that in sebum. Hitherto, the single nucleotide polymorphism analysis of the DHCR24 gene in Chinese Simmental cattle has not appeared. The correlation between the DHCR24 gene with carcass traits and fat deposition traits has never been studied before. Our results indicated that the SNP site (g. 32435 G > A) was detected in 3 ‘UTR of the DHCR24 gene in 445 Chinese Simmental cattle. The GA genotype frequency of this locus was the highest (0.553), followed by GG (0.429). The results showed that the SNP site (G. 32435 g > A) was detected in 3 ‘UTR of the DHCR24 gene in 445 Chinese Simmental cattle. The GA genotype frequency of this locus was the highest (0.553), followed by GG (0.429). The results of correlation analysis between SNP and traits showed that there was a significant correlation between g. 32435g > a locus to the carcass and fat deposition traits (p < 0.05): individuals with GG genotype had higher body weight, liver weight, kidney fat weight, backfat thickness, marbling grade, and fat color grade (p < 0.05); individuals with GA genotype had lower liver weight, kidney fat weight, backfat thickness and fat coverage (p < 0.05) than those with other two genotypes. We also detected the SNP at the 3’UTR at the bovine DHCR24 locus. Among them, the mutation of the g. 32435 G > A showed significant association with traits related to fat deposition in 445 Chinese Simmental steers. The site of g. 32435 G > A occurred in 3’ untranslated regions and did not alter the amino acid sequence of DHCR24. However, mutations in the non-coding region may also influence the expression and function of a gene by aberrant splicing (Komar, 2007). This also indirectly indicates that bovine DNA is highly conserved. We use miRNA binding site prediction software predicted miRNA binding site, when g. 32435 G > A site is nucleotide A, bta-miR-12059 may recognize 3’UTR of the DHCR24 gene. Based on the prediction results, it can be inferred that bta-miR-12059 can regulate the expression of the DHCR24 gene, thus affecting cholesterol production and finally causing the difference of phenotype. Albeit, how DHCR24 genes are involved in the regulation of body fat deposition in cattle and whether bta-miR-12059 can regulate the expression of DHCR24 gene still need to be explored.

CONCLUSION

In summary, the single nucleotide polymorphisms of DHCR24 showed significant correlations with fat-related traits in Chinese Simmental steers. This suggests that DHCR24 is involved in fat deposition at different stages of growth and fattening of cattle, e.g. intramuscular fat, back fat, and peri-renal fat deposition. Bioinformatics analysis predicts that bta-miR-12059 can bind to the DHCR24 gene, so it can regulate the expression of the DHCR24 gene in bovine fat through bta-miR-12059. This mutation might be molecular markers for beef breeding selection.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (No.31772562) and the Key Platform Project of Innovative Strong School Engineering by the Department of Education of Guangdong Province (2018302).

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Barrett, J.C., Fry, B., Maller, J. and Daly, M.J., 2005.Haploview: Analysis and visualization of LD and haplotype maps. Bioinforma. Oxf. Engl., 21: 263–265. https://doi.org/10.1093/bioinformatics/bth457

Botstein, D., White, R.L., Skolnick, M. and Davis, R.W., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet., 32:314-31.

Cecchi, C., Rosati, F., Pensalfini, A., Formigli, L., Nosi, D., Liguri, G., Dichiara, F., Morello, M., Danza, G. and G. Pieraccini. 2008. Seladin-1/DHCR24 protects neuroblastoma cells against Aβ toxicity by increasing membrane cholesterol content. J. cell. mol. Med., 12: 1990-2002. https://doi.org/10.1111/j.1582-4934.2008.00216.x

Cochran, S.D., John, B.C., Daniel, J.N. and Peter, J.H., 2013. Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle. BMC Genet., 14: 49. https://doi.org/10.1186/1471-2156-14-49

Crameri, A., Elisa, B., Katrin, K., Dieter, L., Karin, M.T., Simona, P., Carlos, G.D., Roger, M.N., Maria, D.L., and Hasan, M.M., 2006. The role of seladin-1/DHCR24 in cholesterol biosynthesis, APP processing and Aβ generation in vivo. EMBO J., 25: 432-443. https://doi.org/10.1038/sj.emboj.7600938

Fang, X., Zhao, Z., Jiang, P., Yu, H., Xiao, H. and Yang, R., 2017. Identification of the bovine HSL gene expression profiles and its association with fatty acid composition and fat deposition traits. Meat Sci., 131: 107–118. https://doi.org/10.1016/j.meatsci.2017.05.003

Giannini, S., Benvenuti, S., Luciani, P., Manuelli, C., Cellai, I., Deledda, C., Pezzatini, A., Vannelli, G.B., Maneschi, E. and Rotella, C.M., 2008. Intermittent high glucose concentrations reduce neuronal precursor survival by altering the IGF system: The involvement of the neuroprotective factor DHCR24 (Seladin-1). J. Endocrinol., 198: 523-532. https://doi.org/10.1677/JOE-07-0613

Greeve, Isabell, Irm, H-B., Claire, B., Dagmar, K., Teresa, G-I., Christian, B., Bodo, L. and Roger, M.N., 2000. The human DIMINUTO/DWARF1 homolog seladin-1 confers resistance to Alzheimer’s disease-associated neurodegeneration and oxidative stress. J. Neurosci., 20: 7345-7352. https://doi.org/10.1523/JNEUROSCI.20-19-07345.2000

Hendriksen, Peter, J.M., Natasja, F.J.D., Koichi, K., Antoine, V., Wytske, M.v.W., Chris, H.B., Jan, T. and Guido, J., 2006. Evolution of the androgen receptor pathway during the progression of prostate cancer. Cancer Res., 66: 5012-5020. https://doi.org/10.1158/0008-5472.CAN-05-3082

Hernández-Jiménez, M., Diego, M-L., Enrique, G-R., Adrian, M-S., Ignacio, L., María, D.L., Carlos, G.D. and María, A.M., 2016. Seladin-1/DHCR24 is neuroprotective by associating EAAT2 glutamate transporter to lipid rafts in experimental stroke. Stroke, 47: 206-213. https://doi.org/10.1161/STROKEAHA.115.010810

Johnston, J.D. and Bloch, K., 1957. In vitro conversion of zymosterol and dihydrozymosterol to cholesterol. J. Am. chem. Soc., 79: 1145-1149. https://doi.org/10.1021/ja01562a032

Kandutsch, A.A. and Russell, A.E., 1960. Preputial gland tumor sterols III. A metabolic pathway from lanosterol to cholesterol. J. biol. Chem., 235: 2256-2261. https://doi.org/10.1016/S0021-9258(18)64608-3

Kim, G-H., Edmond, C.P., Sung-Ho, Y., Yeonhee, H., Dong-Gyu, L., Eun-Young, S., Jongsun, J., Young, H. Kim, Kyung-Bok, L. and Ik-Soon, J., 2013. Proteomic and bioinformatic analysis of membrane proteome in type 2 diabetic mouse liver. Proteomics, 13: 1164-1179. https://doi.org/10.1002/pmic.201200210

Komar, A.A., 2007. Silent SNPs: Impact on gene function and phenotype. https://doi.org/10.2217/14622416.8.8.1075

Kuehnle, K., Arames, C., Roland, E.K., Paola, L., Susanna, B., Alessandro, P., Francesca, R., Monica, R., Luka, K. and Frank, L.H., 2008. Prosurvival effect of DHCR24/Seladin-1 in acute and chronic responses to oxidative stress. Mol. Cell Biol., 28: 539-550. https://doi.org/10.1128/MCB.00584-07

Lämsä, R., Helisalmi, S., Hiltunen, M., Herukka, S-K., Tapiola, T., Pirttilä, T., Vepsäläinen, S. and Soininen, H., 2007. The association study between DHCR24 polymorphisms and Alzheimer’s disease. Am. J. med. Genet. B Neurops. Genet., 144: 906-910. https://doi.org/10.1002/ajmg.b.30532

Martiskainen, H., Kaisa, M.A.P., Teemu, N., Mari, T., Mikael, M., Stina, L., Nadine, H., Petra, M., Enni, B. and Hiramani, D., 2017. DHCR24 exerts neuroprotection upon inflammation-induced neuronal death. J. Neuroinflamm., 14: 215. https://doi.org/10.1186/s12974-017-0991-6

Mu, X., Xiaoyan, C., Ranran, L., Qinghe, L., Maiqing, Z., Guiping, Z., Changrong, G., Jie, W., Yaodong, H. and Huanxian, C., 2019. Identification of differentially expressed genes and pathways for abdominal fat deposition in ovariectomized and sham-operated chickens. Genes, 10: 155. https://doi.org/10.3390/genes10020155

Takahashi, T., Gasch, A., Nishizawa, N. and Chua, N.H., 1995. The DIMINUTO gene of Arabidopsis is involved in regulating cell elongation. Genes Dev., 9: 97. https://doi.org/10.1101/gad.9.1.97

Wu, B.J., Kang, C., Sudichhya, S., Kwok, L.O., Philip, J.B. and Kerry-Anne, R., 2013. High-density lipoproteins inhibit vascular endothelial inflammation by increasing 3β-hydroxysteroid-Δ24 reductase expression and inducing heme oxygenase-1. Circ. Res., 112: 278-288. https://doi.org/10.1161/CIRCRESAHA.111.300104

Zhang, F., Xi, N., Liangting, T., Xueqin, R., Sheng, L., Jiafu, W. and Shihui, H., 2018. Identification of candidate genes associated with Xiang pig estrus by genome-wide transcriptome analysis. Int. J. clin. exp. Med., 11: 12079-12087.