Research Article
PROP-1 Gene a Selective Marker of Wool Production in Sheep Breeds of Balochistan Pakistan
Chandni Wajid1, Abdul Hameed Baloch1, Ahmed Nawaz Khosa1*, Hubdar Ali Kaleri2, Nasrullah Bangulzai1, Sarfraz Ali Fazlani1, Haleema Sadia3, Saeeda Kalsoom4, Muhammad Bilawal Arain2, Wassem Ali Vistro2
1Faculty of Veterinary and Animal Sciences, Lasbela University of Agriculture, Water and Marine Sciences, Uthal, Pakistan; 2Faculty of Animal Husbandry and Veterinary Sciences, Sindh Agriculture University Tando Jam Sindh, Pakistan; 3Department of Biotechnology, BUITEMS Quetta Pakistan; 4Department of Biotechnology, Virtual University of Pakistan, Pakistan.
Abstract | PROP1 gene plays a vital role in growth and development of wool production in mammals. The genetic variations in PROP1 gene in the sheep breeds of Pakistan are unknown. This study was conducted to compare wool color and fleece weight and to analyze the PROP1 gene of Balochi, Bibrik, Harnai and Rakhshani sheep breeds of Balochistan. The wool was sheared, its color and fleece weight were observed. The result reveled that wool color and fleece weight were black and white with 1.91 kg, full white, white with black muzzles and limb extremities with 1.83 kg, white gray mix with 1.85 kg, white with black muzzles and limbs extremities with 1.77 kg, for Balochi, Bibrik, Harnai and Rakhshani sheep breeds respectively. For PROP1 gene analysis, the blood sample were collected from the selected sheep breeds and processed for DNA extraction. Primers were designed using Primer 3 software and PCR was performed. PCR products were sequenced and analyzed for observing genetic variation in PROP1 gene of these four sheep breeds of Balochistan. The result for PROP1 gene analysis showed 7 variations including 3 frame shift and 4-point mutations with c.63G>A, c.83G>A, c.94G>T, c.104C>G, c.237G>A, c.432T>C and c.450C>T were observed in all three exons of PROP1 gene of Balochi, Bibrik, Harnai and Rakhshani sheep breed of Balochistan. The phenotypic variation related to wool production traits including the fleece weight and wool color with diverse pigmentation and genetic variations observed in the coding region of the PROP1 gene. This study indicates that the PROP1 gene may be used as a selective marker for the future selection of the sheep breeds for different wool productive traits.
Keywords | Genotypic variation, Phenotypic variation, Sheep, PROP1 gene, Wool trait.
Received | January 21, 2022; Accepted | March 01, 2022; Published | June 01, 2022
*Correspondence | Ahmed Nawaz Khosa, Faculty of Veterinary and Animal Sciences, Lasbela University of Agriculture, Water and Marine Sciences, Uthal, Pakistan; Email: [email protected]
Citation | Wajid C, Baloch AH, Khosa AN, Kaleri HA, Bangulzai N, Fazlani SA, Sadia H, Kalsoom S, Arain MB, Vistro WA (2022). Prop-1 gene a selective marker of wool production in sheep breeds of Balochistan Pakistan. J. Anim. Health Prod. 10(2): 238-244.
DOI | http://dx.doi.org/10.17582/journal.jahp/2022/10.2.238.244
ISSN | 2308-2801
Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Pakistan is the 11th sheep producing country in the world and has well known 28 breeds of sheep. (Anonymous et al., 2013). In Balochistan (Province of Pakistan), some sheep breeds and strains are found with diverse phenotypic characteristics including the production traits i.e., meat, milk and wool. Balochi, Bibrik, Harnai and Rakhshani are well-known sheep breeds of Balochistan; these breeds usually produce coarse wool and this type of wool is usually used for the manufacturing of carpet (Raziq et al., 2009). Wool production of these sheep breeds is low as compared to other sheep breeds of Pakistan. However, wool production can be improved by selecting the animals with high genetic potency. Therefore, it is very important to identify the major genes which have effects on the growth and production of wool.
Homeobox protein prophet of Pit-1 (PROP1) gene is also called pituitary-specific homeodomain factor, PROP1 Human and prophet of Pit1, paired-like homeodomain transcription factor. It controls and offer directions for protein development and other genes respectively. PROP1 is also well known transcription factor due to their mood of action, and this protein is originated in the pituitary gland of the brain. In the pituitary gland this protein helps in the differentiation of various types of the cells (Sornson et al., 1996; Mehta et al., 2008). PROP1 codes a transcription factor (paired-like homeodomain) in the mechanism of pituitary gland. It has dual activations skills for DNA binding, transcription and in sheep it is on chromosomes 5 with 3 exons and 2kb in size having a structure similar to other mammalian’s genes such as the human and pig. It is a positive regulator for growth hormone (GH), prolactin (PRL) and thyroid stimulating hormone (TSH), in mammals (Cohen et al., 1997; Ribeca et al., 2014). GH promotes protein synthesis and the growth of nearly all body tissues as well as having key role in the regulation of carbohydrate metabolism (Carter-Su et al., 2000). Any alteration on this gene may results in absence of hormones GH, PRL, TSH, and PROP-1 (Lan et al., 2009 b). It plays a vital role relating to the growth, reproductive and fiber traits in domestic animals. Growth is a highly orchestrated biological process involving a delicate interplay of different factors including genes (Ekegbu et al., 2019).
Consequently, PROP1 gene can be considered as a marker gene to effect wool production in ovine. This marker substantially contributes to variance of the trait expression in small ruminants and have been increasingly focus in the area of livestock genetics. Such markers should be investigated in Pakistani sheep breeds that would be helpful in the selection of sheep breeds for high wool production. Presently no information about PROP1 gene has been reported in the Pakistani sheep breeds. Therefore, the present study was designed to investigate the genotypic variation in PROP1 gene in different sheep breeds of Balochistan with diverse phenotypic variations including wool, color, yield and fineness.
MATERIALS AND METHODS
The research study was carried out in the Laboratory of Molecular Genetics, Lasbela University of Agriculture, Water and Marine Sciences (LUAWMS), Uthal, Balochistan. The trial conducted according to the guideline of the declaration of Lasbela University of Agriculture, Water and Marine Sciences and all of procedures were approved by the Ministry of Livestock, Government of Balochistan, Islamic Republic of Pakistan.
Animal Selection And Dna Extractions
A total 120 animals of four different sheep breeds (Balochi, Bibrik, Harnai and Rakhshani) of Balochistan (n = 30/breed) were randomly selected for the current research. All selected individuals were healthy and unrelated. Animals were selected from their respective breeds and home tracts by identifying them on the basis of phenotypic characteristics. A total blood samples (n=120) of four sheep breeds of Balochistan were aseptically collected. The 5ml blood sample was collected from jugular vein from each sheep breed by using vacuum tubes with EDTA (ethyline diamine tetra acetic acid) as an anticoagulant. The samples were stored in ice container at -20oC and were brought to laboratory of molecular genetics, Lasbela University of Agriculture, Water and Marine Sciences, Uthal, for further analysis. Phenotypic data including weight of fleece and color of wool were also recorded. Animal’s record was maintained, includes information about the animal age, phenotypic characters, and area where the samples were collected. The age of the animals was detected by physical appearance and observing their teeth using method as describe by (Kumar et al.,1990).
Dna Extractions
DNA was extracted by inorganic method (Sambrook & Russel, 2001). Quantity and quality of the DNA samples were measured by using spectrophotometer (SPUV1100).The ratio of absorbance at 260 nm and 280 nm is used to assess the purity of DNA.
Primers Designing And Optimizations
For the amplification of three exonic region of PROP1 gene the specific primers were designed by using the software (primer 3 software (Rozen & Skaletsky, 2000). Complete PROP1 gene of Ovisaries (KP229296) available on NCBI (http://www.ncbi. nlm.nih.gov. Sequence and product size of the specific primers are given in (Table 1). Primers were optimized for their annealing temperature by gradient PCR in which a range of annealing temperature (64°C to 54°C) was used in thermo cycler. The temperature at which primer showed best results was selected. The subsequent PCR were carried out at optimized annealing temperatures. Polymerase chain reactions were carried out in a 25μL reaction mixture containing, PCR Buffer(5x) 2.5μL, Taq Polymerase 0.5μL, dNTPs 2.5μL, MgCl2 2μL, Primer Forward 1μL, Primer Reverse 1μL, DNA 3μL, Distilled Water 12.5μL. The amplification conditions for primers of the PROP1 gene were as follows: denaturation at 94°C for 5 min; followed by 35 cycles of denaturation at 94°C for 30 sec; annealing at 57°C for 30 sec; and extension at 72°C for 45 sec; with a final extension at 72°C for 10 min, on a Thermocycler. The PCR product was subjected to electrophoresis for detection of amplified DNA.
Table 1: List of the primers used in this study
| Primers | Oligo Name | Sequence | Length | Annealing Temp: | Product size (bp) |
| Exon-1 | Forward | CACCGAGGAGGTCACAGTCT | 20 | 62.5 |
112 |
| Reverse | GTGACCATGGACACAGAAG | 20 | 60.5 | ||
| Exon-2 | Forward | AAGACTTTCTCGTGCCCAAA | 20 | 56.4 | 238 |
| Reverse | ACTCAGCCCTACCGGAATCT | 20 | 60.5 | ||
| Exon-3 | Forward | AGCATGGTTGTAGGGGTGAG | 20 | 60.5 | 340 |
| Reverse | AACCGCAGAGCTAAGCAGAG | 20 | 60.5 |
Table 2: Codon modification of PROP 1 gene in Balochi, Bibrik and Harnai sheep breeds
| Serial No. | Breed | Variation Position | Codon # | Reference Codon | Changed Codon | References Amino acids | Changed amino acids |
| 1 | Bibrik | 63bp | 21 | CTG | CTA | Lysine | Lysine |
| 2 | Balochi | 85bp | 29 | GCT | ACT | Alanine | Aspartic Acid |
| 3 | Bibrik, Balochi and Harnai | 94bp | 32 | GTG | GGT | Valine | Glycine |
| 4 | Harnai | 104bp | 35 | TCG | TCA | Serine | Serine |
| 5 | Balochi, Bibrik | 237bp | 79 | GCG | GCA | Alanine | Alanine |
| 6 |
Bibrik, Harnai |
432bp | 144 | TCT | TCC | Serine | Serine |
| 7 | Harnai | 450bp | 148 | CCC | CCT | Proline |
Proline |
Table 3: Per anum fleece weight, wool color and finesse of different sheep breeds of Balochistan
| Breed Name | Fleece weight | Wool Color | Finesse |
| Balochi | 1.91 | Black and white, brown and white, gray and white, off white and white and sometimes white with black or brown muzzles and limbs extremities | Course wool |
| Bibrak | 1.83 | Full white, white with black muzzle and limbs extremities | Course wool |
| Harnai | 1.85 | White gray mix, white with black and sometimes brown muzzles and limbs extremities | Course Wool |
| Rakhshani | 1.77 | White with black muzzles and limbs extremities | Course Wool |
Dna Sequencing And Analysis
After preparation of PCR products, the samples were sent to Center of Applied and Molecular Biology, University of Punjab Lahore for sequencing of the samples.
Analysis Of Sequencing Data
DNA sequencing data analysis was performed by using the software Bioedit (Hall et al., 1999). The blast2 software was used for the subject sequences to align against the normal sequences. Single nucleotide polymorphism (SNPs) sequences with EU743938. Any change in DNA sequence was observed and confirmed by comparing each sense and antisense.
RESULTS
To investigate the genetic variation in PROP1 gene and their effect on wool production and quality in four different sheep breeds of Balochistan including Balochi, Bibrik, Harnai and Rakhshani. Phenotypic data including weight of fleece and color of wool were also recorded. DNA samples were extracted from the collected blood samples and checked for quantification and quality analysis by gel electrophoresis (1%) (Figure 1).
The exons 1-3 of the PROP1 gene were amplified by using specific primers (Figure 2). Amplified PCR products were sequenced commercially.
Sequencing Results
The sequencing result revealed that 7 variations including 3 frame shift mutations and 4-point mutations were observed in all four sheep breeds of Balochistan. In exon-1 three variations were reported including c.63G>A (insertion of A, A at 63 and 64 nucleotide positions) a frame shift mutation (Figure 3), c.83G>A (pA29D) a missense heterozygous variation (Figure 4), and c.94G>T (insertion of G, G at nucleotide position 94,95) a frame shift mutation (Figure 5).
In exon 2, two variations were observed including c.104C>G and an insertion of A at 104 nucleotide position resulting a frame shift mutation (Figure 6) and c.237G>A (p.A79A) heterozygous silent variation (Figure 7).
In exon 3, two variations including c.432T>C (p.S144S) homozygous silent variation (Figure 8) and c.450 C>T (p.P148P) heterozygous silent variation (Figure 9) were reported.
When subject sequences were compared with the control sequence (Accession No. KP228775.1Ovisaries). Variations reported in Balochi breed 85bp G>A, whereas GCT/ACT which coded Alanine into Aspartic acid on 29th codon, in 94bpG>T where GTG/GGT which coded Valine into Glycine on 32nd codon and 237bpG>A where GCG/GCA which coded same amino acid Alanine on 79th codon showed in Table 2.
In Bibrik breed 63bp G>A where CTG/CTA which coded same amino acid Lysine on 21st codon, on 94bp G>T where GTG/GGT which coded Valine into Glycine on 32nd codon, on 237bp G>A where GCG/GCA which coded same amino acid Alanine on 79th codon, on 432bp T>C where TCT>TCC which coded same amino acid Serine on 144th codon.
In Harnai breed 94bp G>T where GTG/GGT which coded Valine into Glycine on 32nd codon, on 104bp C>G where TCG/TCA which coded same amino acid Serine on 35th codon, on 432bp T>C where TCT>TCC which coded same amino acid Serine on 144th codon, on 540bp C>T where CCC/CCT which coded same amino acid Proline on 148th codon. In Rakhshani sheep breed on 540bp C>T where CCC/CCT which coded same amino acid Proline on 148th codon.
Phenotypic Variations
In this study phenotypic parameters including fleece weight, wool color, wool yield and finesse were also investigated.
Weight And Color Of Fleece
The average weight of fleece in animals per anum was recorded 1.91 kg, 1.83 kg, 1.85kg, 1.77 kg in Balochi, Bibrik, Harnai and Rakhshani sheep breeds of Balochistan respectively (Table 3).
The color of wool in Balochi sheep breed was observed in diverse variations including black and white, brown and white, gray and white, off white and white and sometimes white with black or brown muzzles and limbs extremities. In Bibrik the color of wool was observed as full white, white with black muzzle and limbs extremities. In Harnai breed the color of wool was observed as white gray mix, white with black and sometimes brown muzzles and limbs extremities whereas in Rakhshani sheep breed the color of wool was observed white with black muzzles and limbs extremities.
DISCUSSION
PROP1 gene consisting of 3 exons expressed in pituitary gland, play a vital role in growth and development in mammals (Nasonkin et al., 2004). It has been reported that this gene is associated with wool production trait and considered to be a candidate gene for selection of breeds of wool production (Zeng et al., 2011). In present study PROP1 gene was investigated to analyze the variations in it and their association to the wool production trait in the sheep breeds. The sequencing results of PROP1 gene revealed 7 variations including 3 frame shift mutations and 4-point mutations. In exon-1 three variations were reported including c63G>A (insertion of A, A at 63 and 64 nucleotide positions) a frame shit mutation, c.83G>A (p.A29D) a missense heterozygous variation and c.94G>T (insertion of G, G at nucleotide position 94,95) a frame shift mutation. In exon 2, 2 variations were observed including c.104C>G and an insertion of A at 104 nucleotide position resulting a frame shift mutation and c.237G>A (p.A79A) heterozygous silent variation. In exon 3, 2 variations including c.432T>C (p.S144S) homozygous silent variation and c.450C>T (p.P148P) heterozygous silent variation were reported. Studies suggested that PROP1 gene play a vital role in determination of animal reproduction, growth and development (Andersen et al., 1995; Sornson et al., 1996; Gong et al., 2005). Polypeptide hormone prolactin (PRL) is a lactotroph due to its ubiquitous distribution beside other functions, also influence the growth of hair in domestic animals (Foitzik et al., 2009; Jung et al., 2021). Association of PROP1 gene variation with wool diameter and suggest that PROP1 gene could be used as molecular marker for sheep breeding and genetics through marker-assisted selection (Zeng et al., 2011). Association of PROP1 gene polymorphisms with growth traits in sheep also reported by (Ekegbu et al., 2019). A study was performed on Loci association with wool production traits of Chinese Merino sheep (JunKen type) genotyped with 50 K single nucleotide. Twenty-Eight genome-wide significant SNPs detected for fiber diameter, fiber diameter coefficient of variation, fineness dispersion, and crimp trait and concluded that these novel SNP markers can be used for exploring the genetic control of wool traits in sheep (Zhipeng et al., 2014). In another study PROP1 gene mutation identified in the exon 1–3 and its association with wool traits in 345 Chinese Merino sheep. They reported ten novel SNPs within the sheep PROP1 gene, namely, AY533708: g.45A [G resulting in Glu15Glu, g.1198A [G, .1341G [C resulting in Arg63Ser, g.1389G [A resulting in Ala79Ala, g.1402C [T resulting in Leu84Leu, g.1424A [G resulting in Asn91Ser, g.1522C[T, g.1556A [T, g.1574T [C, g.2430C [G. In addition, association analysis showed that three genotypes of P4 fragment were significantly associated with fiber diameter in the analyzed population (P = 0.044). They concluded that polymorphisms of the PROP1 gene could be a useful molecular marker for sheep breeding and genetics through marker-assisted selection (MAS) (Zeng et al., 2011; Indraswari et al., 2021).
The results in present study revealed the phenotypic data regarding the wool production, the average fleece weight in breeds per anum was1.91 kg in Balochi, 1.83 kg in Bibrik, 1.85 in Harnai and 1.77 in Rakhshani respectively. The color of wool in Balochi sheep breeds was observed with diverse variations including black and white, brown and white, gray and white, off white and white and sometimes white with black or brown muzzles and limbs extremities. In Bibrik the color of wool was observed as full white, white with black muzzle and limbs extremities. In Harnai breed the color of wool was observed as white gray mix, white with black and sometimes brown muzzles and limbs extremities, whereas in Rakhshani sheep breed the color of wool was observed white with black muzzles and limbs extremities.
Whereas a study was conducted and reported white black and mixed color in Balochi and Rakhshani Breeds, white in Bibrik and white and mixed in Harnai breeds. The average wool production in Balochi, Bibrik, Harnai and Rakhshani 2.4, 1.8,1.8 and 1.3 kg respectively (Munir et al., 2010). Wool production performance of Harnai sheep breed of Balochistan was investigated and reported that overall mean yield of white and mixed wool from an adult sheep was 1.75 and 0.10 kg from young sheep was 1.58 and 0.10 kg respectively (Bukhari et al., 2016). Breed, management and environmental factors also influencing on wool production (Khan et al., 2012).
Environmental factors’ influence on the wool production as well as the wool quality parameters of Mengali sheep. Season of shearing and location of flocks had significant effects (P<0.05) on fleece weight in different years. Sex and type of birth of animal were not statistically different (P>0.05) for fleece traits. Mengali wool characteristics are best suited for carpet manufacturing but color would be a limitation. The findings suggested that Mengali sheep wool production and quality can be improved through selection, management, and favorable environment (Tariq et al., 2013). Some other studies carried out in other parts of the world also reported spot pigmentations with white wool color (Sponenberg et al.,1988; Koseniuk et al., 2018).
CONCLUSION
The results of the current study indicate that sheep breeds of Balochistan having diverse genetic and phenotypic characteristic related to the different productive traits. The sequencing results of PROP1 gene revealed 7 variations including 3 frame shift mutations and 4-point mutations. Genetic variations in PROP1 gene suggest that this gene can be used as a suitable genetic marker for the future selection of the farm animals for different productive traits.
ACKNOWLEDGMENT
The Authors are thankful to Higher Education Commission of Pakistan for providing funding for this study through PSDP project titled” Establishment of National Center for Livestock Breeding, Genetics and Genomics at Lasbela University of Agriculture, Water and Marine Sciences Uthal”.
AUTHORS CONTRIBUTION
Chandni Wajid and Abdul Hameed Baloch conceived and designed the project. Ahmed Nawaz Khosa wrote the paper, Hubdar Ali Kaleri and Nasrullah Bangulzai performed the experiments, Sarfaraz Ali Fazlani, Haleema Sadia and Saeeda kalsoom analyzed the data, Muhammad Bilawal Arain and Waseem Ali Vistro revised the paper. All authors read and approved the final manuscript.
Conflict of Interest
The authors declare that they have no known competing financial interests or personal conflicts.
REFERENCES
Andersen B, Pearse II RV, Jenne K, Sornson M, Lin SC, Bartke A, Rosenfeld MG (1995). The Ames dwarf gene is required for Pit-1 gene activation. Dev. biol. 172(2): 495-503. https://doi.org/10.1006/dbio.1995.8040
Anonymous (2013). Economic Survey of Pakistan. Economic Advisers Wing, Finance Division, Government of Pakistan, Islamabad.
Bukhari FA, Ahmad S, Islam M, Asmat TM, Rafique M, Hameed T, Ali I (2016). Wool production performance of Harnai sheep from Asghara valley, Sinjavi, District Ziarat. Pure and Appl. Biol. 5(4): 1. https://doi.org/10.19045/bspab.2016.50138
Carter SC, Rui L, Herrington J (2000). Role of the tyrosine kinase JAK2 in signal transduction by growth hormone. Pediatr. Nephrol. 14: 550–557. https://doi.org/10.1007/s004670000366
Cohen GM (1997). Caspases: the executioners of apoptosis. Biochem. J. 326(1): 1-16. https://doi.org/10.1042/bj3260001
Ekegbu UJ, Burrows L, Amirpour NH, Zhou H, Hickford JG (2019). Gene polymorphisms in PROP1 associated with growth traits in sheep. Gene. 683: 41-46. https://doi.org/10.1016/j.gene.2018.10.024
Foitzik K, Langan EA, Paus R (2009). Prolactin and the skin: a dermatological perspective on an ancient pleiotropic peptide hormone. J. Invest. Dermatol. 129(5): 1071-1087. https://doi.org/10.1038/jid.2008.348
Gong ZM, Chen LY, Fang XK, Yu PC, Hua XG (2005). Preliminary comparison of Prop-1 gene between Meishan pig and Xiang pig. Chinese J. Anim. Sci. 41(11): 14.
Hall TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Paper presented at the Nucleic acids symposium series.
Indraswari A, Haryanto A, Suardana IW, Widiasih DA (2021). Isolation and detection of four major virulence genes in O157: H7 and non-O157 E. coli from beef at Yogyakarta Special Province, Indonesia. J. Anim. Health Prod. 9(4): 371-379. onesia. J. Anim. Health Prod. 9(4): 371-379. https://doi.org/10.17582/journal.jahp/2021/9.4.371.379
Jung KS, Choi YD, Kim SH (2021). Differences in melanogenesis-related gene expression between korean brindle cattle and Korean native cattle for coat color decisions. J. Anim. Health Prod. 9(3): 321-330. https://doi.org/10.17582/journal.jahp/2021/9.3.321.330
Khan MJ, Abbas A, Ayaz M, Naeem M, Akhter MS, Soomro MH (2012). Factors affecting wool quality and quantity in sheep. Afr. J. Biotechnol. 11(73): 13761-13766. https://doi.org/10.5897/AJBX11.064
Koseniuk A, Ropka MK, Rubis D, Smołucha G (2018). Genetic background of coat colour in sheep. Archiv. Tierz. 61(2): 173. https://doi.org/10.5194/aab-61-173-2018.
Kumar CL, Sridhar M (1990). Estimation of the age of an individual based on times of eruption of permanent teeth. Forensic Sci. Inter. 48(1): 1-7. https://doi.org/10.1016/0379-0738(90)90266-2
Lan XY, Shu JH, Chen H, Pan CY, Leu CZ, Wang X, Lui SQ, Zhang YB (2009) b. A Pstl Polymorphisim at 3’UTR of Goat POUIFI gene and its effect on Cashmere Production. Mol. Biol. Rep. 36: 1371-1374. https://doi.org/10.1007/s11033-008-9322-4
Munir M, Shah N, Aujla K (2010). Production of wool and hair in highland Balochistan, Pakistan. Pak. J. Agri., Agril. Engg., Vet. Sci, 26(1), 75-87.
Mehta, Ameeta, Mehul TD (2008). Developmental disorders of the hypothalamus and pituitary gland associated with congenital hypopituitarism. Best Pract. Res. Clin. Endocrinol. Metab. 22(1): 191-206. https://doi.org/10.1016/j.beem.2007.07.007
Nasonkin IO, Ward RD, Raetzman LT, Seasholtz AF, Saunders TL, Gillespie PJ, Camper SA (2004). Pituitary hypoplasia and respiratory distress syndrome in Prop1 knockout mice. Hum. Mol. Genet. 13(22): 2727-2735. https://doi.org/10.1093/hmg/ddh311
Raziq A (2009). Assessing the potential of the indigenous livestock breeds of Balochistan. Drynet: A science and technology expertise. Project study report, funded by the European Union and supported by The Global Mechanism.
Ribeca C, Bonfatti V, Cecchinato A, Albera A, Gallo L, Carnier P (2014). Effect of polymorphisms in candidate genes on carcass and meat quality traits in double muscled Piemontese cattle. Meat Sci. 96(3): 1376-1383. https://doi.org/10.1016/j.meatsci.2013.11.028
Rozen S, Skaletsky H (2000). Primer3 on the WWW for general users and for biologist programmers Bioinformatics methods and protocols (pp. 365-386). https://doi.org/10.1385/1-59259-192-2:365
Sambrook J, Russel D (2001). Extraction and purification of plasmid; screening of bacterial colonies by hybridization. Molecular Cloning: a laboratory manual, 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.
Sornson MW, Wu W, Dasen, JS, Flynn SE, Norman DJ, Connell MAP
(1996). Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature. 384(6607): 327-333. https://doi.org/10.1038/384327a0
Sponenberg DP, Ito S, Wakamatsu K, Eng LA (1988). Pigment types in sheep, goats, and llamas. Pigment Cell Res. 1(6), 414-418. https://doi.org/10.1111/j.1600-0749.1988.tb00145.x
Tariq M, Bajwa M, Javed K, Rafeeq M, Awan M, Rashid N, Bukhari F (2013). Assessment of wool characteristics of Mengali sheep of Balochistan. J. Anim. Pl. Sci 23:721-726.
Zeng XC, Chen HY, Jia B, Zhao ZS, Hui WQ, Wang ZB, Du YC (2011). Identification of SNPs within the sheep PROP1 gene and their effects on wool traits. Mol. Biol. Rep. 38(4): 2723-2728. https://doi.org/10.1007/s11033-010-0416-4
Zhipeng W, Zhang H, Yang H, Wang S, Rong E, Pei W, Li H, Wang N (2014). Genome-Wide Association Study for Wool Production Traits in a Chinese Merino Sheep Population PLOS ONE | www.plosone.org| Vol. 9(9) e107101. https://doi.org/10.1371/journal.pone.0107101