Prevalence of Borrelia burgdorferi Sensu Lato in Pet Dogs and Associated Ticks in Pakistan

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

1Department of Veterinary Medicine, University of Veterinary and Animal Sciences, Lahore, Pakistan

2Department of Biochemistry, University of Health Sciences, Lahore, Pakistan

3Department of Epidemiology and Public Health, University of Veterinary and Animal Sciences, Lahore, Pakistan

ABSTRACT

Borrelia burgdorferi sensu lato is the etiological agent of Lyme disease. We investigated presence of B. burgdorferi s.l. in 600 pet dogs and 391 tick pools using PCR assay and sequencing in the Lahore City Metropolitan Area, Pakistan. Potential association of various risk factors with occurrence of Lyme borreliosis was also estimated via univariate and multivariate logistic regression. From each dog, blood and tick samples were collected and then tick species were identified. DNA extraction was followed by detection of 16S rRNA signature gene using B. burgdorferi s.l. specific primers through conventional PCR. We found that 4.3% dogs and 8.9% tick pools were positive for B. burgdorferi s.l. Rhipicephalus sanguineus (86.5%) was the most abundant tick species. 57.1% I. gibbosus and 8.4% R. sanguineus pools tested positive for B. burgdorferi s.l. Phylogenetically, our sequences clustered with B. burgdorferi sensu stricto, B. bavariensis, B. garinii, and B. bissettii sequences sourced from different hosts worldwide. Sequences showed 40.2%-99.1% sequences identity among them and 39%–98.3% with previously reported sequences on NCBI GenBank. Our sequences were submitted in NCBI GenBank under accession numbers MW547399-MW547405. Four animal-related: age (p=0.03), weight (p<0.05), sex (p=0.03), and breed (p<0.05), while three management-related risk factors: type of housing (p<0.05), tick infestation (p=0.007), and travel history (p=0.003) were significantly (p < 0.05) associated with occurrence of Lyme borreliosis. This is the first report on the presence of B. burgdorferi s.l. in Pakistan indicating the need for more comprehensive molecular surveys to estimate its prevalence in wider geographical areas and additional animal species as well as human population.


Article Information

Received 27 August 2021

Revised 03 October 2021

Accepted 15 October 2021

Available online 09 February 2022

(early access)

Published 19 October 2022

Authors’ Contribution

AZD conceptualization, methodology. MU visualization, investigation, data curation, writing- original draft preparation. AZD and NM supervision. MHS software, validation. MC writing, reviewing and editing.

Key words

Borrelia burgdorferi sensu lato, Dogs, Ticks, PCR, Risk factor, Phylogenetic analyses

DOI: https://dx.doi.org/10.17582/journal.pjz/20210827160812

* Corresponding author: [email protected], [email protected]

0030-9923/2023/0001-93 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Lyme borreliosis (Lb) is an emerging vector borne disease (Jánová, 2019). A spirochete, Borrelia burgdorferi sensu leto, is its causative agent. There are more than 52 species of Borrelia (Cutler et al., 2017) but currently 22 species are classified under B. burgdorferi s.l. and the most important of these 22 are B. burgdorferi sensu stricto, B. afzelii, Bb mayonii and B. garinii (Littman et al., 2018; Springer et al., 2020).

The main vectors of Borrelia sp. are three-host tick Ixodes scapularis in Mid-Atlantic, Northeastern, and upper Midwestern states (Herrin et al., 2017), I. ricinus in Europe, and I. persulcatus in Asia (Zintl et al., 2020). Ixodes are once considered prevalent ticks of temperate zone but their distribution and density have expanded over the years due to climate change and globalization (Bouchard et al., 2015). Besides, other tick species including Rhipicephalus sanguinus, Hyalomma anatolicum, I. persulcatus, I. granulatus, I. sinesis, and H. longicornis, Hy. asiaticum, H. punctata, D. nuttalli, D. marginatus and I. persulcatus, Amblyomma americanum have also been reported to harbor B. burgdorferi s.l. (Geurden et al., 2018; James et al., 2001; Livanova et al., 2018; Yu et al., 2016, 2017). Consequently, Lyme disease is becoming endemic in those areas like China, Japan, Thailand, Egypt which are previously not known to have this disease (Elhelw et al., 2021; Sthitmatee et al., 2016; Wang et al., 2019).

Dogs are the most common pet animals with over 470 million pet dogs in 2018 throughout the world E. Bedford, ‘Global Dog and Cat Pet Population 2018’, Statista: Consumer Goods and FMCG> Pets and Animal Supplies, 2020 <https://www.statista.com/statistics/1044386/dog-and-cat-pet-population-worldwide/> [accessed 2 February 2021]. In Pakistan, pet lovers keep more than 0.2 million pet dogs as per a recent estimate. Dogs are highly susceptible to Lb and the most common clinical picture attributed to canine Lb includes history of tick infestation, anorexia, lethargy, fever, arthritis, nephritis, and neurological signs. However, most of the seropositive dogs show no clinical sign but they may act as carrier (Littman et al., 2018). Since pet dogs maintain a close contact with their owners, any exposure of these dogs to B. burgdorferi s.l or its vectors reflects corresponding risk to their owners. This is why, many previous studies used dogs and ticks as sentinels to assess the risk of Lyme disease in the corresponding human population (Liu et al., 2019).

Of the various tests prevalent for the diagnosis of Lyme disease in dogs such as ELISA and indirect fluorescence antibody (IFA), PCR is most sensitive and specific assay to detect different species of B. burgdorferi s.l. complex and it can also distinguish between active infection and past exposure (Díaz-Sánchez et al., 2020). Besides, its results can be subsequently used to characterize different strains, study their origin, and find out genetic modification. Above all, it is equally effective for screening of B. burgdorferi s.l. in dogs as well as ticks and many researchers have used it (Kocoń et al., 2020; Michalski et al., 2020).

To the best of our knowledge, previously no work has been done to diagnose and report B. burgdorferi s.l. in dogs and their ticks in Pakistan, despite evidence of Lb from neighboring country China as before as 1985 (Yu et al., 2016). Moreover, Pakistan regularly imports dogs from Europe and America where Lb is endemic. The current study was designed to investigate status of B. burgdorferi s.l. This study provides the first evidence of B. burgdorferi s.l. presence in Pakistan on the basis of PCR assay and sequencing. The nucleotide sequences of 16S rRNA gene obtained from positive DNAs were analyzed. The study also explored the distribution of tick species on dogs and explained potential association of various hypothesized risk factors with occurrence of Lb.

MATERIALS AND METHODS

Ethics statement

The study followed all essential ethical guidelines and recommendations of ARRIVE. Blood samples were collected after seeking consent from pet owners. Furthermore, Institutional Review Committee for Biomedical Research, University of Veterinary and Animal Sciences, Lahore approved the sample collection methodology (Letter number DR/894; dated 22/08/2017).

Study area

The study was carried out in Lahore district, Punjab. Lahore (31.5204° N and 74.3587° E.) is provincial capital of Punjab with a population of about 130 million (average rainfall 628.8mm and average temperature is 24.1 °C). Its metropolitan area is particularly important where expatriates bring their pet dogs with them and urban elite likes to keep pure breeds of dogs imported from Europe and America where Lyme disease is endemic. Twelve veterinary clinics, out of >100 veterinary clinics, were contacted for participation in the study.

Study design

Dogs with a history of tick infestation, anorexia, travel history, arthritis, shifting lameness, lymphadenopathy, renal issues, or neurological complications were included in the study. Blood and tick samples from 600 dogs were collected. Tick samples were collected in a sterile tube containing ethanol. Blood samples were collected from jugular vein aseptically, and stored until further processing.

Data related to hypothesized risk factors were collected in a structured questionnaire. The study lasted more than three years; from 1st May 2018 to 30th June 2021.

Genomic DNA extraction from blood and tick samples

The genomic DNA from blood and tick samples was extracted using Thermo Scientific GeneJET® Genomic DNA purification kit (catalogue number K0721) following the instructions of manufacturer. Ticks were first identified under an Olympus SZX16 stereoscopic microscope. Usually, one fully engorged tick from each dog was processed for DNA extraction. However, when multiple ticks were collected from a single dog, they were pooled and examined as single specimen. The tick specimen was grinded in liquid nitrogen using a mortar and pestle. 180uL digestion and 20uL Proteinase K solutions were added in the resultant mixture and mixed thoroughly through pipetting and vortexing. Then completely lysed tissue material was incubated for whole night in shacking incubator at 56°C. Subsequently, 20uL RNase solution, 200uL lysis solution, and 400uL 50% ethanol were added following guidelines given by the manufacturer. Finally, after addition of wash buffers and afterwards elution buffer fulfilling centrifugation and vortexing conditions, genomic DNA was obtained which was stored at -20°C until further processing. The same procedure was used for DNA extraction from blood samples.

Molecular diagnosis of Borrelia burgdorferi sensu lato

We used a highly specific primer set which targets 16S rRNA signature gene of all species of B. burgdorferi s.l. The forward and reverse orientations of the primer are 5’ATGCACACTTGGTGTTAACTA 3’ and 5’ GACTTATCACCGGCAGTCTTA 3’, respectively and it generated DNA fragment of 357 bases through conventional PCR (Marconi and Garon, 1992).

Thermo ScientificTM DreamTaq Green PCR Master Mix (2X) (catalog number K1081) was used for performing PCR. Each reaction mixture (25μL) was prepared by adding Master Mix 12.5μL, forward primer 1.25μL, and reverse primer 1.25μL. The volumes of DNA template and water were adjusted according to concentration of DNA in each sample. Except annealing temperature, different stages and conditions for PCR were same as suggested by manufacturer of master mix. Briefly, initial denaturation and denaturation at 95°C for 2 min and 30 seconds, while extension and final extension at 72°C each for 1 min and 12 min, respectively. Number of cycles for denaturation, annealing, and extension were set at 33. Prior to our sample analysis, optimization and validation of assay was accomplished using AMPLIRUN® BORRELIA BURGDORFERI DNA CONTROL (catalogue number MBC076).

The obtained PCR products were further evaluated using agarose gel electrophoresis (2%) with a 100 bp ladder (Invitrogen Co. Carlsbad, CA, USA). Then gel purification of amplified DNA fragments of 357bp was carried out with Wizard SV Gel and PCR Clean-Up System (Promega, Co., Madison, WI, USA). The final gel purified DNA products were processed for sequencing on 3100 DNA analyzer (Applied Biosystems) both in forward and reverse directions.

The unique 16S rRNA sequences, which were used in the phylogenetic analyses have been submitted to NCBI GenBank and assigned GenBank accession numbers MW547399-MW547405.

Phylogenetic analyses

The final nucleotide data of this study was assembled, edited, and aligned using BioEdit version 7.2.5 and only one sequence was selected from those, which were 100 alike. Using the same software, the final sequence data was phylogenetically compared with various nucleotide sequences, originating from different geographical regions and hosts, reported on GenBank. To infer evolutionary history, Maximum Likelihood (ML) method and Tamura-Nei model were used (Tamura and Nei, 1993). Phylogenetic tree centered on 16S rRNA was constructed and 1000 replications of bootstrap were used. Branches corresponding to partitions reproduced in less than 50 percent bootstrap replicates were collapsed. MEGA version X was used for this evolutionary analysis (Kumar et al., 2016). The same consensus sequences were used to calculate the percent identities.

Statistical analysis

The data was compiled into Microsoft Excel spreadsheets and validated using Epi Info™ software. The data was statistically analyzed using Minitab® 17.1.0 or GraphPad Prism® version 8.0 or SPSS version 20.0. Two statistical models were used to analyze association of risk factors with occurrence of Lb. In model 1, univariable exact logistic regression was used for estimating association of animal associated risk factors. In this model, p value was calculated using score method. Multivariate logistic regression was not possible owing to small positive sample size in each variable category. In model 2, firstly univariate mixed logistic regression test was used to determine the association of management-related risk factors with occurrence of borreliosis in dogs. All variables which had p values equal to or less than 0.2 were dropped and remaining were analyzed as explanatory variables using binary logistic regression. Backward elimination method was used to include variables in the model.

RESULTS

Distribution of ticks

Overall, 887 ticks were collected from 369 dogs. The most abundant tick species was R. sanguineus (86.5%; 95% CI = 84.06-88.57) followed Hy. anatolicum anatolicum (4.4%; 95% CI = 3.23-5.95), and D. reticulatus (1.6%; 95% CI = 0.94-2.63), whereas the least abundant species of ticks was H. punctata with only 9 ticks (1%; 95% CI = 0.54-1.92) identified according to keys (Keirans and Clifford, 1978; Keirans and Litwak, 1989). On average, 69 tick samples were collected from each clinic. The number of ticks infesting a dog was between 1 > 50 and 94.3% dogs were infested with a single type of ticks. The most favorable predilection site of ticks was inner side of hindleg with 430 ticks (48.5%; 95% CI = 45.2-51.77) followed by head, tail, and other body parts of the dogs as described in Table I. Tick collection also varied with the season and the most of the ticks were collected in summer season (56%; 95% CI = 52.75-59.27) followed by autumn and spring seasons while the least number of ticks (n=55) were collected in winter season. Out of 887 ticks, 783 were females, 46 nymphs while the rest were males (Table I). Most of these ticks were partially or fully engorged and 166 were unfed. Excluding presumptive repetitive sampling, partially and fully engorged female ticks and nymphs were pooled for subsequent analyses by DNA extraction and PCR.

 

Table I. Pertinent information about distribution of ticks, their species, life stages, seasonal recovery, and engorgement status.

Category

Percentage (number of samples/total)

95% CI

Species (n=829)

Rhipicephalus sanguineus

86.5% (767/887)

84.06-88.57

Haemaphysalis punctata

1% (09/887)

0.54-1.92

Hyalomma anatolicum anatolicum

4.4% (39/887)

3.23-5.95

Dermacentor reticulatus

1.6% (14/887)

0.94-2.63

Ixodes gibbosus

6.5% (58/887)

5.09-8.4

Predilection site (n=887)

Head

22.3% (198/887)

19.71-25.18

Tail

15.8% (140/887)

13.53-18.33

Inner side of hindleg

48.5% (430/887)

45.2-51.77

Other parts of body

13.4% (119/887)

11.33-15.82

Season (n=887)

Winter

6.2% (55/887)

4.79-7.98

Spring

14.5% (129/887)

12.38-17.01

Summer

56% (497/887)

52.75-59.27

Autumn

23.4% (208/887)

20.78-26.25

Life stage of ticks (n=887)

Male

6.5% (58/887)

5.09-8.36

Females

88.3% (783/887)

85.99-90.23

Nymph

5.2% (46/887)

3.91-6.85

Larvae

-

-

Engorgement status of (n=887)

Partially engorged

55% (488/887)

51.73-58.26

Fully engorged

20% (177/887)

17.46-22.71

Unfed

18.7% (166/887)

16.29-21.41

 

Molecular detection of Borrelia burgdorferi sensu lato

We calculated the molecular prevalence of B. burgdorferi s.l. using PCR assay. 16S rRNA gene was targeted in PCR and results showed that 4.3% dogs and 8.9% tick pools were positive for B. burgdorferi s.l. (Table II). Among different tick species, I. gibbosus were 57.1% positive for B. burgdorferi s.l. followed by R. sanguineus, Hy. A. anatolicum, and D. reticulatus while we found no H. punctata positive for B. burgdorferi s.l. All of these ticks were adult females but no nymph was found positive for Lb. Breed wise positive percentage was also calculated and we found that bulldog had the highest positive percentage (13.4%; 95% CI = 7.66-22.44) while Spaniel and American Pit Bull Terrier had no cases (0%; 95% CI = 0.00-10.42 and 0%; 95% CI = 0.00-24.25) of B. burgdorferi s.l. Figure 1 shows positive cases of Lb in dogs.

 

Table II. Descriptive statistics and results of univariable exact logistic regression analyses vis-à-vis animal-related risk factors significantly associated with occurrence of lyme borreliosis in dogs.

Predictor variables and their categories

Positive cases

(%)

ODD ratio

(CIa 95%)

p valuec

0.03b

<1 Y (Puppy)

211/4(1.8)

Referent

1-7 Y (Adult)

231/16(6.9)

3.9 (1.25 to 10.74)

0.01

>7 Y (Senior)

152/6(3.9)

2.1 (0.56 to 6.76)

0.2

<0.0001

Small (<10 Kg)

61/1(1.6)

Referent

Medium (10-30 Kg)

416/7(1.7)

1.03 (0.17 to 11.75)

0.9

Large (>30 Kg)

123/18(14.63)

10.3 (1.70 to 109.4)

0.01

Male

293/19(6.09)

2.6 (1.08 to 6.66)

0.03

Female

281/7(2.4)

Referent

<0.0001

German shepherd

191/2(1.03)

1.7 (0.19 to 24.42)

0.6

Greyhound

34/7(17.1)

32.94 (5.48 to 372.6)

<0.0001

Labrador

160/1(0.6)

Referent

Bulldog

71/11(13.4)

24.97 (4.25 to 26)

<0.0001

Rottweiler

19/2(9.5)

4.5 (0.51 to 65.65)

0.2

Spaniel

0(0.00)

-

-

American pit bull terrier

0(0.00)

-

-

Cross bred

101/2(1.9)

3.2 (0.36 to 46.16)

0.3

Others

56/1(1.79)

2.9 (0.15 to 55.55)

0.4

 

a 95% Confidence Interval; b Over-all significance for variables with >2 categories; c Significant p value (<0.05) is bold.

 

Association of animal-related risk factors with occurrence of Lb

Using the subset of 600 dogs, univariate exact logistic regression identified four animal related risk factors: Age, dog weight, sex, and breed, as significantly (p < 0.05) associated with the occurrence of Lb. The adult dogs were at significantly (p = 0.01) greater odds of carrying Lb while there was no significant (p = 0.2) difference in the odds observed between senior dogs and puppies. Similarly, the odds of having Lb was 10.3 times higher in heavy dogs (>30kg) than in light-weight dogs (<10kg), whereas the odds of testing positive for Lb was not significant (p = 0.9) in medium dogs. Likewise, male dogs (6.09%) had 2.6 times greater odds of suffering from Lb than female dogs (2.4%). Lastly, the occurrence of Lb was significantly (p < 0.05) associated with dog breeds. Labrador had the lowest percentage (0.6%) of Lb and was used as a reference breed. The results showed that the odds of carrying Lb were 32.94, 24.9, 4.5, 3.2, 1.7 in greyhound, bulldog, rottweiler, crossbred, and German shepherd, respectively (These results are presented in Table II).

 

Association of management-related risk factors with occurrence of Lb

Results from univariate mixed logistic regression were compiled. The model identified that type of housing, tick infestation, acaricide usage, and travel history were significantly (p < 0.05) associated with the occurrence of Lb. Nevertheless, the predictors with p values ≥ 0.2 were further processed in the final binomial regression model with a stepwise backward elimination procedure to test their association with responses. However, the high value of variance inflation factor (VIF) for acaricide usage data showed multicollinearity and was, therefore, excluded from the final model. The remaining data adequately fitted the model (Hosmer and Lemeshow Test = 1.000) and the value of variance inflation factor (VIF = 1.00) confirmed the absence of multicollinearity. The final binomial logistic regression model was statistically significant (χ2 = 35.39; p = 0.000) and it explained 56.6% (R-squared) variance in Borrelia infection. The model confirmed that keeping dogs outside the house was significantly (p = 0.000) associated with increased likelihood of carrying Lb. Likewise, the presence of ticks and travel history within last 14 days were also significantly (p < 0.05) associated with increased likelihood of suffering from Lb with odds of 3.8178 and 3.6471, respectively (Table III).

 

Table III. Association of management related risk factors with occurrence of Lb using multivariate binominal logistic regression.

Predictor variables

Response (Frequency)

Positive cases (%)

ODD ratio (CIa 95%)

p value

Type of housing (n=591)

Indoor (377)

6(1.6)

Referent

0.000b

Outdoor (214)

20(9.8)

0.146 (0.057, 0.374)

Tick infestation (n=600)

Yes (369)

22(6)

3.817 (1.272-11.452)

0.007

No (231)

4(1.7)

Referent

Travel history within last 7 days (n=582)

Yes (270)

19(7)

3.647 (1.478-8.994)

0.003

No (312)

7(2.2)

Referent

 

a 95% confidence interval; b p values less than 0.05 are bold.

 

Phylogeny of isolates by maximum likelihood method

Phylogeny of our isolates from dog blood and tick was inferred using 16S rRNA sequences of B. burgdorferi s.l. reported on NCBI gene bank. BLAST search of our sequences generated different results and all top hits with maximum percentage identity were selected for investigating phylogeny at nucleotide level. Evolutionary tree was constructed using 20 nucleotide sequences. The percentage of replicate trees in which related sequences clustered together in 1000 bootstrap replications are displayed next to the branches (Felsenstein, 1985). Based on Neighbor-Join and BioNJ algorithms, initial trees for the investigation were attained using Maximum Composite Likelihood method followed by selection of the topology with superior log likelihood value. A sequence of B. turicatae (AY93460.1), which is a member of relapsing fever borrelia, was used as outer group. The final tree branched into two groups and three main clades, with bootstrap support varied from 52% to 100% (Fig. 2). Overall, divergence among our sequences varied between 0.9% and 59.8%. Sequences MW547400 and MW547404 clustered in sister clades as both shared 99.1% homology. Isolates MW547399 and MW547402 were 97.4%-98.3% similar to MW547400 and MW547404 and all of these clustered in the same clade with 52 % bootstrap consensus. However, isolate MW547399 shared 98.8% similarity with human isolates from Germany CP028872.1, MW547400 and MW547402 isolates displayed 97.1% and 98.8% resemblance with tick isolates from USA (KU598197.1), while MW547404 showed 97.7% homology with another tick isolate from USA (NR_148750.1). Contrarily, our two isolates MW547405 and MW547401 clustered in a separate branch of the tree. Both were 97.5% identical to each other and clustered with a tick isolate from France (MW301938.1) showing 59 percent bootstrap consensus. One of our isolates (MW547403) was very divergent from all others and clustered with tick, mouse, and human isolates from Germany (CP019916.1 and CP019844.1), France (CP028861.1), and USA (CP017201.1 and CP031412.1) with 100 percent bootstrap support; this isolate MW547403 shared almost 99% homology with other isolates (Fig. 2).

 

DISCUSSION

Investigation of emerging vector borne zoonotic diseases is a crucial component of one health program. Lyme disease has long been neglected in Pakistan. In the current study, molecular prevalence of Lb and association of its various hypothesized risk factors were estimated in pet dogs and their ticks in the Lahore City metropolitan area. The study presented first molecular evidence of B. burgdorferi s.l. in ticks and different dog breeds in Pakistan. 16S rRNA signature nucleotides were detected in our isolates using a special primer set designed by (Marconi and Garon, 1992). This primer set specifically amplifies 16S rRNA signature nucleotides related to all species of Borrelia that cause Lyme disease. The authenticity of this primer set is still established and it has been used successfully by many researchers for screening B. burgdorferi s.l. in different hosts (Akl et al., 2019; Elhelw et al., 2021; Liu et al., 2017).

This study confirmed that more than 93 percent dogs were infested with R. sanguineus. This finding is consistent with previous studies conducted in Pakistan (Bashir et al., 2009; Cabezas-Cruz et al., 2019; Ul-Hasan et al., 2012). With exception to Ul-Hasan et al. (2012), all the aforementioned researchers limited their studies to the genus of dog-sourced ticks, which explains why D. reticulatus and H. punctata species were not reported on dogs in Pakistan. However Hy. a. anatolicum which are abundantly found on other animal species including buffaloes, cows, sheep, and goats have been reported by many researchers (Alanazi et al., 2021; Batool et al., 2019; Ghafar et al., 2020). Ixodes scapularis, the most important species for Borrelia sp. transmission was missing in our sampling. Our study is the first to report that Hy. a. anatolicum also infests pet dogs in Lahore. This may be due to shared environment with other animals especially during a religious event, Eid-ul-Adha, in which pet owners buy and keep ruminants at home or in close proximity to pet dogs.

The most favorable predilection site of ticks was inner side of hindlegs (48.5%) and various factors like season, time of tick collection, and inaccessibility for grooming of this body area explain it. On the other side, seasonality of tick recovery revealed that most of the ticks were recovered during summer (56%) and autumn (23.4%). This recovery period coincides with seasonal activity of R. sanguineus, which is the most abundant tick species in our samples (Estrada-Peña et al., 2004). Interestingly, all of the recovered ticks were adults or nymphs but no larvae. Although nymph, larva, and adult of the most abundant tick species in our sampling, R. sanguineus, feed on dogs but no larva was recovered. The reason can be ascribed to the fact that mouth parts of larvae of R. sanguineus are much shorter as compared to other ticks like Ixodes and thus have difficulty in their attachment (Fourie et al., 2013). Moreover, different drop-off rhythm of larvae, nymph, and adult R. sanguineus can also explain it (Paz et al., 2008).

Overall, our study reported 4.3% and 8.9% positive percentages of B. burgdorferi s.l. in dogs and ticks. The most of the literature we reviewed showed that prevalence in dogs was quite high in our study as compared to previous studies which reported 0.1%-5.4% prevalence in dogs (Angelou et al., 2019; Galluzzo et al., 2020; Movilla et al., 2016), whereas 0.3-2.0% in dog-sourced ticks (Geurden et al., 2018; Parry, 2016; Zhang et al., 2017). Contrarily, some studies also reported higher prevalence of Lb in ticks as 7.3% by Livanova et al. (2018) and 18.6% by Yu et al. (2016) while in dogs as high as 11% by Beall et al. (2008). So, more elaborative studies are imperative to estimate the exact prevalence of Lyme disease in Pakistan. It is also pertinent to mention that Ixodes sp. are considered as the principal vector of B. burgdorferi s.l. (Michalski et al., 2020), whereas many studies, including our study, reported the presence of B. burgdorferi s.l. in R. sanguineus (Cabezas-Cruz et al., 2019; Elhelw et al., 2021), though many of these studies implied that R. sanguineus acquired B. burgdorferi s.l. by feeding on Lb positive dogs. In addition, a few studies hypothesized and concluded that many factors like high parasite diversity (Betts et al., 2018), and co-infection (Cabezas-Cruz et al., 2019) may increase ecological innovation in ticks (Cabezas-Cruz et al., 2017). Considering these findings, it is indispensable to ascertain the role of R. sanguineus in harboring and transmitting B. burgdorferi s.l. in future studies.

According to our findings related to the association of various risk factors, likelihood of testing positive to Lb was significantly (p < 0.05) associated with age, weight, gender, and breed of dogs. Adult dogs are more prone (OR = 3.9; p = 0.01) to the disease probably due to their more active lifestyle. Our study also reported 2.6 times greater odds of testing Lb positive in males than in female dogs and this finding is in line with the finding of a recent study (Galluzzo et al., 2020). Likewise, heavy breeds of dogs also had a higher possibility (OR = 3.9; p = 0.01) of being positive to Lb. Interestingly, the same trend was observed when we compared the Lb results in different breeds of dogs individually (Table II). A possible explanation relies on the differences in the susceptibility of different dog breeds to R. sanguinus (Louly et al., 2009, 2010; Zeringóta et al., 2021) and B. burgdorferi s.l. (Gerber et al., 2007); however, more studies are warranted to explore it further.

Unsurprisingly, the result of our management related hypothesized risk factors confirmed that outside housing, presence of ticks, and travel history were significantly (p < 0.05) associated with occurrence of Lb. The reason of this association lies in a simple fact that dogs travelled in recent past or living outside had more exposure of ticks i.e., the main vectors of Lb. Guerra et al. (2001) also reported the same findings. We excluded the data of acaricide usage from the final regression model to avoid multicollinearity; however, its association with occurrence of Lb needs to be established in further epidemiological studies.

Phylogenetic analyses of our isolated DNAs present a grim picture of Lb in the study area. Our recovered sequences shared maximum homology with sequences of four main species of Lyme borreliosis namely, B. burgdorferi sensu stricto, B. bavariensis, B. garinii, and B. bissettii. Besides, the fact that these previous isolates were sourced from human, illustrates the corresponding zoonotic potential of our isolates. Additionally, our isolates also showed some sequence differences (39%–98.3%) with previously reported sequences on NCBI GenBank. As a previous study has already ascertained that Lb agents evolve differently in different geographies, the genetic modifications found in our isolates highlight the need of further elaborative studies to investigate complete genetic modification and resultant change in pathogenicity.

Limitations of this study include inclusion criteria-based sampling, some missing information related to risk factors, and use of B. burgdorferi s.l. specific, rather than species-specific, primers for amplification of the isolated DNAs. The sample selection was based on aforementioned inclusion criteria due to pioneer nature of the study and unavailability of previous data related to presence of B. burgdorferi s.l. not only from Lahore, our study area, but also in Pakistan. Non-random sampling limits generalization of results but it is considered necessary for more focused and valid results. Secondly, some information related to risk factors was missed due to difficulty in recalling by some owners as well as hesitation of some owners to answer questions. This limitation was unavoidable because we could not force an owner to share everything related to his pet. Nevertheless, most of the owners provided the information as risk factors data shows (Tables II and III). Lastly, B. burgdorferi s.l. specific primer set was used instead of species-specific primers, which could have provided detailed information about circulating species and strains of Borrelia; as there are more than 22 species of Borrelia in B. burgdorferi s.l. group, which causes Lyme disease so future studies are indispensable for detailed genomic analyses of circulating Borrelia species in Pakistan.

To conclude, this study reports presence of B. burgdorferi s.l. in pet dogs (4.3%) and distribution of ticks on dogs in the Lahore City Metropolitan area, Pakistan. R. sanguineus was ubiquitously present on dogs and also found positive for B. burgdorferi s.l. A potential association among hypothesized animal and management related risk factors with occurrence of B. burgdorferi s.l. was also studied. Furthermore, phylogenetic analyses illustrated that our sequences showed maximum identities with 16S rRNA sequences of B. burgdorferi sensu stricto, B. bavariensis, B. garinii, and B. bissettii sourced from different hosts worldwide. Clearly, these results confirm a substantial disease risk of Lb in Pakistan and this risk is likely to become more significant without better surveillance program and availability of adequate diagnostic testing. Therefore, future studies are required to characterize genospecies of Borrelia, and investigate unexplored geographical areas and hosts including potential human population at risk, particularly veterinarians and the pet owners.

ACKNOWLEDGEMENTS

The research was supported by PAK-US Science and Technology project number 1122 titled “Capacity Building for Vector-borne Neglected Diseases of Livestock” and HEC Indigenous Scholarship Phase II, Batch VI (Personal Identification Number is 520-147912-2AV6-164). Authors are also grateful Dr. Muhammad Zahid Iqbal, Dr. Ahsan Anjum, Dr. Abid Hussain, Dr. Zia Ullah, Ms Saba Usman as well as all pet clinicians for their support in sample collection and processing.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Akl, T., Bourgoin, G., Souq, M.L., Appolinaire, J., Poirel, M.T., Gibert, P., Abi Rizk, G., Garel, M. and Zenner, L., 2019. Detection of tick-borne pathogens in questing Ixodes ricinus in the French Pyrenees and first identification of Rickettsia monacensis in France. Parasite, pp. 26. https://doi.org/10.1051/parasite/2019019

Alanazi, A.D., Alouffi, A.S., Alshahrani, M.Y., Alyousif, M.S., Abdullah, H.H., Allam, A.M., Elsawy, B.S., Abdel-Shafy, S., Alsulami, M.N., Khan, A. and Iqbal, F., 2021. A report on tick burden and molecular detection of tick-borne pathogens in cattle blood samples collected from four regions in Saudi Arabia. Ticks Tick-borne Dis.12: 101652. https://doi.org/10.1016/j.ttbdis.2021.101652

Angelou, A., Gelasakis, A.I., Verde, N., Pantchev, N., Schaper, R., Chandrashekar, R. and Papadopoulos, E., 2019. Prevalence and risk factors for selected canine vector-borne diseases in Greece. Parasites Vectors12: 1-11. https://doi.org/10.1186/s13071-019-3543-3

Bashir, I.N., Chaudhry, Z.I., Ahmed, S. and Saeed, M.A., 2009. Epidemiological and vector identification studies on canine babesiosis. Pak. Vet. J.29: 51-54.

Batool, M., Nasir, S., Rafique, A., Yousaf, I., and Yousaf, M., 2019. Prevalence of tick infestation in farm animals from Punjab, Pakistan. Pak. Vet. J.39: 406-410. https://doi.org/10.29261/pakvetj/2019.089

Beall, M.J., Chandrashekar, R., Eberts, M.D., Cyr, K.E., Diniz, P.P.V., Mainville, C., Hegarty, B.C., Crawford, J.M. and Breitschwerdt, E.B., 2008. Serological and molecular prevalence of Borrelia burgdorferi, Anaplasma phagocytophilum, and Ehrlichia species in dogs from Minnesota. Vector Borne Zoon Dis.8: 455-464. https://doi.org/10.1089/vbz.2007.0236

Bedford, E., 2020. Global dog and cat pet population 2018 [WWW Document]. Stat consum goods FMCG> pets anim supplies. URL https://www.statista.com/statistics/1044386/dog-and-cat-pet-population-worldwide/ (accessed 2.2.21).

Betts, A., Gray, C., Zelek, M., MacLean, R.C. and King, K.C., 2018. High parasite diversity accelerates host adaptation and diversification. Science360: 907-911. https://doi.org/10.1126/science.aam9974

Bouchard, C., Leonard, E., Koffi, J.K., Pelcat, Y., Peregrine, A., Chilton, N., Rochon, K., Lysyk, T., Lindsay, L.R. and Ogden, N.H., 2015. The increasing risk of Lyme disease in Canada. Can. Vet J.56: 693.

Cabezas-Cruz, A., Allain, E., Ahmad, A.S., Saeed, M.A., Rashid, I., Ashraf, K., Yousfi, L., Shehzad, W., Indjein, L., Rodriguez-Valle, M. and Estrada-Peña, A., 2019. Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (sl). Para Vect., 12: 1-13. https://doi.org/10.1186/s13071-018-3194-9

Cabezas-Cruz, A., Estrada-Peña, A., Rego, R.O. and De la Fuente, J., 2017. Tick-pathogen ensembles: Do molecular interactions lead ecological innovation? Front. Cell Infect. Micro., 7: 74. https://doi.org/10.3389/fcimb.2017.00074

Cutler, S.J., Ruzic-Sabljic, E. and Potkonjak, A., 2017. Emerging borreliae expanding beyond Lyme borreliosis. Mol. Cell. Prob., 31: 22-27. https://doi.org/10.1016/j.mcp.2016.08.003

Díaz-Sánchez, A.A., Corona-González, B., Meli, M.L., Roblejo-Arias, L., Fonseca-Rodríguez, O., Pérez Castillo, A., Vega Cañizares, E., Lobo Rivero, E. and Hofmann-Lehmann, R., 2020. Molecular diagnosis, prevalence and importance of zoonotic vector-borne pathogens in cuban shelter dogs a preliminary study. Pathogens9: 901. https://doi.org/10.3390/pathogens9110901

Elhelw, R., Elhariri, M., Hamza, D., Abuowarda, M., Ismael, E. and Farag, H., 2021. Evidence of the presence of Borrelia burgdorferi in dogs and associated ticks in Egypt. BMC Vet. Res.17: 1-9. https://doi.org/10.1186/s12917-020-02733-5

Estrada-Peña, A., Bouattour, A., Camicas, J.L. and Walker, A.R., 2004. Ticks of domestic animals in the Mediterranean region. University of Zaragoza, Spain, pp. 131.

Felsenstein, J., 1985. Confidence limits on phylogenies: A justification. Evolution39: 783-791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x

Fourie, J.J., Stanneck, D., Luus, H.G., Beugnet, F., Wijnveld, M. and Jongejan, F., 2013. Transmission of Ehrlichia canis by Rhipicephalus sanguineus ticks feeding on dogs and on artificial membranes. Vet. Para.197: 595-603. https://doi.org/10.1016/j.vetpar.2013.07.026

Galluzzo, P., Grippi, F., Di Bella, S., Santangelo, F., Sciortino, S., Castiglia, A., Sciacca, C., Arnone, M., Alduina, R. and Chiarenza, G., 2020. Seroprevalence of Borrelia burgdorferi in stray dogs from southern Italy. Microorganisms8: 1688. https://doi.org/10.3390/microorganisms8111688

Gatzmann, F., Metzler, D., Krebs, S., Blum, H., Sing, A., Takano, A., Kawabata, H., Fingerle, V., Margos, G. and Becker, N.S., 2015. NGS population genetics analyses reveal divergent evolution of a Lyme Borreliosis agent in Europe and Asia. Ticks Tick Borne Dis.6: 344-351. https://doi.org/10.1016/j.ttbdis.2015.02.008

Gerber, B., Eichenberger, S., Wittenbrink, M.M. and Reusch, C.E., 2007. Increased prevalence of Borrelia burgdorferi infections in Bermese Mountain Dogs: A possible breed predisposition. BMC Vet. Res., 3: 1-8. https://doi.org/10.1186/1746-6148-3-15

Geurden, T., Becskei, C., Six, R.H., Maeder, S., Latrofa, M.S., Otranto, D. and Farkas, R., 2018. Detection of tick-borne pathogens in ticks from dogs and cats in different European countries. Ticks Tick Borne Dis.9: 1431-1436. https://doi.org/10.1016/j.ttbdis.2018.06.013

Ghafar, A., Gasser, R.B., Rashid, I., Ghafoor, A. and Jabbar, A., 2020. Exploring the prevalence and diversity of bovine ticks in five agro-ecological zones of Pakistan using phenetic and genetic tools. Ticks Tick Borne Dis.11: 101472. https://doi.org/10.1016/j.ttbdis.2020.101472

Guerra, M.A., Walker, E.D. and Kitron, U., 2001. Canine surveillance system for Lyme borreliosis in Wisconsin and northern Illinois: Geographic distribution and risk factor analysis. Am. J. trop. Med. Hyg.65: 546-552. https://doi.org/10.4269/ajtmh.2001.65.546

Herrin, B.H., Peregrine, A.S., Goring, J., Beall, M.J. and Little, S.E., 2017. Canine infection with Borrelia burgdorferi, Dirofilaria immitis, Anaplasma spp. and Ehrlichia spp. in Canada, 2013–2014. Para Vector10: 1-9. https://doi.org/10.1186/s13071-017-2184-7

James, A.M., Liveris, D., Wormser, G.P., Schwartz, I., Montecalvo, M.A., and Johnson, B.J.B., 2001. Borrelia lonestari infection after a bite by an Amblyomma americanum tick. J. Infect. Dis., https://doi.org/10.1086/320721

Jánová, E., 2019. Emerging and threatening vector-borne zoonoses in the world and in Europe: A brief update. Pathog. Glob. Hlth., 113: 49–57. https://doi.org/10.1080/20477724.2019.1598127

Keirans, J.E. and Clifford, C.M., 1978. The genus Ixodes in the United States: A scanning electron microscope study and key to the adults. J. Med. Ent.15(suppl_2): 1-38. https://doi.org/10.1093/jmedent/15.suppl2.1

Keirans, J.E. and Litwak, T.R., 1989. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J. med. Ent.26: 435-448. https://doi.org/10.1093/jmedent/26.5.435

Kocoń, A., Asman, M., Nowak-Chmura, M., Witecka, J., Kłyś, M. and Solarz, K., 2020. Molecular detection of tick-borne pathogens in ticks collected from pets in selected mountainous areas of Tatra County (Tatra Mountains, Poland). Sci. Rep.10: 1-7. https://doi.org/10.1038/s41598-020-72981-w

Kumar, S., Stecher, G. and Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol.33: 1870-1874. https://doi.org/10.1093/molbev/msw054

Littman, M.P., Gerber, B., Goldstein, R.E., Labato, M.A., Lappin, M.R., and Moore, G.E., 2018. ACVIM consensus update on Lyme borreliosis in dogs and cats. J. Vet. Int. Med., 32: 887–903. https://doi.org/10.1111/jvim.15085

Liu, X.Y., Gong, X.Y., Zheng, C., Song, Q.Y., Chen, T., Wang, J., Zheng, J., Deng, H.K. and Zheng, K.Y., 2017. Molecular epidemiological survey of bacterial and parasitic pathogens in hard ticks from eastern China. Acta Trop.167: 26-30. https://doi.org/10.1016/j.actatropica.2016.12.010

Liu, Y., Nordone, S.K., Yabsley, M.J., Lund, R.B., McMahan, C.S. and Gettings, J.R., 2019. Quantifying the relationship between human Lyme disease and Borrelia burgdorferi exposure in domestic dogs. Geospatial. Hlth.14: 111-120. https://doi.org/10.4081/gh.2019.750

Livanova, N.N., Fomenko, N.V., Akimov, I.A., Ivanov, M.J., Tikunova, N.V., Armstrong, R. and Konyaev, S.V., 2018. Dog survey in Russian veterinary hospitals: Tick identification and molecular detection of tick-borne pathogens. Parast. Vector11: 1-10. https://doi.org/10.1186/s13071-018-3161-5

Louly, C.C., Soares, S.F., Silveira, D.N., Neto, O.J., Silva, A.C. and Borges, L.M., 2009. Differences in the susceptibility of two breeds of dogs, English cocker spaniel and beagle, to Rhipicephalus sanguineus (Acari: Ixodidae). Int. J. Acarol.35: 25-32. https://doi.org/10.1080/01647950802655251

Louly, C.C.B., Soares, S.F., da Nóbrega Silveira, D., Guimarães, M.S. and Borges, L.M.F., 2010. Differences in the behavior of Rhipicephalus sanguineus tested against resistant and susceptible dogs. Exp. Appl. Acar.51: 353-362. https://doi.org/10.1007/s10493-009-9334-3

Marconi, R.T. and Garon, C.F., 1992. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis. J. clin. Microbiol., 30: 2830-2834. https://doi.org/10.1128/jcm.30.11.2830-2834.1992

Michalski, M.M., Kubiak, K., Szczotko, M., Chajęcka, M. and Dmitryjuk, M., 2020. Molecular detection of Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in ticks collected from dogs in urban areas of North-Eastern Poland. Pathogens9: 455. https://doi.org/10.3390/pathogens9060455

Movilla, R., García, C., Siebert, S., Roura, X., 2016. Countrywide serological evaluation of canine prevalence for Anaplasma spp., Borrelia burgdorferi (sensu lato), Dirofilaria immitis and Ehrlichia canis in Mexico. Para Vec., 9: 421. https://doi.org/10.1186/s13071-016-1686-z

Parry, N., 2016. Canine borreliosis: Epidemiology, pathogenesis, clinical signs, and diagnostics. Companion Anim., 21: 323–331. https://doi.org/10.12968/coan.2016.21.6.323

Paz, G.F., Labruna, M.B. and Leite, R.C., 2008. Ritmo de queda de Rhipicephalus sanguineus (Acari: Ixodidae) de cães artificialmente infestados. Rev. Brasil. Parasitol. Vet.17: 139-144. https://doi.org/10.1590/S1984-29612008000300004

Sato, K., Sakakibara, K., Masuzawa, T., Ohnishi, M. and Kawabata, H., 2018. Case control study: Serological evidence that Borrelia miyamotoi disease occurs nationwide in Japan. J. Infect. Chemother.24: 828-833. https://doi.org/10.1016/j.jiac.2018.06.017

Springer, A., Glass, A., Topp, A.K., and Strube, C., 2020. Zoonotic tick-borne pathogens in temperate and cold regions of Europe. A review on the prevalence in domestic animals. Front. Vet. Sci., 7: 604910 https://doi.org/10.3389/fvets.2020.604910

Sthitmatee, N., Jinawan, W., Jaisan, N., Tangjitjaroen, W., Chailangkarn, S., Sodarat, C., Ekgatat, M., and Padungtod, P., 2016. Genetic and immunological evidences of Borrelia burgdorferi in dog in Thailand. Southeast Asian J. trop. Med. Publ. Hlth., 47: 71.

Tamura, K., and Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 28: 2886-2902.

Ul-Hasan, M., Abubakar, M., Muhammad, G., Khan, M.N., and Hussain, M., 2012. Prevalence of tick infestation (Rhipicephalus sanguineus and Hyalomma anatolicum anatolicum) in dogs in Punjab, Pakistan. Vet. Ital., 48: 95–98.

Wang, Y., Li, S., Wang, Z., Zhang, L., Cai, Y., Liu, Q., 2019. Prevalence and identification of Borrelia burgdorferi sensu lato genospecies in ticks from northeastern China. Vector-Borne Zoon. Dis., 19: 309–315. https://doi.org/10.1089/vbz.2018.2316

Yu, P., Liu, Z., Niu, Q., Yang, J., Abdallah, M.O., Chen, Z., Liu, G., Luo, J. and Yin, H., 2017. Molecular evidence of tick-borne pathogens in Hyalomma anatolicum ticks infesting cattle in Xinjiang Uygur Autonomous Region, Northwestern China. Exp. App. Acarol.73: 269-281. https://doi.org/10.1007/s10493-017-0162-6

Yu, P.F., Niu, Q.L., Liu, Z.J., Yang, J.F., Chen, Z., Guan, G.Q., Liu, G.Y., Luo, J.X. and Yin, H., 2016. Molecular epidemiological surveillance to assess emergence and re-emergence of tick-borne infections in tick samples from China evaluated by nested PCRs. Acta Trop.158: 181-188. https://doi.org/10.1016/j.actatropica.2016.02.027

Zeringóta, V., Pereira-Junior, R.A., Sarria, A.L., Henrique, A.C., Birkett, M.A. and Borges, L.M., 2021. Identification of a non-host semiochemical from miniature pinscher, Canis lupus familiaris, that repels Rhipicephalus sanguineus sensu lato (Acari: Ixodidae). Ticks Tick Borne Dis.12: 101582. https://doi.org/10.1016/j.ttbdis.2020.101582

Zhang, J., Liu, Q., Wang, D., Li, W., Beugnet, F., and Zhou, J., 2017. Epidemiological survey of ticks and tick-borne pathogens in pet dogs in south-eastern China. Parasite, 24. https://doi.org/10.1051/parasite/2017036

Zhang, X., Norris, D.E. and Rasgon, J.L., 2011. Distribution and molecular characterization of Wolbachia endosymbionts and filarial nematodes in Maryland populations of the lone star tick (Amblyomma americanum). FEMS Microbiol. Ecol.77: 50-56. https://doi.org/10.1111/j.1574-6941.2011.01089.x

Zintl, A., Zaid, T., McKiernan, F., Naranjo-Lucena, A., Gray, J., Brosnan, S., Browne, J., O’Connor, J., Mee, J.F., Good, B. and Gillingham, E.L., 2020. Update on the presence of Ixodes ricinus at the western limit of its range and the prevalence of Borrelia burgdorferi sensu lato. Ticks Tick Borne Dis.11: 101518. https://doi.org/10.1016/j.ttbdis.2020.101518