Research Article

Prevalence of Herpes simplex Virus in Pregnant Women in Ismailia City

Hanaa H.A. Gomaa1*, Shimaa A.S. Hasan1, Nashwa Harb1, Amal H.A. Gomaa2 and Maha Anani3

1Department of Botany and Microbiology, Faculty of Science, Suez Canal University, Ismailia, Egypt; 2Department of Dermatology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt; 3Department of Clinical Pathology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt.

Abstract | Herpes simplex virus infections are usually asymptomatic, however infection during pregnancy is life-threatening for pregnant women and their newborns. We aimed to assess both the seroprevalence of herpes simplex virus type 1 and 2 among pregnant women in Ismailia City as well as the impact of pregnancy duration on their prevalence. A descriptive cross-sectional study was conducted on 94 serum samples of pregnant women in Ismailia City. The presence of herpes simplex virus type 1 and 2 antibodies (IgG and IgM) and viremia were evaluated by commercial ELISA and real-time polymerase chain reaction (RT-PCR) techniques. Our findings revealed a very high frequency of HSV-1 and 2 infections among the studied pregnant women with percentages of 74.5% and 98.9%, respectively. Upon the interpretation of the HSV serological profiles, the past latent infection with HSV-1 and 2 were the most prevalent types of infection representing 74.5% and 92.5%, respectively, followed by HSV-2 recurrent infection which was more prevalent (6.4%) than HSV-1 recurrent infection (0%), and no primary infection was found. HSV-2 co-infection was detected in all the HSV-1 positive cases (n= 70, 74.5%). Moreover, there was no correlation between pregnancy duration and HSV-1 and 2 seroprevalences. In addition, the real-time PCR confirmed the positivity of the HSV-2 IgM subjects (n=6), while ruling out the equivocal sample as HSV-2 IgM negative. Pregnancy screening for herpes simplex viruses is recommended to control the high viral seropositivity found among pregnant women in Ismailia City. Furthermore, the real-time PCR technique improves the diagnostic value of serological tests.


Received | May 30, 2022; Accepted | October 28, 2022; Published | June 28, 2022

*Correspondence | Hanaa H.A. Gomaa, Department of Botany and Microbiology, Faculty of Science, Suez Canal University, Ismailia, Egypt; Email: [email protected]

Citation | Gomaa, H.H.A., S.A.S. Hasan, N. Harb, A.H.A. Gomaa and M. Anani. 2022. Prevalence of Herpes simplex virus in pregnant women in Ismailia city. Journal of Virological Sciences, 10(1): 18-26.

DOI | https://dx.doi.org/10.17582/journal.jvs/2022/10.1.18.26

Keywords | Herpes simplex virus type 1, Herpes simplex virus type 2, Pregnant women, Seroprevalence

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Pregnancy is a unique stage of life that most women go through. One of the most common characteristics of pregnant women is an immune system deficit. As a result, harmful microbes like viruses can overwhelm the host’s defensive system. Human herpes simplex viruses (HSVs) are a well-known microbial pathogen that causes a variety of diseases (Anzivino et al., 2009). They are double-stranded DNA viruses that are, enveloped, and belongs to the Herpesviridae family and subfamily alpha herpesvirinae (Whitley and Baines, 2018). They are transmitted through mucosal membranes and nonintact skin and migrates to nerve tissues, where it remains in latent status. HSV-1 is frequently acquired orally in infancy. It can also be transmitted sexually. Whereas, a person can only get HSV-2 through genital contact (Ayoub et al., 2019). Both viruses have the potential to be transferred vertically during childbirth (Looker et al., 2017). However, the risk is significant when a mother becomes infected with the virus for the first time during late pregnancy (Kimberlin, 2007).

Up to 80% of HSV infections are asymptomatic (Whitley and Baines, 2018) and a large percentage of HSV infections have no or mild manifestations with no detection; hence, pregnant women are the most vulnerable patients to HSV infections. A small number of patients get clinical symptoms such as vaginal lesions and herpetic ulcers (Anzivino et al., 2009; Bochner et al., 2013; Looker et al., 2017).

A first primary infection occurs when a susceptible person (without preexisting HSV-1 and HSV-2 antibodies) is exposed to HSV. A first nonprimary episode happens when a person who has preexisting HSV antibodies (type 1 or 2) has a first episode with the opposing HSV type. Recurrent infection develops when a person has already antibodies against the same HSV type (Gupta et al., 2007). All three kinds of HSV infections are prevalent in pregnant women, which may lead to infection transmission to fetuses and newborns causing eye or skin lesions, meningoencephalitis, fetal abnormalities, and even death (Straface et al., 2012; Stephenson-Famy and Gardella, 2014).

Thus, the present study aimed to assess the seroprevalence of HSV-1 and 2 in pregnant women in Ismailia City and in addition, to assess the impact of the pregnancy duration on the presence of HSV-1 and HSV-2 antibodies. To our knowledge, this is the first report from Ismailia City and gives clues regarding the seroprevalence of the HSVs in Egyptian pregnant women.

Materials and Methods

Study population and data collection

This is a cross-sectional descriptive study conducted in Ismailia city which is located in north-eastern Egypt, near the midpoint of the Suez Canal. Ninety-four pregnant women were randomly chosen from those attending the health care centers in Ismailia city, the sample collection continued from January 2019 to January 2020. After having received written and verbal permission from the participants, they were asked about the following data: name, age and residence, data about the pregnancy semester, and associated complications.

Collection and storage of samples

Each participant’s blood sample (5.0 ml) was taken in a sterile plane tube and centrifuged at 3000 rpm for 5 minutes. Then, the serum obtained from each study subject was divided into three different Eppendorf tubes. One was used for serological tests, the second was used for the real-time PCR test, and the third one was a backup sample. Sera were stored at less than -20˚C until being used.

The serological assessment

Sera from all the participants were subjected to serological studies by indirect ELISA for HSV-1 IgG detection (MyBio Source HSV-1 IgG ELISA kit, Cat no. MBS494292, MyBio Source, Inc., San Diego, California, USA); HSV-1 IgM (MyBioSource HSV-1 IgMELISA kit, Cat no. MBS495633, MyBioSource, Inc., San Diego, California, USA) and HSV-2 IgG/IgM (gG2 purified) (VIRCELL kits for HSV-2 IgG/IgM,Cat.No.G/M1013, VIRCELL, S.L. Pza, Spain). The technique was done according to the manufacturers instructions. The absorbance of each well was read at 450nm and determined by ELISA system using ELISA Reader (Hyperion, USA). The concentrations were determined using standard curves. Construct a standard curve by plotting the average OD for each standard on the vertical (Y) axis against the concentration on the horizontal (X) axis and draw a best fit curve through the points on the graph.

The molecular assessment

For confirmation of HSV-1/2 infection, all serum samples positive for IgM were tested to detect the presence of HSV-1/2 DNA using qualitative real-time PCR (RT-PCR) assay.

DNA extraction and qualitative real-time PCR

Since no HSV-1 IgM was detected in any sera, only DNA from all positive HSV-2 IgM serum samples were manually extracted and purified using DNA-sorb-AM nucleic acid extraction kit, Cat no. K1-12-100-CE, supplied by AmpliSens®, Russia.

 

Table 1: Primers and probes used for Taqman detection of the gBregiona.

Primer or probe

Sequence

Label

Tm (°C)

μM

HSV2-F

TGCAGTTTACGTATAACCACATACAGC

59.5

0.9

HSV2-R

AGCTTGCGGGCCTCGTT

60.5

0.9

HSV2-probe

CGCCCCAGCATGTCGTTCACGT

5FAM or JOE, 3 TAMRA

70.0

0.2

 

aFAM, 6-carboxyfluorescein; JOE, 6-carboxy-4, 5-dichloro-2, 7-dimethoxyfluorescein, TAMRA, 6-carboxytetramethyl-rhodamine. Nucleotides that differ from HSV-1 are underlined.

 

The HSV-2 DNA was detected by using qualitative real-time polymerase chain reaction (RT-PCR) using Ampli Sens® HSV-typing-FRT PCR kit, Cat.No. R-V38-F (RG, iQ)-CE, Supplied by Inter Lab Service Ltd, Russia. The DNA target amplification specific region for HSV-2 was gpB gene by using applied biosystem Step On, USA real-time PCR.

In the real-time PCR, the amplified product was detected with the use of fluorescent dyes. These dyes were linked to oligonucleotide probes, which bind specifically to the amplified product during thermocycling. The real-time monitoring of fluorescence intensities during the real-time PCR allowed the detection of accumulating product without re-opening the reaction tubes after the PCR run.

 

Table 2: Real-time PCR amplification program for amplifying HSV-2 gpB gene.

Step

Temperature °C

Time

Cycles

1

95

15 min

1

2

95

5 s

5

60

20 s

72

15 s

3

95

5 s

40

60

20 s fluorescent signal detection

72

15s

 

Statistical analysis

Data analyses were performed using SPSS version 23. Quantities data were expressed as means±SD and qualitative data were expressed as numbers and percentages. The Chi-square (χ2) test was used to test the significance of qualitative variables. P < 0.05 was considered to denote statistical significance.

Results and Discussion

Study population

The study population comprised 94 pregnant women; their ages ranged from 16 years up to 42 years (mean±SD= 25.9±5.73 years). Regarding the pregnancyduration at the time of the study, the studied population (n=94) was classified into three groups as follows: only 14.9% were during the 1st trimester; 52.1% were during the 2nd trimester and 33% were during 3rd trimester (Table 3).

 

Table 3: Basic Characteristics of the study population.

Characteristics

(n=94)

Age\ year

Mean ± SD

Range

25.9 ± 5.73

16–42

Age of pregnancy\ months

Mean ± SD

Range

5.5±2.13

1–9

Trimester

First no. (%)

Second no. (%)

Third no. (%)

14 (14.9%)

49 (52.1%)

31 (33%)

 

Serological profiles of HSV-1 and 2

Regarding the serological markers for both HSV-1 and 2, the most prevalent immunoglobulins were HSV-1 IgG and HSV-2 IgG which were found to be positive in 74.5% and 98.9% of the studied population, respectively. Whereas, the HSV-2 IgM was detected in only 6.4% of the studied cases who had also HSV-2 IgG, and there was no HSV-1 IgM seropositivity detected at all (Table 4).

Detection of HSV-2 DNA in all positive HSV-2 IgM serum

The qualitative RT-PCR technique confirmed the HSV-2 infection of the six IgM seropositive subjects, while the unknown (equivocal) sample was negative for HSV-2 DNA, and thus it was confirmed to be a negative HSV-2 IgM case.

Interpretation of the serological profile of HSV-1 and 2

The interpretation of the performed serological tests of HSV-1 and 2 revealed that most of the studied subjects had serological evidence of past latent infection with HSV-1 and 2 that representing 74.5% and 92.5%, respectively. HSV-2 recurrent infection was more prevalent (6.4%) in the studied subjects than recurrent HSV-1 which was not detected at all. Otherwise, no primary infections of HSV1 and 2 were detected. Indeed, the results showed a very high prevalence of HSV-1 and 2 infections among the studied pregnant women with percentages of 74.5% and 98.9%, respectively (Table 5).

 

Table 4: Serological results of HSV-1 and 2 among the studied groups.

Seropositivity in the studied group (n=94)

Titer (U/ml)

N

%

HSV-1

IgM

Negative

94

100%

Mean±SD

0.39±0.197

Positive

0

0.0%

Range

0.1–0.9

IgG

Negative

24

25.5%

Mean±SD

13.26±6.1

Positive

70

74.5%

Range

3–40

HSV-2

IgM

Negative

87

92.5%

Mean±SD

Range

1.41±2.93

0.1–0.9

Positive

6

6.4%

Equivocal

(unknown)

1

1.1%

IgG

Negative

1

1.1%

Mean±SD

49.3±31.7

Positive

93

98.9%

Range

8–200

 

Table 5: Interpretation of the serological results of HSV-1 and 2.

Interpretation status

N

%

HSV-1

No infection

24

25.5%

Primary infection

0

0%

Latent infection

70

74.5%

Recurrent HSV-1 episode

0

0%

Total HSV-1 prevalence

70

74.5%

HSV-2

No infection

1

1.1%

Primary infection

0

0%

Latent infection

87

92.5%

Recurrent HSV-2 episode

6

6.4%

Total HSV-2 prevalence

93

98.9%

 

Relation between pregnancy duration and the HSV-1 and 2 infections among the studied population

Our results showed that regarding the HSV-1 and 2 serological profiles and infection types, there was no significant difference between the studied three groups of pregnant women (p-value > 0.05) (Table 6 and 7). Thus, there was no relationship between the pregnancy duration and the seroprevalences of HSV-1 and 2.

HSV-1 and 2 co-infections among the studied pregnant women

Interestingly, our results showed that all the HSV-1 positive cases (n= 70, 74.5%) had also HSV-2 co-infection. They were classified as follows: 6 (6.4%) had recurrent HSV-2 infection and HSV-1 latent infection, and 64 had evidence of both HSV-1 and 2 past coinfections.

The prevalence of HSV-1 IgM observed in this study was 0%. Similar to the previous study in other different countries such as Saudi Arabia (Al-Hakami et al., 2020), Brazil (Lima et al., 2021) and Turkey (Duran, 2004). On the contrary the high level of HSV-1 IgM, seropositivity was reported also by other countries researchers such as in Serbia 6.25% (Đorđević, 2006), Saudi Arabia two separate studies (5.9%, 4.3%), respectively (Obeid, 2007; Alzahrani et al., 2005), Nigeria 2.8% (Okonko and Cookey, 2015) and India 0.55% (Rajendiran et al., 2021).

The present study found that the prevalence of HSV-1 IgG was 74.5%. This is considerably close to the values obtained in other studies such as in India 69.44% (Rajendiran et al., 2021), Serbia 68.75% (Đorđević, 2006) and Switzerland 79.4% (Kucera et al., 2012). This is also considerably lower than the values obtained in other studies such as in Turkey 98% (Dolar et al., 2006), Saudi Arabia four separate studies (90.9%, 90.5%, 84.1%, 94.7%), respectively (Ghazi et al., 2002; Alzahrani et al., 2005; Obeid, 2007; Al-Hakami et al., 2020), Ghana 99.2% (Agyemang-Yeboah et al., 2019), Yemen 99.4% (Assayaghi et al., 2017), Germany 82% (Sauerbrei et al., 2011) and Brazil 82% (Lima et al., 2021). This is also considerably higher than values obtained in other studies such as in united states two separated studies (59.3%, 63%), respectively (Patton et al., 2018; Xu et al., 2007).

In the current study it was observed that the prevalence of anti-HSV-2 IgM was 6.4%. Different studies had presented different results; in Saudi Arabia 0.5% (Alzahrani et al., 2005), Serbia 6, 25% (Đorđević, 2006), Iraq three separate studies (6.2%, 2.2%, 0.6%), respectively (Mahmood and Najem, 2020; Hasan et al., 2013; Abdulkhaliq et al., 2017), Brazil 1.2% (Lima et al., 2021), India 2.1% (Amar et al., 2015) and Turkey 11.3% (Duran, 2004). In contrast, some studies showed that all the studied cases had no recent HSV- 2 infection with negative IgMtitre such as in Saudi Arabia (Obeid, 2007; Al-Hakami et al., 2020), Turkey (Özdemir et al., 2011), Sudane (El-Amin et al., 2013) and India (Rajendiran et al., 2021).

 

Table 6: The relation between the pregnancy duration and the serological profile of HSV-1 and 2.

Pregnancy duration

P value

1st trimester

(14)

2ndtrimester

(49)

3rdtrimester

(31)

HSV-1

IgG

Positive (n=70)

9 (64.3%)

38 (77.6%)

23 (74.2%)

0.664

(NS)

Negative (n=24)

5 (35.7%)

11 (22.4%)

8 (25.8%)

IgM

Positive (n=0)

0

0

0

-----

Negative (n=94)

14 (100%)

49 (100%)

31 (100%)

HSV-2

IgG

Positive (n=93)

13 (92.9%)

49 (100%)

31 (100%)

0.06

(NS)

Negative (n=1)

1 (7.1%)

0 (0.0%)

0 (0.0%)

IgM

Positive (n=6)

0 (0.0%)

3 (6.12%)

3 (9.7%)

0.5

(NS)

Negative (n=87)

14 (100%)

45 (91.84%)

28 (90.3%)

Equivocal (n=1)

0

1 (2.04%)

0

 

Table 7: The relation between the pregnancy duration and HSV-1 and 2 infection types.

Interpretation status

Pregnancy duration

P value

1st trimester

(n=14)

2nd trimester

(n=49)

3rd trimester

(n=31)

HSV-1

No infection

5

35.7%

11

22.4%

8

25.8%

0.5

(NS)

Primary infection

0

0%

0

0%

0

0%

Latent infection

9

64.3%

38

77.6%

23

74.2%

Recurrent HSV-1 episode

0

0%

0

0%

0

0%

Total HSV-1 prevalence

9

64.3%

38

77.6%

23

74.2%

HSV-2

No infection

1

7.1%

0

0

0

0

0.1

(NS)

Primary infection

0

0%

0

0

0

0

Latent infection

13

92.9%

46

93.9%

28

90.3%

Recurrent HSV-2 episode

0

0%

3

6.1%

3

9.7%

Total HSV-2 prevalence

13

92.9%

49

100%

31

100%

 

The present study also contrast with other studies such as in Iraq28.9% (Al-Marziqi et al., 2012) and Turkey 28.6% (Sert et al., 2020).

Moreover, some studies found that the state of pregnancy may predispose to the reactivation of latent HSV-2 infection which might result in fetal infection with spontaneous abortion (Sifakis et al., 1998; Goda et al., 2007).

In this study, seroprevalence of anti HSV-2 IgG antibodies among pregnant women was 98.9%. This is considerably close to the values obtained in other studies such as in Nigeria 99.4% (Okonko and Cookey, 2015), Zaria 82.2% (Ameh et al., 2016) and Turkey 73.8% (Sert et al., 2020).

Regarding the low level of HSV-2 IgG, seropositivity was reported also by other countries researchers such as in India five separate studies found that the seropositivity of anti HSV-2 IgG among pregnant women was (64.9% , 16.66% , 8.7% , 7.5% , 6.7%) respectively (Amar et al., 2015; Rajendiran et al., 2021; Biswas et al., 2011; Rathore et al., 2010; Bochner et al., 2013), Nigeria two separate studies (58.9%, 33.3%) respectively (Diamreyan et al., 2021; Anaedobe and Ajani, 2019), Zimbabwe two separate studies (51.1%, 49.1%), respectively (Kurewa et al., 2010; Munjoma et al., 2010), Sudan 32.1% (El-Amin et al., 2013), Ethiopia 32.1% (Anjulo et al., 2016), Turkey two separate studies (63.1%, 4.4%), respectively (Duran, 2004; Özdemir et al., 2011), Saudi Arabia five separate studies (27.1%, 7.6%, 6.8%, 6.5%, 0.5%), respectively (Ghazi et al., 2002; Fazza, 2016; Obeid, 2007; Alzahrani et al., 2005; Al-Hakami et al., 2020), Serbia 12.5% (Đorđević, 2006), Iraq 9% (Mezher et al., 2018), 2.2% (Abdulkhaliq et al., 2017; Hasan et al., 2013), Yemen two separate studies (5.1%, 6%) respectively (Assayaghi et al., 2017; Al-Bana et al., 2021) and Brazil 9.5% (Lima et al., 2021).

The higher prevalence in our study might be due to various factors. First, the prevalence of HSV might be high among general population especially in men. Financial constraints might be the second factor as it was difficult to cover screening cost in our country and simultaneously creating awareness. Educational status might be the other factor. Lack of health information might play important role to increase the prevalence.

In this study, real-time PCR confirmed the positivity of the HSV-2 IgM cases (n=6), while it cleared that the equivocal sample was HSV-2 IgM negative. This proved the importance of the DNA assays in cases of doubtful serological findings, due to their sensitivity and specificity.

Our study showed high HSV PCR positivity compared with the previously published studies such as in Iraq 1.2% (Ali et al., 2019), Brazil; 0% (Lima et al., 2021), 1.49% (Lima et al., 2018).

In contrast, another study performed by (Finger-Jardim et al., 2017) in Brazil reported about 28% and 12.6% positivity results of HSV-1 DNA and HSV-2 DNA, respectively.

Miranda et al. (2014) reported that about (16% and 12.3%) of pregnant women in Brazil had positive result to HSV-1 DNA and HSV-2 DNA, respectively.

In this study we found that all IgM positive cases with recent HSV-2 infection had old HSV-1 and HSV-2 infection too with positive IgG test result and about 75.3% of cases with old HSV-2 infection gave positive results for old HSV-1 infection. Also, one case showed to be negative for old infection of both types.

In contrast to this, (Duran, 2004) found that about 44.4% of cases with recent herpes type 2 infection had old infection too with positive IgG test results. Another study by (Abdulkhaliq et al., 2017) reported that only one case with recent herpes type 2 infection had also old infection too with positive IgG test result.

Also, other studies showing that none of the cases that had old infection with herpes type 2 had also recent infection with negative IgM test results such as (Duran, 2004; Obeid, 2007; Özdemir et al., 2011; El-Amin et al., 2013; Al-Hakami et al., 2020; Rajendiran et al., 2021).

The present study found that none of the demographic factors age and duration of pregnancy has significant influence on the HSV positivity rate, these results are in agreement with (Al-Bana et al., 2021; Hasan et al., 2013) and are inconsistent with certain studies such as (Lima et al., 2021; Rathore et al., 2010; Biswas et al., 2011).

Our results clearly suggested that the prevalence of HSV were high and can contribute to various congenital infections and other complications. Periodic screening for antenatal mothers thus becomes necessary to avoid HSV complications, which results in pregnancy related and neonatal morbidity.

Conclusions and Recommendations

The current study results showed that there was a high seroprevalence of both HSV-1 and HSV-2 among pregnant women in Ismailia city. Thus, pregnancy screening for HSVs is recommended to manage the complications caused by these viruses. HSVs can be a significant problem in pregnancy since they can infect newborns vertically and produce difficulties that can affect mother health and even cause maternal mortality. Furthermore, we discovered that detecting DNA in maternal serum using PCR improves the diagnostic value of serological testing.

Novelty Statement

The study presents the results of original research and reported have not been published elsewhere.

Author’s Contribution

Conceptualization: Hanaa H.A. Gomaa, Maha Anani and Amal H.A. Gomaa; Methodology: Hanaa H.A. Gomaa, Maha Anani and Amal H.A. Gomaa; Formal analysis and investigation: Shimaa A.S. Hasan and Maha Anani; Writing-original draft preparation: Shimaa A.S. Hasan; Writing-review and editing: Hanaa H.A. Gomaa, Maha Anani, Amal H.A. Gomaa and Nashwa Harb; Supervision: Hanaa H.A. Gomaa and Maha Anani

Conflict of interest

The authors have declared no conflict of interest.

References

Abdulkhaliq, R.J., Mohammed, S.T., and Abbas, A.A.H., 2017. Seroprevalence of rubella, cytomegalovirus, herpes, and Toxoplasma gondii in recurrent aborted women in Baghdad. Pak. J. Biotechnol., 14(3): 359-364.

Agyemang-Yeboah, F., Debrah, O., Timmy-Donkoh, E., Asmah, R., and Seini, M., 2019. SERO-prevalence of herpes simplex virus type 1 and type 2 among women attending routine Cervicare clinics in Ghana. Curr. Find Infect. Dis., ReDelve: RD-INF10005.

Al-Bana, M.N.Q., Abdullah, Q.Y.M., and Al-Arnoot, S., 2021. Seroprevalence and risk factors of herpes simplex virus type 2 among pregnant women in Dhamar city, Yemen. MOJ Biol. Med., 6(3): 108-114. https://doi.org/10.15406/mojbm.2021.06.00141

Al-Hakami, A.M., Paul, E., Al-Abed, F., Alzoani, A.A., Shati, A.A., Assiri, M.I. and Chandramoorthy, H.C. 2020. Prevalence of toxoplasmosis, rubella, cytomegalovirus, and herpes (TORCH) infections among women attending the antenatal care clinic, maternity hospital in Abha, Southwestern Saudi Arabia. Saudi Med. J., 41(7): 757. https://doi.org/10.15537/smj.2020.7.25121

Ali, M.K., Shia, J.S., and Al-Marsome, H.D., 2019. Detection of HSV and CMV in pregnant and miscarriage women by ELISA and real time PCR Assay. Res. J. Pharm. Technol., 12(9): 4090-4094. https://doi.org/10.5958/0974-360X.2019.00704.2

Al-Marzoqi, A.H., Kadhim, R.A., Al-Janabi, D.K., Hussein, H.J., and Al-Taee, Z.M., 2012. Seroprevalence study of IgG and IgM antibodies to toxoplasma, rubella, cytomegalovirus, Chlamydia trachomatis and Herpes simplex II in pregnancy women in Babylon Province. J. Biol. Agric. Healthc., 2(10): 159-164.

Alzahrani, A., Obeid, O., Almulhim, A., Awari, B., Taha, A., Al-Ajmi, F., and Al-Turkistani, H.K. 2005. Analysis of herpes simplex 1 and 2 IgG and IgM antibodies in pregnant women and their neonates. Saudi J. Obstet. Gynaecol., 5: 53.

Amar, O.A.O., Bajaj, H.K., Gupta, N., Singla, A., and Masih, H., 2015. Prevalence of herpes simplex virus in pregnant women from gangetic plain region of Allahabad, India. Adv. Microbiol., 5(6): 404. https://doi.org/10.4236/aim.2015.56041

Ameh, R.E., Aminu, M., and Ella, E.E., 2016. Seroprevalence of HSV-2 among women of reproductive age in Zaria, Kaduna state. Biol. Med., 8(7): 1.

Anaedobe, C.G., and Ajani, T.A., 2019. Co-infection of herpes simplex virus type 2 and HIV infections among pregnant women in Ibadan, Nigeria. J. Glob. Infect. Dis., 11(1): 19. https://doi.org/10.4103/jgid.jgid_56_18

Anjulo, A.A., Abebe, T., Hailemichael, F., and Mihret, A., 2016. Seroprevalence and risk factors of herpes simplex virus-2 among pregnant women attending antenatal care at health facilities in Wolaita zone, Ethiopia. Virol. J., 13(1): 1-8. https://doi.org/10.1186/s12985-016-0501-y

Anzivino, E., Fioriti, D., Mischitelli, M., Bellizzi, A., Barucca, V., Chiarini, F., and Pietropaolo, V. 2009. Herpes simplex virus infection in pregnancy and in neonate: Status of art of epidemiology, diagnosis, therapy and prevention. Virol. J., 6(1): 1-11. https://doi.org/10.1186/1743-422X-6-40

Assayaghi, R., Al-Jaufy, A., and Al-Robasi, A., 2017. Seroprevalence and risk factors for herpes simplex virus type 1 and 2 among women attending antenatal and gynecology clinics in Sana’a city Yemen. J. Hum. Virol. Retrovirol., 5(4): 00163. https://doi.org/10.15406/jhvrv.2017.05.00163

Ayoub, H.H., Chemaitelly, H., and Abu-Raddad, L.J., 2019. Characterizing the transitioning epidemiology of herpes simplex virus type 1 in the USA: Model-based predictions. J. BMC Med., 17(1): 1-12. https://doi.org/10.1186/s12916-019-1285-x

Biswas, D., Borkakoty, B., Mahanta, J., Walia, K., Saikia, L., Akoijam, B.S., and Zomawia, E. 2011. Seroprevalence and risk factors of herpes simplex virus type-2 infection among pregnant women in Northeast India. BMC Infect. Dis., 11(1): 1-9. https://doi.org/10.1186/1471-2334-11-325

Bochner, A.F., Madhivanan, P., Niranjankumar, B., Ravi, K., Arun, A., Krupp, K., and Klausner, J.D. 2013. The epidemiology of herpes simplex virus type-2 infection among pregnant women in rural Mysore taluk, India. J. Sex. Trans. Dis., 2013. https://doi.org/10.1155/2013/750415

Diamreyan, O.O., Amala, S.E., and Nwokah, E.G., 2021. Prevalence of herpes simplex virus type-2 infection among pregnant women in port harcourt rivers State, Nigeria. Am. J. Biomed. Sci., 13(2). https://doi.org/10.5099/aj210200070

Dolar, N., Serdaroglu, S., Yilmaz, G., Ergin, S., and Venereology. 2006. Seroprevalence of herpes simplex virus type 1 and type 2 in Turkey. J. Eu. Acad. Dermatol. Venereol., 20(10): 1232-1236. https://doi.org/10.1111/j.1468-3083.2006.01766.x

Đorđević, H., 2006. Serological response to herpes simplex virus type 1 and 2 infection among women of reproductive age. Med. Pregl., 59(11-12): 591-597. https://doi.org/10.2298/MPNS0612591D

Duran, N., 2004. Serological evaluation of HSV-1 and HSV-2 infection in pregnancy. Turkish J. Med. Sci., 34(2): 97-101.

El-Amin, E.O., Elamin, O.E., Ahmed, R.A.M., Abdulla, A.K., Elamin, S.E., and Elhaj, H.I. 2013. Sero-prevalence of herpes virus infection in sudanese pregnant women. Trop. Med. Health Surg., 1: 1-4.

Fazza, M.A.A.M., 2016. Seroprevalence of herpes simplex type 2 virus among pregnant women attending some Hospitals in Khartoum State (Doctoral dissertation, Sudan University of Science and Technology).

Finger-Jardim, F., Avila, E.C., da Hora, V.P., Gonçalves, C.V., de Martinez, A.M.B., and Soares, M.A., 2017. Prevalence of herpes simplex virus types 1 and 2 at maternal and fetal sides of the placenta in asymptomatic pregnant women. Am. J. Reprod. Immunol., 78(1): e12689. https://doi.org/10.1111/aji.12689

Ghazi, H.O., Telmesani, A.M., and Mahomed, M.F., 2002. TORCH agents in pregnant Saudi women. Med. Princ. Pract., 11(4): 180-182. https://doi.org/10.1159/000065813

Goda, H., Warda, O., Hady, E.S., Nezar, M., El-Said, M., El-Refaie, A.A., and Ragab, A.A. 2007. Can infection with cytomegalovirus, parvovirus B19 and herpes simplex virus cause recurrent pregnancy loss? Egypt. J. Fertil. Steril., 11(1): 15-22. https://doi.org/10.21608/egyfs.2007.4950

Gupta, R., Warren, T., and Wald, A., 2007. Genital herpes. Lancet, 370(9605): 2127-2137. https://doi.org/10.1016/S0140-6736(07)61908-4

Hasan, A.R.S., Al-Duliami, A.A., Hwaid, A.H., Mageed, W.A., and Fadeel, Z.G., 2013. Seroprevalence of anti-herpes simplex virus type2 IgG, IgM antibodies among pregnant women in Diyala province. Diyala J. Med., 5(1): 36-43.

Kimberlin, D.W., 2007. Herpes simplex virus infections of the newborn. Semin. Perinatol., 31(1): 19–25. https://doi.org/10.1053/j.semperi.2007.01.003

Kucera, P., Gerber, S., Marques-Vidal, P., and Meylan, P.R., 2012. Seroepidemiology of herpes simplex virus type 1 and 2 in pregnant women in Switzerland: An obstetric clinic based study. Eur. J. Obst. Gynecol. Reprod. Biol., 160(1): 13-17. https://doi.org/10.1016/j.ejogrb.2011.09.030

Kurewa, N.E., Mapingure, M.P., Munjoma, M.W., Chirenje, M.Z., Rusakaniko, S., and Stray-Pedersen, B., 2010. The burden and risk factors of sexually transmitted infections and reproductive tract infections among pregnant women in Zimbabwe. BMC Infect. Dis., 10(1): 1-8. https://doi.org/10.1186/1471-2334-10-127

Lima, L.R.P., Fernandes, L.E.B.C., Villela, D.A., Morgado, M.G., Pilotto, J.H., and de Paula, V.S., 2018. Co-infection of human herpesvirus type 2 (HHV-2) and human immunodeficiency virus (HIV) among pregnant 21. https://doi.org/10.1080/09540121.2017.1378798

Lima, L.R., Dos-Santos, P.J.D.S., De Almeida, N.A., De Meneses, M.D., Aguiar, S.F., Fernandes, C.A., and de Paula, V.S. 2021. Seroprevalence of human alphaherpesvirus 1 and 2 among pregnant women infected or uninfected with Zika virus from Rio de Janeiro, Brazil. J. Med. Virol., 93(6): 3383-3388. https://doi.org/10.1002/jmv.26665

Looker, K.J., Magaret, A.S., May, M.T., Turner, K.M.E., Vickerman, P., Newman, L.M., and Gottlieb, S.L. 2017. First estimates of the global and regional incidence of neonatal herpes infection. Lancet Glob. Health, 5(3): e300-e309. https://doi.org/10.1016/S2214-109X(16)30362-X

Mahmood, M.N., and Najem, M.H., 2020. Detection of infection by Toxoplasma and Herpes simplex virus 2 among women exposed to abortion in Ninavah province/ Iraq. Tikrit J. Pure Sci., 25(4): 31-35.

Mezher, M.N., Mejbel, F.A., and Hussein, H.K., 2018. Detection of herpes simplex-2 virus in women with spontaneous abortion in Al-Najaf City, Iraq. J. Pharm. Sci. Res., 10(5): 0975.

Miranda, C.A., Lima, E.G., De Lima, D.B., Cobucci, R.N., Cornetta Mda, C., Fernandes, T.A.A.D.M., and Fernandes, J.V. 2014. Genital infection with herpes simplex virus types 1 and 2 in women from natal, Brazil. ISRN Obstet. Gynecol., 2014: 323657. https://doi.org/10.1155/2014/323657

Munjoma, M.W., Kurewa, E.N., Mapingure, M.P., Mashavave, G.V., Chirenje, M.Z., Rusakaniko, S., and Stray-Pedersen, B., 2010. The prevalence, incidence and risk factors of herpes simplex virus type 2 infection among pregnant Zimbabwean women followed up nine months after childbirth. BMC Women’s Health, 10(1): 1-8. https://doi.org/10.1186/1472-6874-10-2

Obeid, O.E., 2007. Prevalence of herpes simplex virus types 1 and 2 and associated sociodemographic variables in pregnant women attending King Fahd Hospital of the University. J. Family Commun. Med., 14(1): 3.

Okonko, I.O., and Cookey, T.I., 2015. Seropositivity and determinants of immunoglobulin-G (IgG) antibodies against Herpes simplex virus (HSV) types -1 and -2 in pregnant women in Port Harcourt, Nigeria. Afr. Health Sci., 15(3): 737-747. https://doi.org/10.4314/ahs.v15i3.6

Özdemir, M., Kalem, F., Feyzioğlu, B., and Baysal, B., 2011. Investigation of viral pathogens during pregnancy in a city region in Turkey. Anatol. J. Clin. Investig., 5: 78-81.

Patton, M.E., Bernstein, K., Liu, G., Zaidi, A., and Markowitz, L.E., 2018. Seroprevalence of herpes simplex virus types 1 and 2 among pregnant women and sexually active, nonpregnant women in the United States. Clin. Infect. Dis., 67(10): 1535-1542. https://doi.org/10.1093/cid/ciy318

Rajendiran, P., Saravanan, N., Ramamurthy, M., Sankar, S., David, N., Nair, A., and Sridharan, G. 2021. Seroprevalence of TORCH-S infections among pregnant woman: A study from Vellore District (South India). Med. Glob. Surv., 12(2): 170-170. https://doi.org/10.4103/jnsbm.JNSBM_103_20

Rathore, S., Jamwal, A., and Gupta, V., 2010. Herpes simplex virus type 2: Seroprevalence in antenatal women. India. J. Sex. Trans. Dis. Aids, 31(1): 11. https://doi.org/10.4103/0253-7184.68994

Sauerbrei, A., Schmitt, S., Scheper, T., Brandstädt, A., Saschenbrecker, S., Motz, M. and Wutzler, P. 2011. Seroprevalence of herpes simplex virus type 1 and type 2 in Thuringia, Germany, 1999 to 2006. Eurosurveillance, 16(44): 20005. https://doi.org/10.2807/ese.16.44.20005-en

Sert, U.Y., Ozgu-Erdinc, A.S., Saygan, S., and Engin-Ustun, Y., 2020. Herpes simplex infection during pregnancy, results of a tertiary referral center in Turkey. Z Geburtshilfe Neonatol., 224(1): 22-25. https://doi.org/10.1055/a-0842-6941

Sifakis, S., Koumantakis, E., Koffa, M., Ergazaki, M., and Spandidos, D., 1998. Detection of herpes simplex virus (HSV) in aborted material using the polymerase chain reaction technique. Gynecol. Obstet. Invest., 45(2): 109-115. https://doi.org/10.1159/000009936

Stephenson-Famy, A., and Gardella, C., 2014. Herpes simplex virus infection during pregnancy. Obst. Gynecol. Clin., 41(4): 601-614. https://doi.org/10.1016/j.ogc.2014.08.006

Straface, G., Selmin, A., Zanardo, V., De Santis, M., Ercoli, A., and Scambia, G. 2012. Herpes simplex virus infection in pregnancy. Infect. Dis. Obst. Gynecol., 2012. https://doi.org/10.1155/2012/385697

Whitley, R., and Baines, J., 2018. Clinical management of herpes simplex virus infections: Past, present, and future. F1000Res., 7. https://doi.org/10.12688/f1000research.16157.1

Xu, F., Markowitz, L.E., Gottlieb, S.L., and Berman, S.M., 2007. Seroprevalence of herpes simplex virus types 1 and 2 in pregnant women in the United States. Am. J. Obstet. Gynecol., 196(1): 43 e41-46. https://doi.org/10.1016/j.ajog.2006.07.051