Review Article
Molecular Studies on Some Virulent and Multi-Drug Resistant Cattle Klebsiella Strains and their Heamatobiochemical Impacts
Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura1, Mohamed Samir2,3, Amira Mohamed Mazid4, Mohamed F.M. Farag5
1Animal Health Research Institute (AHRI), Ismailia Branch, Agriculture Research Center (ARC), 41511, Egypt; 2Department of Zoonosis, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt; 3Pirbright Institute, Pirbright, Surrey, United Kingdom; 4Division of Infectious Diseases, Department of Veterinary Medicine, Arish University, North Sinai, 45511, Egypt; 5Department of Clinical Pathology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt.
Abstract | Multidrug resistant Klebsiella spp. (MDR) and the extended-spectrum 𝛽-lactamases (ESBL) producing strains are one of the dominantly pathogenic bacteria that involved in bovine respiratory infections. Its spreading problem is growing rapidly especially it could combine resistance with high-level of virulence traits that make it is more difficult to be treated. This study provides insight into the respiratory infections by Klebsiella spp. and its MDR profile in bovine cases, as well as the potential target genes that were involved in the links between virulence determinants and MDR. The bacterial examination of 200 nasal swabs and 30 lung tissue samples (taken from 30 emergency slaughtered cattle) indicated that Klebsiella spp. was recovered in 55/230 (24%) of all samples with a high proportion of K. pneumoniae (18.7%). In-vitro antibiogram exhibited a wide MDR phenotype. The virulence genes (fimA, aerobactin, rmpA and magA) were exhibited in 90%, 85%, 90% and 80% of the tested isolates, respectively. Moreover, ESBL-resistant markers (blaCTX-M, blaTEM and blaSHV) were found in 100%, 85% and 80% of the same isolates, respectively. A significant positive correlation (R = 0.7) was reported between aerobactine and magA virulence genes and blaTEM and blaSHV ESBL resistant genes, respectively. In addition, the hemato-biochemical analysis of 100 blood samples (50 from naturally infected and 50 from apparently healthy cattle) revealed significant decreases in the haemobiogram parameters levels meanwhile, leucogram picture total proteins, globulins, urea, creatinine levels were significantly increased in klebsiella-infected animals. An alarming increase in MDR and ESBL klebsiella bovine infections necessitates a controlled use of antibiotics in cattle farms and warrants sustainable monitoring of antibiotic emergence events and further studies for their genetic phenotypic interrelation. Moreover, the haemato-biochemical alterations in the klebsiella infected cattle could be act as biomarkers for bacterial infections.
Keywords | Klebsiella spp, ESBL, Heamato-biochemical; antibiotics, MDR, Virulence, Resistant, Hemobiogram, Leucogram, Cattle farms
Received | December 05, 2022; Accepted | January 05, 2023; Published | February 23, 2023
*Correspondence | Ghada A. Ibrahim, Animal Health Research Institute (AHRI), Ismailia Branch, Agriculture Research Center (ARC), 41511, Egypt; Email: [email protected]
Citation | Ibrahim GA, Helal MS, Kamoura NAE, Samir M, Mazid AM, Farag MFM (2023). Molecular studies on some virulent and multi-drug resistant cattle klebsiella strains and their heamatobiochemical impacts. Adv. Anim. Vet. Sci. 11(3):485-498.
DOI | https://dx.doi.org/10.17582/journal.aavs/2023/11.3.485.498
ISSN (Online) | 2307-8316
Copyright: 2023 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Klebsiella organisms are opportunistic nosocomial pathogens primarily associated with variety of infectious diseases including upper respiratory tract infections especially pneumonia, also, mastitis, blood stream infections and pyogenic liver abscesses in animals and mammals (Butaye et al., 2021; Xu et al., 2022).
Klebsiella spp. possesses a main crucial feature that is their ability to emerge multi antimicrobial resistance (AMR) phenotypes. They are well known with its high phenotypic and genetic diversity, in particular regarding antimicrobial-resistance genes (ARGs) (Wyres and Holt, 2018). Consequently, a particular concerning is given to the emerged MDR and hypervirulent K. pneumoniae (hvKP) strains due to their rapid geographic spread. Even though it is still unclear how exactly K. pneumoniae’s virulence and antibiotic resistance work together (Wang et al., 2020).
MDR bacterial phenomena is growing concern due to the irrational indiscriminate use of many antibiotics in veterinary field especially in the absence of legislation regulating the antimicrobial agents use in countries like Egypt (Cheng et al., 2018). The spread and dissemination of antimicrobial resistance (AMR) is linked with the genetic mobile elements (MGS) like plasmids, integrons, transposons and insertion sequences (Wareth and Neubauer, 2021). Integrons are found to be widely disseminated in most clinical isolates of AMR Gram-negative bacteria. Integrons also, could capture the individual ARGs and enhance their transcription and expression limiting the chance to treat infectious diseases in humans and animals (Meshref et al., 2021). Also, MGS could pass the ESBL resistant genes through; into different animal species or humans or even to the surrounding environment via contaminated soil and water, especially in poor hygienic or bad sanitation conditions (Wareth and Neubauer, 2021).
ESBL resistance traits of the family Enterobacteriacea including Klebsiella spp. are of universe public health alarm in many livestock animals and human (Nossair et al., 2022). Cattle might act as the potential reservoir for resistant ESBL (Extended Spectrum Beta Lactamase) Klebsiella spp. that could exist naturally in their nostril or intestine, invading lung tissues in the presence of predisposing factors with subsequent infection (Montso et al., 2019; Shin et al., 2021; Wareth and Neubauer, 2021).
The data describing ESBL-mediated resistance in Klebsiella spp. in bovine or ESBL detection in veterinary medicine is still limited; however, ESBL-mediated resistance of Klebsiella spp. against β-lactam drugs were recorded (Lee et al., 2021). ESBL bacteria could produce extended-spectrum β-lactamases enzymes, making them survive longer than other Gram -ve bacteria in the environment. MDR ESBL K. pneumoniae strains could put human and animal health at risk since it limited the therapeutic choices prompting the usage of colistin antibiotic, which was no longer utilized owing to toxicity (Abdeltawab et al., 2022). ESBL strains could harbour (blaCTX-M, blaTEM and blaSHV) genes. These genes were most frequently identified in animals and humans (Wareth and Neubauer, 2021). Moreover, ESBL genes could be mutated, creating novel enzymes with extended substrate proles. Indeed, over 300 distinct ESBL genes were recorded, which had been classified according to their amino acid sequence into nine different structural and evolutionary groups (Abdeltawab et al., 2022).
In addition, for the virulence factors of Klebsiella spp., they own several virulence traits encompassing fimbriae, capsular polysaccharides, lipopolysaccharides, and siderophores that had been encoded by fimH, rmpA, maga, uge, wabg, iuc, iro, and other virulence genes (Remya et al., 2019). Moreover, K. pneumoniae’s infectivity and pathogencity was found to be correlated with the ability to express their virulence genes. A proficient pathogen is virulent, resistant to antibiotics, and epidemic. The interplay between resistance and virulence is poorly understood, and is receiving great (Xu et al., 2022).
Furthermore, bovine respiratory diseases (BRD) had been considered as one of the major serious health problems that commonly occurred in cattle farms around the world (Fararh et al., 2017). These respiratory diseases were found to be directly impaired lung functions and acid-base balance in the animal body. Also, it could relatively alter the normal ratio of other blood components (Hb, RBCs, PCV), total and differential leucocytic count (Kumar et al., 2018). Moreover, they were intimately bound up with marked deterioration in the liver and kidney functions and affect seriously on the blood proteins in a previous study in Košice, Slovak Republic (Metwally et al., 2017).
Hence, this study aimed to monitor the prevalence of MDR and ESBL-mediated resistant Klebsiella spp. in cattle farms in Egypt studying their ESBL resistance genotypic phenotypic relation pattern with a special regard to estimation of the modulatory changes on different haemato-biochemical indices in naturally infected cattle.
Materials and Methods
Animals
This investigation was undertaken between August 2021 and June 2022. A total of two hundred animals from various private cattle farms in the province of Ismailia, Northern Egypt; were clinically assessed to be sure that they were free from any external, internal or any blood parasites. All examined animals were aged between 1-3 years old. Then, these animals were divided into two groups based on the health condition and clinical signs; the first group (n=100) that exhibited respiratory symptoms such as fever (>39.5 °C), fast breathing, coughing, and nasal discharge, while the second group was control apparently healthy (n=100) and exhibited no symptoms.
The first part of this study discussed the bacterial isolation with a special regard to Klebsiella species, so, 200 nasal swabs from diseased cattle (n=100) and from apparently healthy (n=100) were gathered and also, about thirty lung tissue samples were collected from some emergency slaughtered cases of cattle. All these samples were then transferred to the bacteriological laboratory without delay for further investigations for of Klebsiella species under aseptic conditions.
In addition, the second part of the study included the estimations of haemato-biochemical alterations inside the animal body, hence, one hundred whole blood samples only were taken aseptically from the jugular veins from both diseased (N=50) and apparently healthy (N=50) animals. Each blood sample was instantly divided into two tubes; one tube contained EDTA anticoagulant for direct haematological studies, while the other was a plain tube without anticoagulant for serum isolation; used for biochemical analysis.
Isolation and identification of Klebsiella species
Nasal swabs and lung tissue samples were cultivated onto HiCrome Klebsiella selective agar media (Himedia, India) and incubated at 37°C for 24h. The suspected purple colonies were then transferred onto EMB (eosin methylene blue) (Oxoid, Uk) and MacConkey’s agar (Oxoid, UK), then re-incubated at 37°C for 24h for further confirmation. The presumptive isolates were biochemically identified on triple sugar iron (TSI; Oxoid, UK) agar and IMVC (indole, methyl red, Voges-Proskauer and citrate) tests (Quinn et al., 2002). For screening of the recovered isolates for ESBL production; pure colonies of the identified Klebsiella species that were taken from HiCrome Klebsiella selective agar media were; sub-cultured on Brilliance ESBL agar plates (Montso et al., 2019) (Oxoid, UK) and then incubated aerobically at 37°C for 24 hours. All klebsiella isolates, which gave green colonies on Brilliance ESBL agar plates were selected also for further confirmation by the Modified Double Disc Synergy Test (MDDST) (Paterson and Bonomo, 2005).
Antimicrobial susceptibility testing
The Kirby-Bauer disk diffusion susceptibility test using Muller Hinton agar (Oxoid, UK) medium evaluated the resistance of all recovered Klebsiella spp. isolates. All the recovered isolates were cultured on Muller Hinton (MH) broth (Oxoid, UK), incubated for 24 hours at 37°C, then cultivated on MH agar (Oxoid, UK) medium and re-incubated. The results were interpreted according to the Clinical and Laboratory Standards Institute (CLSI 2022). A panel of fifteen used antibiotic discs (Oxoid, UK) including ampicillin, erythromycin, tetracycline, streptomycin, norfloxacin, cefepime, cefotaxime, ciprofloxacin, cefadroxil, amoxiclav, colistin, gentamicin, aztreonam, imipenem and amikacin.
PCR investigations of different recovered Klebsiella spp. isolates
Genomic DNA was extracted from presumptive isolates with a QIAamp DNA Mini kit (Qiagen, GmbH, Germany) according to the manufacturer’s instructions. PCR identification gene (16S-23S ITS gene) was tested to confirm the identity of the recovered K. pneumoniae isolates. Also, aerobactin, rmpA and fimA virulence genes were assigned to detect the virulence traits of all isolates. In addition, based on phenotypic antimicrobial resistance profiles, MDR ESBL Klebsiella spp. isolates were screened for integron (Int1) and ESBL genes (blaCTX-M, blaTEM and blaSHV). PCR amplification of all genes was carried out using specific oligonucleotide primers and reaction cycling conditions, as listed in Table 1. The positive control reference strain (K. pneumonia; ATCC BAA- 1705) was kindly obtained from Reference Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Giza, Egypt) and the negative control was (PCR reaction mixture without DNA).
Hematological analysis
EDTA collected blood samples were performed for estimation of total red blood cells count (RBCs) count, hemoglobin (Hb) concentration, packed cell volume (PCV), total leukocytic count (TLC) and differential leukocytic counts as previously described by (Feldman et al., 2000).
Biochemical analysis
The serum total proteins were evaluated by the spectrophotometric method mentioned by (Doumas et al., 1981). The calorimetric method using the dye-binding procedure with bromocresol green is used to measure albumin (Doumas et al., 1971). The serum globulin could be attained mathematically by subtracting albumin from total protein according to (Chernecky and Barbara, 2008). Albumin/globulin (A/G) ratio was obtained by dividing the albumin value by the globulin value as in (Fischbach and Dunning, 2009).Aspartate transaminase (AST), Alanine aminotransferase (ALT) were calculated according to (Reitman and Frankel, 1957).
Table 1: Oligonucleotide primer sequences, cycling conditions and predicted sizes of PCR products for detecting different gene Markers of Klebsiella spp.
|
Function of gene |
Primers sequences |
Amplified segment (bp) |
Initial denaturation ˚C/min |
Actual cycles (35 cycles) °C/sec |
Final extention °C/ min |
Reference |
||
|
Denatur ation |
Annealing |
Extension |
||||||
|
Confirmation gene for species |
ATTTGAAGAGGTTGCAAACGAT |
150 |
94/5 |
94/30 |
55/30 |
72/30 |
72/7 |
(Turton et al ., 2010) |
|
TTCACTCTGAAGTTTTCTTGTGTTC |
||||||||
|
fimA Virulence gene |
CGGACGGTACGCTGTATTTT |
436 |
94/5 |
94/30 |
55/40 |
72/45 |
72/ 10 |
(Alcántar-Curiel et al., 2013) |
|
GCTTCGGCGTTGTCTTTATC |
||||||||
|
Aerobactin virulence gene |
GCATAGGCGGATACGAACAT |
556 |
94/5 |
94/30 |
50/40 |
72/45 |
72/ 10 |
(Siu et al., 2011) |
|
CACAGGGCAATTGCTTACCT |
||||||||
|
rmpA Virulence gene |
ACTGGGCTACCTCTGCTTCA |
535 |
94/5 |
94/30 |
50/40 |
72/45 |
72/ 10 |
(Yeh et al., 2007) |
|
CTTGCATGAGCCATCTTTCA |
||||||||
|
magA Virulence gene |
GGTGCTCTTTACATCATTGC |
1282 |
94/5 |
94/30 |
50/40 |
72/60 |
72/ 10 |
|
|
GCAATGGCCATTTGCGTTAG |
||||||||
|
Int1 Class 1 integron gene |
CCTCCCGCACGATGATC |
280 |
94/5 |
94/30 |
54/30 |
72/30 |
72/ 7 |
(Kashif et al., 2013) |
|
TCCACGCATCGTCAGGC |
||||||||
|
blaCTX-M ESBL resistance gene |
ATGTGCAGYACCAGTAARGTKATGGC |
593 |
94/5 |
94/30 |
54/40 |
72/45 |
72/ 10 |
(Archambault et al., 2006) |
|
TGGGTRAARTARGTSACCAGAAYCAGCGG |
||||||||
|
blaTEM ESBL resistance gene |
ATCAGCAATAA-ACCAGC |
516 |
94/5 |
94/30 |
54/40 |
72/45 |
72/ 10 |
(Colom et al., 2003) |
|
CCCCGAAGAAC-GTTTTC |
||||||||
|
blaSHV ESBL resistance gene |
AGGATTGACTG-CCTTTTTG |
392 |
94/5 |
94/30 |
54/40 |
72/45 |
72/ 10 |
|
|
ATTTGCTGATT-TCGCTCG |
||||||||
Also, urea (Patton and Crouch, 1977) and creatinine (Aminlari and Vaseghi, 1987) concentrations were also evaluated.
Also, the serum concentrations of calcium (Ca, mmol/l), (Gindler and King, 1972) and magnesium (Mg, mmol/l) (Smith, 1955) were analyzed using atomic absorption spectrophotometer (M 2380; PERKIN-ELEMER, AHRI). Sodium and potassium values were tested by atomic absorption spectrophotometer. Also, zinc and iron were evaluated by atomic absorption spectrophotometer (A Analyst 100, Perkin Elmer).
Statistical analysis
The obtained data in this study were edited in Microsoft Excel (Microsoft Corporation, Redmond, WA, USA). Before conducting the main statistical analysis, the data were checked for normality according to A Shapiro-Wilk test (Mohd Razali and Yap, 2011). T-Test (Proc test, (SAS, 2012) was used to compare between apparently healthy and diseased cattle for serum biochemical parameters and minerals concentrations. The results were expressed as means ± SE. Fisher’s Exact Test was performed to detect the significant relationship between the cattle with respiratory disease and the other apparently healthy for the prevalence ratio of Klebsiella spp. Moreover, the significant differences between the antibiotic resistance profiles of different used antibiotics in Klebsiella spp. were calculated according to afore mentioned test. The correlation analyses among various bacterial features were calculated and visualized using Heatamply_cor function within heatmaply package in R software v. 4.2.1 (Galili et al., 2017). Figures were fitted by the Graph-Pad Prism software 5.0 (Graph Pad, USA). Statistical significance was set at p-value less than 0.05.
Ethical approvement
All research protocols were carried out in accordance with regulations and approved guidelines of the Institutional Ethics Committee on Animal Care and Use established by the Faculty of Veterinary Medicine, Zagazig University (ZU-IACUC/2/F/902/2022). This article does not contain any studies with human participants performed by any of the authors.
Results and Discussion
Phenotypic characterization of the recovered Klebsiella spp. isolates
The recovered isolates were identified phenotypically as Klebsiella spp. The isolates gave the characteristic purple-magenta mucoid colonies on HiCrome Klebsiella selective agar base, lactose fermenting mucoid colonies on MacConkey’s agar, and large mucoid pink-to-purple colonies on EMB agar medium. Moreover, biochemically they gave positive reactions for Voges-Proskauer, citrate utilization, lysine decarboxylase and urease tests. However, they were negative for indole and methyl red tests. On TSI agar media, Klebsiella isolates produced acid slant/ acid butt and no H2S production. In addition, ESBL-producing Klebsiella isolates were identified by the green colonies on Brilliance ESBL agar plates.
The prevalence and distribution of Klebsiella spp. in cattle farms
There was a significant relationship between the prevalence of Klebsiella spp. and different types of cattle whether diseased, apparently healthy, or dead (p=0.001). Also, Table 2 showed that 55 Klebsiella isolates were recovered from a total of 230 analyzed samples in 24%. Forty-three (43/230) positive K. pneumoniae were recovered from all samples (18.7%). K. pneumoniae were recovered from 100 nasal swabs from respiratory-diseased animals in 18%, while it was 11% from apparently healthy ones. However, 14 lung tissue samples from emergency slaughtered cattle that were positive for K. Rhinoscleromatis were recovered in (6% and 4%) from diseased and healthy animals, respectively.
Antibiotic susceptibility testing of different recovered Klebsiella spp. isolates
MDR strains of Klebsiella spp. were detected and confirmed with phenotypic antibiotic sensitivity test. As shown in Table 3 and Figure 1, the recovered isolates belonging to all analyzed spp. shared a maximum resistance (100%) to ampicillin, erythromycin,tetracycline and streptomycin. Other Klebsiella spp. showed differential phenotypic resistance to antimicrobials. In K. pneumonia, the resistance rate to cefepime, cefotaxime, ciprofloxacin and colistin antibiotics (range: 83.7-95.3%)
Table 2: Prevalence of different Klebsiella spp. in diseased and apparently healthy cattle.
|
Sample and animal health |
Diseased animals (Nasal swab N=100) |
App. Healthy animals (Nasal swab N=100) |
Dead animals (lung N=30) |
Total (230) |
p value |
|
+ve (%) |
+ve (%) |
+ve (%) |
+ve (%) |
||
|
K. Pneumoniae |
18/100 (18%) |
11/100 (11%) |
14/30 (46.7%) |
43/230 (18.7%) |
0.001 |
|
K. Rhinoscleromatis |
6/100 (6%) |
4/100 (4%) |
0 |
10/230 (4.3%) |
0.516 |
|
K. Ozaenae |
1/100 (1%) |
0 |
1/30 (3.3%) |
2/230 (0.9%) |
0.362 |
|
Total recovered Klebsiella isolates |
25/100 (25%) |
15/100 (15%) |
15/30 (50%) |
55/230 (24%) |
0 |
|
p-value |
0.001 |
0.096 |
0.0001 |
0 |
0.001 |
Table 3: Antibiotic resistance profile of recovered Klebsiella spp. isolates.
|
Antibiotic disc |
Antibiotic group |
Abbreviation |
Disc conc. (µg) |
K. pneumoniae recovered isolates |
|||||||||||||
|
K. Pneumoniae (N=43) |
K. Rhinoscleromatis (N=10) |
K. Ozaenae (N=2) |
|||||||||||||||
|
S |
I |
R |
R% |
S |
I |
R |
R% |
S |
I |
R |
R% |
||||||
|
Ampicillin |
Aminopenicillin |
AMP |
10 |
- |
- |
43/43 |
100% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Macrolides |
ERY |
10 |
- |
- |
43/43 |
100% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
|||
|
Tetracycline |
Tetracycline |
TE |
30 |
- |
- |
43/43 |
100% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Streptomycin |
Aminoglycosides |
ST |
10 |
- |
- |
43/43 |
100% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Norfloxacin |
Fluoroquinolone |
Nor |
10 |
- |
1/43 |
42/43 |
97.7% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Cefepime |
4th generation cephalosporin |
FEB |
30 |
2/43 |
- |
41/43 |
95.3% |
2/10 |
1/10 |
7/10 |
70% |
2/2 |
- |
- |
- |
||
|
Cefotaxime |
3rd generation cephalosporin |
CTX |
30 |
-- |
3/43 |
40/43 |
93% |
1/10 |
1/10 |
8/10 |
80% |
- |
- |
2/2 |
100% |
||
|
Ciprofloxacin |
Fluoroquinolone |
CIP |
10 |
1/43 |
2/43 |
40/43 |
93% |
2/10 |
- |
8/10 |
80% |
- |
- |
2/2 |
100% |
||
|
Cefadroxil |
1st generation cephalosporin |
CFT |
30 |
- |
4/43 |
39/43 |
90.7% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Amoxiclav |
Aminopenicillin |
AMC |
20 |
- |
5/43 |
38/43 |
88.4% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Colistin |
Polymyxin |
C |
30 |
4/43 |
3/43 |
36/43 |
83.7% |
7/10 |
1/10 |
2/10 |
20% |
2/2 |
- |
- |
- |
||
|
Gentamicin |
Aminoglycosides |
GEN |
10 |
11/43 (25.6%) |
5/43 |
27/43 |
62.8% |
- |
1/10 |
9/10 |
90% |
- |
- |
2/2 |
100% |
||
|
Imipenem |
Carbapenem |
IP |
10 |
32/43 (81.4%) |
- |
11/43 |
25.6% |
2/10 |
- |
8/10 |
80% |
- |
- |
2/2 |
100% |
||
|
Aztreonam |
Monobactam |
AZM |
30 |
34/43 (79%) |
- |
9/43 |
21% |
- |
- |
10/10 |
100% |
- |
- |
2/2 |
100% |
||
|
Amikacin |
Aminoglycosides |
AK |
30 |
26/43 (60.5%) |
5/43 |
10/43 |
23.3% |
1/10 |
- |
9/10 |
90% |
- |
- |
2/2 |
100% |
||
R%: resistance percentage.
was higher than that in K. Rhinoscleromatis (range 20-80%). on the other hand, K. pneumonia showed variable resistance percentages to norfloxacin (97.7%), cefadroxil (90.7%), amoxiclav (88.4%) and gentamicin (62.8%), imipenem (25.6%), amikacin (23.3%) and aztreonam (21%), 100% resistance to all analyzed antibiotic. Moreover, ESBL resistance traits of isolated klebsiella strains were positive by the phenotypic results of Modified Double Disc Synergy Test (MDDST).
Molecular identification of virulence and resistant genes of the recovered Klebsiella spp. isolates
The recovered klebsiella isolates were confirmed with PCR technique for the species specific (16S-23S ITS) gene of K. pneumoniae as illustrated in (Supplementary Figure 1). However, the virulence (fimA, aerobactin, rmpA and magA) genes were detected in 90%, 85%, 90% and 80% of all examined klebsiella isolates, respectively. The pattern of occurrence of resistance genes was consistent among isolates. Moreover, class 1 integron (Int1) gene was detected in 100% of the tested isolates (Supplementary Figure 2). Furthermore, ESBL resistant genes (BlaCTX-M, blaTEM and blaSHV) were detected in 100%, 85% and 80% of the same isolates (Figure 2). In both K. pneumonia and K. Rhinoscleromatis, BlaCTX-M was top detected gene followed by BlaSHV and blaTEM genes (Figure 1). However, BlaCTX-M and BlaSHV showed similar presence, which was higher than Bla TEM gene. Regarding virulence genes, MagA was the top detected gene in K. pneumonia and K. Rhinoscleromatis. RampA was the least detected gene in K. pneumonia and Aerobactin was the least detected gene in K. Rhinoscleromatis. K. Ozaenae showed similar presence pattern for virulence genes as K. Rhinoscleromatis.
Association between antimicrobial resistance, virulence traits and disease status of cattle
The distribution of antimicrobial and virulence traits in bacterial isolates differed according to the animal status, from which the bacteria were isolated (Figure 2). We used variance as a measurment of how much of the difference is the occurrence of one trait between the appraently healthy and diseased animals. Regarding antimicrobial resistance phenotypes, the rate of resistance to CTX and CIP was the mosty different. Resistance to 60% (6/10) of the analyzed traits were of higher rate in isolates from diseased aninmals compared to those from appraently healthy animals, whereas only 30% (3/10) of these were more frequent in isolates from appranetly healthy animals, and only resistance to ERY was similar in both condition. With regard to antimicrobial resistance genes, blaTEM showed the most variable rate of resistance between isolates from appraently healthy and diseased animals. Two of the analyzed genes (blaTEM and blaSHV) were more frequent in isolates from diseased than those from healthy cattle. Regarding virulence genes, rampA, aerobactin and magA were more enriched in isolates from diseased animals compared to those from apparently healthy animals, whereas resistance to fimA was more prevalent in isolates from appraently animals.
Correlation analyses of antimicrobial resistance and virulence traits
As shown in Figure 3, we observed significant high positive correlation among antimicrobial resistance phenotypes. For instance, streptomysin (ST) and amoxiclave (AMC) (R = 0.46, p-value = 0.0002), tetracyclin (TE) and cefadroxil (CFT) (R = 0.48, p-value = 0.0001). Lower correlation was detected between norfloxacin (NOR) and cefotaxime (CTX) (R = 0.2, p-value = 0.03) and also between erythromycin (ERY) and amoxiclave (AMC) (R = 0..3, p-value = 0.01). The phenotypic resistance against cefadroxil (CFT) was correlated weakly positive, but it was significantly with both blaCTX-M and blaTEM ESBL resistant genes (R= 0.28, p-value = 0.02, each).
Regarding the correlation between antimicrobial resistance and virulence genes, the aerobactine virulance and blaTEM resistant genes exhibited the highest positive signficiant correlation (R= 0.7, p-value < 0.0001). Similarly, magA and blaSHV were found to be correlated highly positively and significantly (R = 0.7, p-value < 0.001). The presence of class I integron (int1) showed also a weak positive but significant correlation with rmpA (R = 0.3, p-value = 0.01)(Figure 3).
Haematological finding
Infection of Klebsiella spp. in diseased cattle induced a significant reduction (P<0.05) in the RBCS, Hb, PCV% and lymphocytes count; as well as a significant (P<0.05) rise in the total leucocytic count (TLC), neutrophils, monocytes and eosinophils counts compared to the control group (apparently healthy cattle) (Table 4).
Biochemical findings
The diseased cattle showed a significant rise (P<0.05) in the total protein, globulin, AST, ALT, urea and creatinine levels, alongside with a significant reduction in both albumin levels and A/G ratio compared to the control group (Table 5). In addition, the diseased cattle showed a significant plummet (P < 0.05) in the serum concentration of Mg, P, Zn and Fe relative to the control healthy group (Table 6).
Table 4: Hematological parameters in apparently healthy and diseased cattle. (Values are shown as mean±SE).
|
Parameters |
Control (apparently healthy) group |
Diseased group (showed respiratory signs) |
p value |
|
RBCs (106 /µl) |
7.9±1.9 |
6.3±2.02 |
0.001 |
|
Hb (gm/dl) |
10.5±2.3 |
8..9±1.87 |
0.001 |
|
PCV (%) |
36.45±1.39 |
27.32±2.41 |
0.001 |
|
TLC (103 /μl) |
8.39±1.3 |
12.15±2.3 |
0.001 |
|
Lymphocytes (103 /μl) |
4.87±0.72 |
3.56±0.51 |
0.006 |
|
Neutrophil (103 /μl) |
3.75±0.12 |
5.27±0.19 |
0.001 |
|
Monocytes(103 /μl) |
0.72±0.09 |
1.21±0.07 |
0.019 |
|
Eosinophils (103 /μl) |
0.32±0.02 |
0.52±0.03 |
0.047 |
Table 5: Alterations of serum biochemical parameters of both control and diseased cattle (Mean±SE).
|
Parameters |
Control (apparently healthy) group |
Infected group (showed respiratory signs) |
p value |
|
Total Protein (g/dl) |
6.13±1.21 |
6.75±1.45 |
0.028 |
|
Albumin (g/dl) |
3.41±0.4 |
3.08±1.02 |
0.036 |
|
Globulin (g/dl) |
2.82±0.52 |
3.49±0.72 |
0.048 |
|
A/G ratio |
1.13±0.09 |
0.85±0.07 |
0.031 |
|
AST(U/L) |
75.86±2.03 |
115.96±1.8 |
0.001 |
|
ALT(U/L) |
16.32±1.51 |
33.25±1.32 |
0.001 |
|
Urea(mg/dl) |
10.19±0.82 |
17.35±0.21 |
0.001 |
|
Creatinine(mg/dl) |
0.98±0.08 |
1.43±0.06 |
0.026 |
Table 6: Concentration levels of some serum minerals in control and diseased cattle (Mean ± SE; n=50).
|
Parameters |
Control (apparently healthy) group |
Infected group (showed respiratory signs) |
p value |
|
Ca (mmol/l) |
2.85±0.21 |
2.68±0.16 |
0.142 |
|
Mg (mmol/l) |
0.98±0.04 |
0.72±0.01 |
0.044 |
|
P (mmol/l) |
2.34±0.13 |
1.53±0.18 |
0.018 |
|
Fe (μmol/l) |
20.56±1.22 |
12.54±1.46 |
0.001 |
|
Zn (μmol/l) |
16.87±1.37 |
11.47±1.1 |
0.001 |
Bovine respiratory diseases (BRD) could be regarded as the main obstacle for animal farm owners worldwide as it negatively impacts animal performance causing high mortality rate and significant economic losses (Lee et al., 2020). Because of the limited data on Klebsiella species and their association with BVD, K. pneumoniae especially the hypervirulent (hvKp) strains had been reiterated periodically in acute and chronic respiratory infections in cattle (Darniati et al., 2021).
In the current study, Table 2 showed that the prevalence of Klebsiella spp. in diseased cattle that suffered from respiratory signs was high (25%) with a high recovery rate of K. pneumoniae (18%). Previous study done on apparently healthy cattle in Shandong province, China revealed similar infection rate of 18% in Klebsiella spp. from nasal swabs (Arbab et al., 2023) Also, cows recorded the most prevalent isolation rate of K. pneumoniae among different examined animal species (25.6%) in KSA, in which it was isolated with higher rate from cow nasopharyngeal swabs than from other samples. On the other side, a lower isolation rate of K. pneumoniae strains was reported from nasal swabs samples of cattle in a percentage of (15.5%), of which 12 isolates were hyper virulent strains (Cheng et al., 2018). This variation in the prevalence of Klebsiella spp. might be attributed to several factors such as hygienic and sanitary measures in the examined area, animal age, sex, breed, immunity, geographical distribution and also the availability and diversity of different culture and identification techniques.
K. pneumoniae in pneumonic lungs was regarded as the second most prevalent pathogen after Staphylococcus aureus in mixed bacterial respiratory infection in cattle (Darniati et al., 2021). In the present study, K. pneumoniae was found in almost half (46.7%) of the lung tissue of the analyzed 30 slaughtered cows. This was in parallel with (Darniati et al., 2021), who isolated hvKp from all examined lung tissue of Aceh cattle in Indonesia exhibiting acute and chronic upper respiratory tract infection. In addition, K. pneumoniae was also isolated in 25% of total 150 pneumonic lungs in a slaughterhouse in Nigeria. Our results regarding the low prevalence of Klebsiella rhinoscleromatis and K. ozaenae is in agreement with previous studies, which detected K. ozaenae 14 (5.7%) and K. rhinoscleromatis (1.6%) in diseased animals.
Most common MDR pathogens were gathered in the word ESKAPE, which encompassed six microbial species (Klebsiella pneumoniae, Enterococcus faecium, Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species). These MDR organisms could degrade the drug enzymes, inactivate antimicrobial compounds, change the membrane permeability or modify the target site of antimicrobial compounds by mutation of bacterial proteins (Wareth and Neubauer, 2021). MDR patterns could arise due to the horizontal or vertical transfer of plasmid encoding antimicrobial resistance genes among bacterial pathogens from animals to humans (Ammar et al., 2020). ESBL K. pneumoniae is one of the MDR bacteria, which inhibit β-lactam (penicillin, cephalosporins, and carbapenems) drugs (Wareth and Neubauer, 2021).
The 3rd generation of cephalosporin resistance of K. pneumoniae in food animals was previously reported, especially against cefotaxime, ceftazidime, and ceftriaxone. This resistance could arise from the bacterial ability to produce penicillinase enzymes that break down beta-lactam rings, converting penicillin into penicilloid acid that is not so active. In Gram-positive bacteria, the enzyme is liberated in the medium and destroys antibiotics before it reaches the cell, while in Gram-negative, it is located on the route where antibiotics proceed to reach the target (Effendi et al., 2018).
The current study showed that Klebsiella spp. have moderate to high range of antimicrobial resistance against the panel of used antibiotics (Table 3). Other antibiotics (e.g., imipenem, aztreonam, amikacin) showed also high sensitivity rates. In the same trend, similar studies declared that MDR Klebsiella spp. was resistant to tetracycline, ampicillin, cefuroxime, amoxicillin-clavulanic acid and gentamycin in percentages of 95%, 85%, 80% and 62%, respectively (Arbab et al., 2023). Also, other reports had found that MDR ESBL resistance-mediated Klebsiella spp. was detected against β-lactams antibiotics (cefoxitin, cefotaxime, cefoperazone, ceftazidime, ceftriaxone and aztreonam), amoxicillin and ampicillin. However, imipenem, and ciprofloxacin, showed 100% activity against K. pneumoniae isolates (Mansour et al., 2014). In addition, a resistance against ampicillin and cefazolin by K. pneumoniae isolates was recorded, with higher sensitivity to amikacin and meropenem drugs (Nirwati et al., 2019). Moreover, K. pneumoniae isolates were highly resistant to ciprofloxacin and relatively low resistant to ceftazidime and Amikacin (Cheng et al., 2018). Corresponding results of the MDR pattern of K. pneumoniae in cattle isolates were reported against ampicillin and amoxicillin-clavulanic acid (100%), cefepime (72.72%) and tetracycline (54.54%); meanwhile, imipenem, aztreonam, amikacin and azithromycin were sensitive drugs in the ratio of (82%, 55%, 45% and 45%), respectively (Ammar et al., 2020). In addition, most animals that recovered K. pneumoniae isolates were susceptible to imipenem (IMP) and meropenem (MEM) (Yang et al., 2019). The observation that antimicrobial resistance rate differ according to the involved spp. reflects potential differences in fitness and survivability of different spp. This also suggests that treatment options of various spp. of Klebsiella should be reconsidered accordingly.
Analyzing antimicrobial resistance phenotypes should not be the sole evaluator criteria for resistance pattern of certain spp., and identification of genetic elements associated with this should be simultaneously determined. Indeed, many of the genetic determinants of ESBL Klebsiella spp. were developed in recent years due to the uncontrolled use of beta-lactam drugs in animal treatment. ESBL strains could hydrolyze beta-lactam antibiotics due to gene mutations, especially blaTEM gene (the active site of the enzyme), causing higher enzymatic activity (Effendi et al., 2018). Moreover, blaCXT-M, blaTEM, blaSHV resistance genes were documented as the most common determinants of ESBL-mediated resistance traits of K. pneumoniae isolates. The beta-lactamase enzyme (blaTEM) was firstly identified in K. pneumoniae and Gram-negative bacteria (Tshitshi et al., 2020). Mutation of TEM genes could occur if a single amino acid or multiplier were substituted around the active site of its enzyme (Dantas and Ferreira, 2020)
The mobile genetic elements (MGE) could transfer the resistant genes in beta-lactamase-producing enzymes bacteria (Eka and Pinatih, 2017). Mutations of plasmid CTX (Cefotaximases enzymes) and chromosomally encoded SHV β-lactamase genes have been discovered within the family Enterobacteriaceae, including K. pneumoniae species (Elmowalid et al., 2018; Rahman et al., 2018). To date, integron of classes 1 was identified as the most prevalent in the group of Gram-negative bacteria out of nine known classes of integrons (Meshref et al., 2021). Furthermore, ESBL-resistant genes (blaCTX-M, blaTEM and blaSHV) were also detected in 100%, 85% and 80% of different examined Klebsiella spp. isolates (Figure 2).
Furthermore, our data indicated that major virulence traits of the recovered Klebsiella spp were fimA (90%), aerobactin (85%), rmpA (90%) and magA (80%) (Figure 1). Similar findings of fimA, rmpA, and aerobactin genes were also detected in previous studies (Xu et al., 2022). It is documented that the most common virulence factors of Klebsiella spp. include capsular antigens, adherence factors, the O-lipopolysaccharide, and siderophores promoting infectivity (Wareth and Neubauer, 2021). The rmpA virlance gens is a plasmid regulator gene of the mucoid phenotype of K. pneumoniae (extracapsular polysaccharide capsule synthesis) meanwhile magA is a chromosomally encoded hyper mucoviscosity gene that encodes the mucoviscous serotype of K. pneumoniae. In addition, the fim gene is an essential factor for pili formation and attachment to cellular surfaces forming biofilms increasing the virulence of this species (Yang et al., 2019).
For a successful infection, bacterial agent, notably Klebsiella spp. would simultaneously be able to resist antimicrobial agents and express virulence genes (Abd-El-Hamid et al., 2022; Ramadan et al., 2018; Tartor et al., 2021). This is expected to substantiate bacterial fitness, evolution and their persistence in infection sites. The current study allowed us to get insights into possible association between both fitness traits (Figure 3). We found significantly positive correlation between aerobactine and and blaTEM as well as between magA and blaSHV genes. It could be possible that correlated genes might be carried on the same MGE (e.g., integron, plasmid or transposons, etc.), and that horizontal gene transfer of these elements among bacteria could be responsible for such co-occurrence. The co-existence of virulence and carbapenem-resistance genes in K. pneumoniae was previously reported and was attributed to the presence of both genes on K. pneumoniae-derived outer membrane vesicles (OMVs), which mediates the horizontal gene transfer among isolates (Wang et al., 2022). Future studies are warranted to analyze this association on larger number of isolates, and how this occurs differentially in different infection sites.
In the current study, different Klebsiella spp. were isolated from both apparently healthy as well as diseased cattle, with these isolates exhibiting varied profile of antimicrobial resistance and virulence traits (Figure 3). In general, more isolates that express these traits was found in diseased cattle than that in apparently healthy ones. This initially suggests an association between disease outcome and presence of more fitted bacteria, in which case, disease appearance and possibly severity could be in part attributed to higher number of high-fitness isolates. While previous reports indicated lack of correlation between resisto-type of Klebsiella and the clinical outcome of the infected human neonates (Hassuna et al., 2020), this particular point remained to be deeply investigated in the animal world, in pursuit of using antimicrobial resistance or virulence profile as predictor of disease outcome or progression.
In an attempt to further analyze the ramifications of infection with Klebsiella spp. that have various antimicrobial resistance or virulence profile and linking this with disease outcome, we compared clinical parameters in diseased and apparently healthy cattle ads done previously (Hassuna et al., 2020).
Regarding the haemobiogram estimation, the blood picture of group of cattle that suffered from respiratory signs recorded a significant descent in red blood cells count (RBCs), heamoglobin concentrations, packed cell volume and lymphocytes levels (Table 4). This finding was along with significant rises in the levels of TLC, neutrophil, monocyte and eosinophils. This change in erythrogram and leukogram pictures might be attributed to in appetence and iron and other nutrients deficiency that are required to blood element forming besides the adverse effect of bacterial toxins (Kumar et al., 2018). Additionally, a noticeable increase in TLC and neutrophils, monocytes and eosinophils count was attributed to severe inflammatory process during respiratory infections, acute microbial inflammation, stress factor and also, the body defense mechanism against this bacterium (El-Zahar et al., 2021; Lindholm-Perry et al., 2018). Similar results were reported in which alterations of the hematological parameters due to Klebsiella spp. in diseased buffaloes were stated and inhibited the erythropoiesis process (Anwar et al., 2019).
The observed remarkable reduction of the lymphocyte count could be due to the high concentrations of endotoxins that were released from the inflammatory sites leading to lymphocytes lysis and, consequently, lymphopenia, or it could be attained due to the immunosuppression that could result from the stress factor during the respiratory infections (Ramadan et al., 2019). The neutrophilia, monocytosis could compensate the lymphopenia results in the current study which was thought to be due to the production of bacterial endotoxins. This finding agreed with (Kumar et al., 2018), who mentioned that change could in turn interfered with granulopoieses, the haemoglobulin synthesis and erythropoiesis processes.
Furthermore, the protein profile in our investigation revealed a significant hike in total protein and globulin levels meanwhile a significant drop in albumin level and A/G ratio in the diseased group (Table 5). These alterations were thought to be caused by anorexia and failure of liver functions. Same results were mentioned previously (Su et al., 2019). The infection, inflammatory processes and liver damage might increase the acute phase of protein formation resulting in hyperproteinemia because microbial infection could make the body neglecting the synthesis of proteins leading to hypoalbuminemia (El-Zahar et al., 2021; Ramadan et al., 2019) but hyperglobinemia and consequently, a decline in the level of A/G ratio was recorded owing that immunoglobulins could be synthetized by the antigens via antigen antibody reaction (Ahmed, 2021; Anwar et al., 2019; Kumar et al., 2018).
For estimation of AST, ALT, urea and creatinine levels in the diseased group, the recording data expressed an obvious plummet in their levels than the healthy group of cattle that was suggested to be caused by liver and kidney cells damage. This finding was in harmony with previous results obtained by (Anwar et al., 2019; Hossain et al., 2018; Metwally et al., 2017). An impairment of liver functions of group with respiratory infections was mainly related to high respiration rate, muscle activity and inflammatory process (Abd-El-Hamed and Ibrahim, 2017). Moreover, significant increases in the urea and creatinine levels due to the microbial infection and inflammation were reported and that result was similar to a previous study by (Metwally et al., 2017). High serum levels of urea and creatinine might be caused by post bacterial infection or inflammation leading to renal dysfunction and massive body protein catabolism (Abd-El-Hamed and Ibrahim, 2017; Lung et al., 2022).
Eventually, the serum mineral profile in Table 6 showed that the infected group of cattle recorded a significant descend in the serum minerals concentrations such as calcium (Ca), magnesium (Mg), potassium (K), iron (Fe) and zinc (Zn) levels when compared with the control healthy group. Resemble findings were also obtained by (Abd-El-Hamed and Ibrahim, 2017). Hypocalcemia was associated with hypoalbuminemia since it could hinder Ca absorption resulting into low levels of albumin bounded calcium (Ramadan et al., 2019). These changes in the levels of trace elements due to bacterial infection in pneumonic calves might be related to decrease of food consumption, low animal food intake, malabsorption, malnutrition and fever with subsequent disturbances of all metabolic processes (El-Zahar et al., 2021; Kumar et al.,2018; Yang et al., 2019).
We acknowledge that this study is limited by some factors such as small sample size that should be increased in future investigations. The small number of isolates made it difficult, for instance, to analyze the diversity of such isolates. It is worth noting that the blood indices measured in the current study is not an indication of Klebsiella infection alone given the nature of the field infection, where cattle could have other confounding infection. It is therefore important to conduct future validation studies for these parameters as biomarker for Klebsiella spp. in a controlled, pathogen-free in-vivo model.
Conclusions and Recommendations
In conclusion, monitoring the spread of ESBL producing strains of Klebsiella spp. are recommended to lower the emergence of BVD diseases and their potential sever economical losses and also to limit the bacterial spread of MDR and ESBL resistance traits in various animal species, which could lead to the failure of the antibiotics treatment strategy at the farm level. While the clinical and hemato-biochemical indices that were measured in filed cases with potential other confounding infections, it did indicate that they could be predictive aids for evaluation of the health condition of the animals. Due to the observed high positive correlation between some of the antimicrobial resistance genes and virulence genes in this study, our recommendations for further studies to validate this correlation on a large scale focusing on how this link could differentially present in different infection sites. Moreover, for both animal and human public health and to reduce the possibility of enhanced antibiotic resistance and MDR phenomena; new treatment regime such as the use of natural products and probiotics might be suggested.
Acknowledgements
The authors would like to acknowledge and thank Animal Health Research Institute (AHRI) and Agriculture Research Center (ARC), Egypt, for their helping hands in sample collection. The authors did not receive any funds for this study.
Novelty Statement
This study sheds light for the first time on the correlation between the virulence and resistant traits of MDR and ESBL Klebsiella strains in cattle with respiratory infections and how this reflects on the heamato-biochemcial indices. This add benefits as to the utility of using these indices to pinpoint cattle suffering from such highly fitted bacteria.
Author’s Contribution
GAI, with some inputs from MS, conceptualized the study. GAI performed the bacteriological analyses. AMM collected the samples and performed the microscopic analysis. MSH run the biochemical analyses. NAEH, MFMF performed and supervised the clinico-pathological part. GAI and MHS (the biochemical analyses part) wrote the initial draft of the manuscript. MS performed the statistical analyses and generated the drafts and final versions of the figures. GAI and MS edited the final version of the manuscript. All authors revised and approved the final version.
There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.aavs/2023/11.3.485.498
Conflict of interest
The authors have declared no conflict of interest.
References
Abd Elhamed H, Ibrahim G (2017). Molecular, bacteriological and clinicopathological studies on pneumonic calveswith special refrences to antibiotic resistance genes. Assiut. Vet. Med. J., 63(155): 144-160. https://doi.org/10.21608/avmj.2017.171017
Abd-El-Hamid MI, Sewid AH, Samir M, Hegazy WAH, Bahnass MM, Mosbah RA, Ghaith DM, Khalifa E, Ramadan H, Alshareef WA, Alshareef HM, Ghoneim MM, Al-Sanea MM, Bendary MM (2022). Clonal diversity and epidemiological characteristics of ST239-MRSA strains. Front. Cell. Infect. Microbiol., 12. https://doi.org/10.3389/fcimb.2022.782045
Abdeltawab A, Soliman E, El-Bery A (2022). Molecular studies on some antibiotic-resistant genes of Klebsiella species isolated from chicken. Benha Vet. Med. J., 41: 1-5. https://doi.org/10.21608/bvmj.2021.99433.1475
Ahmed IM (2021) Detection of CTX-M gene in extended spectrum β-lactamases producing Enterobacteriaceae isolated from bovine milk. Iraqi Journal of Veterinary Sciences 35(2):397-402. doi:10.33899/ijvs.2020.126909.1412
Alcántar-Curiel MD, Blackburn D, Saldaña Z, Gayosso-Vázquez C, Iovine NM, De la Cruz MA, Girón JA (2013). Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence, 4(2): 129-138. https://doi.org/10.4161/viru.22974
Aminlari M, Vaseghi T (1987). A new colorimetric method for determination of creatine phosphokinase. Anal. Biochem., 164(2): 397-404. https://doi.org/10.1016/0003-2697(87)90510-0
Ammar AM, Abd-El-Aziz NK, Mohamed SS (2020). Biofilm formation and its correlation with antimicrobial resistance in Klebsiella pneumoniae. Zagazig Vet. J., 48(4): 366-377. https://doi.org/10.21608/zvjz.2020.37640.1115
Anwar MR, Abd El-Raof YM, El-Attar HM, Hefnawy AE, Ghanem MM (2019). Evaluation of clinical and hematobiochemical alterations in naturally occurring bovine respiratory disease in feedlot cattle calves in Egypt. Benha Vet. Med. J., 36(2): 305-313. https://doi.org/10.21608/bvmj.2019.16753.1088
Arbab S, Ullah H, Wei X, Wang W, Ahmad SU, Zhang J (2023). Drug resistance and susceptibility testing of Gram negative bacterial isolates from healthy cattle with different β–Lactam resistance Phenotypes from Shandong province China. Braz. J. Biol., 83: 2023. https://doi.org/10.1590/1519-6984.247061
Archambault M, Petrov P, Hendriksen RS, Asseva G, Bangtrakulnonth A, Hasman H, Aarestrup FM (2006). Molecular characterization and occurrence of extended-spectrum beta-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb. Drug Resist., 12(3): 192-198. https://doi.org/10.1089/mdr.2006.12.192
Butaye P, Stegger M, Moodley A, Damborg P, Williams A, Halliday-Simmonds I, Guardabassi L (2021). One health genomic study of human and animal klebsiella pneumoniae isolated at diagnostic laboratories on a small caribbean island. Antibiotics (Basel)., 11(1): 42. https://doi.org/10.3390/antibiotics11010042
Cheng F, Li Z, Lan S, Liu W, Li X, Zhou Z, Song Z, Wu J, Zhang M, Shan W (2018) Characterization of Klebsiella pneumoniae associated with cattle infections in southwest China using multi-locus sequence typing (MLST), antibiotic resistance and virulence-associated gene profile analysis. Braz. J. Microbiol., 49 (Suppl 1): 93-100. https://doi.org/10.1016/j.bjm.2018.06.004
Chernecky CCB, Barbara J (2008). Laboratory tests and diagnostic procedures 5th ed. St. Louis, MO: Saunders.
CLSI (2022). M100 clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing Wayne, PA, USA CLSI Supplement 30th ed.
Colom K, Pérez J, Alonso R, Fernández-Aranguiz A, Lariño E, Cisterna R (2003). Simple and reliable multiplex PCR assay for detection of blaTEM, bla(SHV) and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol Lett., 223(2): 147-151. https://doi.org/10.1016/S0378-1097(03)00306-9
Dantas Palmeira J, Ferreira HMN (2020). Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in cattle production- a threat around the world. Heliyon, 6(1): e03206. https://doi.org/10.1016/j.heliyon.2020.e03206
Darniati D, Setiyaningsih S, Agungpriyono DR, Handharyani E (2021). First evidence of Klebsiella pneumoniae infection in Aceh cattle: Pathomorphology and antigenic distribution in the lungs. Vet. World, 14(4): 1007-1013. https://doi.org/10.14202/vetworld.2021.1007-1013
Doumas BT, Ard Watson W, Biggs HG (1971). Albumin standards and the measurement of serum albumin with bromcresol green. Clin. Chim. Acta, 31(1): 87-96. https://doi.org/10.1016/0009-8981(71)90365-2
Doumas BT, Bayse DD, Borner K, Carter RJ, Elevitch F, Garber CC, Graby RA, Hause LL, Mather A, Peters T, Jr., Rand RN, Reeder DJ, Russell SM, Schaffer R, Westgard JO (1981). A candidate reference method for determination of total protein in serum. II. Test for transferability. Clin. Chem., 27(10): 1651-1654. https://doi.org/10.1093/clinchem/27.10.1651
Effendi M, Bintari I, Aksono B, Hermawan I (2018). Detection of blaTEM gene of Klebsiella pneumoniae isolated from Swab of food-producing animals in East Java. Trop. Anim. Sci. J., 41: 174-178. https://doi.org/10.5398/tasj.2018.41.3.174
Eka Umarista Apriliani NP, Januartha Putra Pinatih K (2017). Prevalensi Kelompok Gen blaCTX-M-1 pada Klebsiella pneumoniae di Rumah Sakit Umum Pusat Sanglah Denpasar. E-Jurnal Medika Udayana; Vol 6 No 2 (2017): E-jurnal Medika Udayana.
Elmowalid GA, Ahmad AAM, Hassan MN, Abd El-Aziz NK, Abdelwahab AM, Elwan SI (2018). Molecular detection of new SHV β-lactamase variants in clinical Escherichia coli and Klebsiella pneumoniae Isolates from Egypt. Comp. Immunol. Microbiol. Infect. Dis., 60: 35-41. https://doi.org/10.1016/j.cimid.2018.09.013
El-Zahar H, Gouda H, El-Naggar A, Eissa A, Gouda S (2021). Monitoring the hemato-biochemical values in clinical cases of cattle with respiratory disorders. J. Anim. Health Prod., 9: 391-397. https://doi.org/10.17582/journal.jahp/2021/9.4.391.397
Fararh KM, Abd EL-Hamied SS, Farid AS, El-Sharkawy RB (2017). Clinicopathological changes in calves with respiratory diseases after treatment with essential volatile oil and other drugs. Benha Vet. Med. J., 33(2): 237-247. https://doi.org/10.21608/bvmj.2017.30477
Feldman BF, Zinkl JC, Jain NC (2000). Schalm’s veterinary hematology, Fifth Ed. Lippincott Williams and Wilkins, Philadelphia, London.
Fischbach FT, Dunning MB (2009). A manual of laboratory and diagnostic tests. Lippincott Williams and Wilkins, Philadelphia.
Galili T, O’Callaghan A, Sidi J, Sievert C (2017). heatmaply: An R package for creating interactive cluster heatmaps for online publishing. Bioinformatics, 34(9): 1600-1602. https://doi.org/10.1093/bioinformatics/btx657
Gindler EM, King JD (1972). Rapid colorimetric determination of calcium in biologic fluids with methylthymol blue. Am. J. Clin. Pathol., 58(4): 376-382. https://doi.org/10.1093/ajcp/58.5.376
Hassuna NA, AbdelAziz RA, Zakaria A, Abdelhakeem M (2020). Extensively-drug resistant Klebsiella pneumoniae recovered from neonatal sepsis cases from a major NICU in Egypt. Front. Microbiol., 11. https://doi.org/10.3389/fmicb.2020.01375
Hossain M, Khan M, Rumi MA, Ahammed M, Bari M (2018). Comparison of hematobiochemical parameters between apparently healthy and bovine tuberculosis affected cattle in Chittagong, Banglaesh. Bangladesh J. Vet. Med., 16: 53. https://doi.org/10.3329/bjvm.v16i1.37374
Kashif J, Buriro R, Memon J, Yaqoob M, Dongxue D, Huang J, Liping W (2013). Detection of class 1 and 2 integrons, β-lactamase genes and molecular characterization of sulfonamide resistance in Escherichia coli isolates recovered from poultry in China. 33: 321-324.
Kumar P, Jain VK, Kumar T, Kumar V, Rana YS (2018). Clinical and haemato-biochemical studies on respiratory disease in buffaloes. Int. J. Livest. Res., 8: 178. https://doi.org/10.5455/ijlr.20171210043959
Lee D, Oh JY, Sum S, Park H-M (2021). Prevalence and antimicrobial resistance of Klebsiella species isolated from clinically ill companion animals. J. Vet. Sci., 22(2): e17. https://doi.org/10.4142/jvs.2021.22.e17
Lee K, Kim H-Y, Choi E-J, Lee K-K, So B, Jung J-Y (2020). Klebsiella pneumoniae infection secondary to bovine viral diarrhea in two prematurely born calves. Korean J. Vet. Res., 60(3): 183-186. https://doi.org/10.14405/kjvr.2020.60.3.183
Lindholm-Perry AK, Kuehn LA, McDaneld TG, Miles JR, Workman AM, Chitko-McKown CG, Keele JW (2018). Complete blood count data and leukocyte expression of cytokine genes and cytokine receptor genes associated with bovine respiratory disease in calves. BMC Res. Notes, 11(1): 1-6. https://doi.org/10.1186/s13104-018-3900-x
Lung WFT, Charytonowicz D, Beaumont KG, Shah SS, Sridhar SH, Gorrie CL, Mu A, Hofstaedter CE, Varisco D, McConville TH, Drikic M, Fowler B, Urso A, Shi W, Fucich D, Annavajhala MK, Khan IN, Oussenko I, Francoeur N, Smith ML, Stockwell BR, Lewis IA, Hachani A, Upadhyay Baskota S, Uhlemann AC, Ahn D, Ernst RK, Howden BP, Sebra R, Prince A (2022). Klebsiella pneumoniae induces host metabolic stress that promotes tolerance to pulmonary infection. Cell Metab., 34(5): 761-774.e9. https://doi.org/10.1016/j.cmet.2022.03.009
Mansour AMA, Zaki HM, Hassan NA, Al-Humiany AA (2014). Molecular characterization and immunoprotective activity of capsular polysacchride of Klebsiella pneumoniae isolated from farm animals at Taif Governorate. Am. J. Infect. Dis., 10(1): 1-14. https://doi.org/10.3844/ajidsp.2014.1.14
Meshref AE, Eldesoukey IE, Alouffi AS, Alrashedi SA, Osman SA, Ahmed AM (2021). Molecular Analysis of Antimicrobial Resistance among Enterobacteriaceae Isolated from Diarrhoeic Calves in Egypt. Anim. (Basel), 11(6): 1712. https://doi.org/10.3390/ani11061712
Metwally AM, Elshahawy II, Abubaker ZM (2017). Green tea as a supportive treatment for respiratory disorders in calves. Alex. J. Vet. Sci., 52(1): 18-144. https://doi.org/10.5455/ajvs.253521
Mohd Razali N, Yap B (2011). Power comparisons of shapiro-wilk, kolmogorov-smirnov, lilliefors and anderson-darling tests. J. Stat. Model Anal., 2:126-138.
Montso KP, Dlamini SB, Kumar A, Ateba CN (2019). Antimicrobial resistance factors of extended-spectrum beta-lactamases producing escherichia coli and klebsiella pneumoniae isolated from cattle farms and raw beef in North-West Province, South Africa. BioMed. Res. Int., https://doi.org/10.1155/2019/4318306
Nirwati H, Sinanjung K, Fahrunissa F, Wijaya F, Napitupulu S, Hati VP, Hakim MS, Meliala A, Aman AT, Nuryastuti T (2019). Biofilm formation and antibiotic resistance of Klebsiella pneumoniae isolated from clinical samples in a tertiary care hospital, Klaten, Indonesia. BMC Proc., 13(Suppl 11): 20. https://doi.org/10.1186/s12919-019-0176-7
Nossair MA, Abd El Baqy FA, Rizk MSY, Elaadli H, Mansour AM, Abd El-Aziz AH, Alkhedaide A, Soliman MM, Ramadan H, Shukry M, Shaaban SI (2022). Prevalence and molecular characterization of extended-spectrum β-Lactamases and AmpC β-lactamase producing enterobacteriaceae among human, cattle, and poultry. Pathogens, 11(8). https://doi.org/10.3390/pathogens11080852
Paterson DL, Bonomo RA (2005). Extended-spectrum beta-lactamases: A clinical update. Clin. Microbiol. Rev., 18(4): 657-686. https://doi.org/10.1128/CMR.18.4.657-686.2005
Patton G, Crouch S (1977). Colorimetric method for the determination of serum urea. Anal. Chem., 49: 464-469. https://doi.org/10.1021/ac50011a034
Quinn PJ, Markey, B.K., Carter, M.E., Donnelly, W.J. and Leonard, F.C. (2002). Veterinary Microbiology and Microbial Diseases., 1st ed, Blackwell Science Ltd, Oxford, UK
Ramadan H, Ibrahim N, Samir M, Abd-El-Moaty A, Gad T (2018). Aeromonas hydrophila from marketed mullet (Mugil cephalus) in Egypt: PCR characterization of β-lactam resistance and virulence genes. J. Appl. Microbiol., 124(6): 1629-1637. https://doi.org/10.1111/jam.13734
Ramadan M, Ghanem M, El-Attar HE, Abdel-Raoof Y (2019). Evaluation of clinical and hematobiochemical alterations in naturally occurring bovine respiratory disease in feedlot cattle calves in Egypt. Benha Vet. Med. J., 36(2): 305-313. https://doi.org/10.21608/bvmj.2019.16753.1088
Reitman S, Frankel S (1957). A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol., 28(1): 56-63. https://doi.org/10.1093/ajcp/28.1.56
Remya PA, Shanthi M, Sekar U (2019). Characterisation of virulence genes associated with pathogenicity in Klebsiella pneumoniae. Indian J. Med. Microbiol., 37(2): 210-218. https://doi.org/10.4103/ijmm.IJMM_19_157
SAS (2012). Institute Inc. SAS/STAT statistics user’s guide. Statistical analytical system, 5th Rev. ed. Cary, NC, USA: SAS Institute Inc; 2012.
Shin SR, Noh SM, Jung WK, Shin S, Park YK, Moon DC, Lim SK, Park YH, Park KT (2021). Characterization of Extended Spectrum beta-lactamase-producing and AmpC beta-lactamase-producing enterobacterales isolated from companion animals in Korea. Antibiotics (Basel)., 10(3). https://doi.org/10.3390/antibiotics10030249
Siu LK, Fung CP, Chang FY, Lee N, Yeh KM, Koh TH, Ip M (2011). Molecular typing and virulence analysis of serotype K1 Klebsiella pneumoniae strains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan. J. Clin. Microbiol., 49(11): 3761-3765. https://doi.org/10.1128/JCM.00977-11
Smith AJ (1955). A colorimetric method for the estimation of serum magnesium. Biochem. J., 60(3): 522-527. https://doi.org/10.1042/bj0600522
Su LJ, Zhang JH, Gomez H, Murugan R, Hong X, Xu D, Jiang F, Peng ZY (2019). Reactive oxygen species-induced lipid peroxidation in apoptosis, autophagy, and ferroptosis. Oxid. Med. Cell. Longev., https://doi.org/10.1155/2019/5080843
Tartor YH, El-Naenaeey E-SY, Abdallah HM, Samir M, Yassen MM, Abdelwahab AM (2021). Virulotyping and genetic diversity of Aeromonas hydrophila isolated from Nile tilapia (Oreochromis niloticus) in aquaculture farms in Egypt. Aquaculture, 541: 736781. https://doi.org/10.1016/j.aquaculture.2021.736781
Tshitshi L, Manganyi MC, Montso PK, Mbewe M, Ateba CN (2020). Extended spectrum Beta-Lactamase-resistant determinants among carbapenem-resistant enterobacteriaceae from beef cattle in the north west province, South Africa: A critical assessment of their possible public health implications. Antibiotics (Basel), 9(11). https://doi.org/10.3390/antibiotics9110820
Turton JF, Perry C, Elgohari S, Hampton CV (2010). PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol., 59(Pt 5): 541-547. https://doi.org/10.1099/jmm
Rahman S, Ali T, Ali I, Khan NA, Han B, Gao J (2018). The growing genetic and functional diversity of extended spectrum Beta-lactamases. Biomed. Res. Int., https://doi.org/10.1155/2018/9519718
Wang G, Zhao G, Chao X, Xie L, Wang H (2020). The characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumoniae. Int. J. Environ. Res. Publ. Health., 17(17). https://doi.org/10.3390/ijerph17176278
Wang Z, Wen Z, Jiang M, Xia F, Wang M, Zhuge X, Dai J (2022). Dissemination of virulence and resistance genes among Klebsiella pneumoniae via outer membrane vesicle (OMVs): An important plasmid transfer mechanism to promote the emergence of carbapenem resistant hypervirulent Klebsiella pneumoniae (CR-hvKp). Transbound. Emerg. Dis., 69. https://doi.org/10.1111/tbed.14615
Wareth G, Neubauer H (2021). The Animal-foods-environment interface of Klebsiella pneumoniae in Germany: An observational study on pathogenicity, resistance development and the current situation. Vet. Res., 52(1): 16. https://doi.org/10.1186/s13567-020-00875-w
Wyres KL, Holt KE (2018). Klebsiella pneumoniae as a key trafficker of drug resistance genes from environmental to clinically important bacteria. Curr. Opin. Microbiol., 45: 131-139. https://doi.org/10.1016/j.mib.2018.04.004
Xu T, Wu X, Cao H, Pei T, Zhou Y, Yang Y, Yang Z (2022). The characteristics of multilocus sequence typing, virulence genes and drug resistance of Klebsiella pneumoniae isolated from cattle in Northern Jiangsu, China. Animals (Basel), 12(19). https://doi.org/10.3390/ani12192627
Yang F, Deng B, Liao W, Wang P, Chen P, Wei J (2019). High rate of multiresistant Klebsiella pneumoniae from human and animal origin. Infect. Drug Resist., 12: 2729-2737. https://doi.org/10.2147/IDR.S219155
Yeh KM, Kurup A, Siu LK, Koh YL, Fung CP, Lin JC, Chen TL, Chang FY, Koh TH (2007). Capsular serotype K1 or K2, rather than magA and rmpA, is a major virulence determinant for Klebsiella pneumoniae liver abscess in Singapore and Taiwan. J. Clin. Microbiol., 45(2): 466-471. https://doi.org/10.1128/JCM.01150-06