Correlation Analysis between the Antimicrobial Resistance and Virulence of Pathogenic Streptococcus Isolates from Cows
Yue-Xia Ding1, Qun Wu2, Zhao Namula1 and Yi Ma1,*
1College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang, Guangdong Province, 524088, P.R. China
2Zhanjiang Experimental Station, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang, Guangdong Province, 524091, P.R. China
Yue-Xia Ding and Qun Wu contributed equally to this work.
ABSTRACT
Bovine Streptococcus are one of the main pathogens causing bacterial disease such as mastitis and endometritis in dairy farming. The virulence factors produced by Streptococcus are related to the occurrence of inflammation. To investigate the correlation between antimicrobial resistance and virulence traits of bovine Streptococcal isolates. Induced resistance was conducted for Streptococcus pneumonia ATCC49619 and erythromycin-sensitive strains by gradually increasing the antimicrobial concentration. Plasmid conjugation test was carried out by membrane filtration method. The correlation between antimicrobial resistance and virulence traits was analyzed by LD50 and related genes. Sensitive Streptococcus isolates to erythromycin and S. pneumoniae ATCC49619 were induced to resistance in vitro, MIC value was from ≤ 0.5 μg/mL up to ≥ 64 μg/mL, and ermB or mefA resistant gene were carried. Transfer rate of resistance was 100% by plasmid conjugant, conjugants had obtained the resistance phenotype and the related resistance genes from the donor bacteria. The LD50 of conjugants and induced resistance strains compared with parental strain, the virulence was lower than sensitive strains. The present study demonstrated that the virulence of resistant Streptococcus strains obtained by different drug resistance transfer methods was lower than that of their parents.
Article Information
Received 02 July 2021
Revised 10 August 2021
Accepted 16 August 2021
Available online 10 June 2022
(early access)
Published 19 April 2023
Authors’ Contribution
Y-XD and YM presented the concept. QW and Y-XD planned methodology and curated data. QW and NZ perfromed forrmal analysis. Y-XD wrote the manuscript. YM and NZ reviewed the manuscript. YM acquire funds.
Key words
Streptococcus, Induced resistance, Plasmid conjugation, Virulence.
DOI: https://dx.doi.org/10.17582/journal.pjz/20210702090706
* Corresponding author: [email protected]
0030-9923/2023/0003-1447 $ 9.00/0
Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Streptococcus belongs to a gram-positive bacterium, which is widely distributed in cow skin, bedding, feces and urine, sewage and other environments. The pathogenic strain can cause cow infection through contact transmission, such as mastitis and endometritis (Wu et al., 2019). Additionally, during recent decades, livestock production (including the dairy production) has tended to a high-density and intensive production model, leading to frequent occurrence of animal diseases, and antibiotics are therefore widely used in feed and veterinary clinical practice to prevent and treat animal bacterial infectious diseases (Guo et al., 2020; Liu et al., 2020), while the rapid emergence and dissemination of resistance has become a major concern of public health security (Liu et al., 2019; Wu et al., 2019), and it also includes the issue of drug resistance in Streptococcus. Besides, in addition to public health issues, drug resistance makes the veterinary clinical treatment of Streptococcus extremely difficult and seriously affect the healthy production of dairy cows (Ding et al., 2016).
The mechanism of bacterial drug resistance has become an important and extensive research topic in clinical microbiology (Martínez et al., 2002). Previous studies have found that the major determinants of the resistant mechanism are derived from horizontal gene transfer in other organisms, and common essential characteristics have also been reported in studies of pathogen virulence. On the other hand, it has been shown that antibiotic resistance genes and virulence genes can be in the same mobile components, such as plasmids, transposons, phages, integrons, and gene clusters (Villa et al., 2005; Reid et al., 2019). Johnson et al. (2005) reported that resistance and virulence genes are located on the same or different plasmids, and both can be transferred simultaneously with plasmid. It was suggested that the plasmid pAPEC-O1-R and ColBM which mediates resistance and virulence, respectively, could co-transfer through the conjugation in avian pathogenic Escherichia coli (Johnson et al., 2006). The pCERC3 plasmid was also found to be both virulence and resistance plasmid in E. coli (Moran et al., 2016). Further studies have shown a correlation between virulence and antibiotics (Rathnayake et al., 2012). Ghorbel et al. (2019) observed a significant correlation between the virulence pattern and the map of antimicrobial agents. Azzam et al. (2017) showed that multiple antibiotics resistances was strongly correlated with bacterial virulence in wastewater ecosystems. Vila et al. (2002) reported that when bacteria acquired antibiotic resistance, their virulence decreased, the study of the mechanism showed that most strains increase resistance by changing their own expression or protein structure (Wang et al., 2016).
At present, most studies on its correlation are focused on human medicine and ecological environment, while few studies on bovine Streptococcus. Hence, the present study was conducted to investigate the correlation between antimicrobial resistance and virulence traits of bovine Streptococcal isolates by using in vitro-induced drug resistance and resistant plasmid conjugation of sensitive Streptococcal isolates, which will render rationale basement for controlling bacterial disease caused by Streptococcal infection.
Materials and methods
Tested strains
S. pneumoniae ATCC49619 was provided by laboratory. Bovine Streptococcal isolates which sensitive to erythromycin (MIC < 1 μg/mL) and the donor bacteria both came from clinical cases. Streptococcus dysgalactiae CVCC3701 and Streptococcus dysgalactiae CVCC3701-PEN (penicillin-induced resistance) were provided by other researchers in this study.
In vitro induced resistance test
The preserved standard strain (ATCC49619) and 15 erythromycin-sensitive Streptococcal isolates were inoculated into the BHI broth with serum, and incubated at 37℃ for 6 h. A small amount of bacterial solution was picked to mark on M-H agar plates and incubated at 37℃ for 16-20 h. BHI broth containing the sub inhibitory concentration of antibiotic was prepared and passed at 37℃. Meanwhile, the negative control of broth was made and transferred every 3 days. The concentration of the induced antibiotic was gradually increased by 2 times until the MIC of the test strain rose to the resistance range (Gautier et al., 2002). The stability of resistant progeny was tested, and related resistant genes (ermB, mefA) were detected by PCR. Primer information was shown in Table I.
Plasmid conjugation test
The test was performed by membrane filtration method (Werner et al., 2003). 20 Streptococcal isolates that were both resistant to tetracycline and sensitive to erythromycin were selected as the donor bacteria, and S. pneumoniae ATCC49619-ERY (erythromycin-induced resistance) was used as the recipient bacteria. The suitable antibiotic concentrations of erythromycin and tetracycline were screened, respectively. The tested strains were inoculated into the BHI broth with serum and incubated at 37℃ for 18 h aerobically in 5% CO2. That was adjusted to 108 CFU/mL. The 5 μL bacteria solution was absorbed
Table I.- Details of PCR primers.
|
Target gene |
Primer sequence (5'–3') |
Tm. (°C) |
Amplicon size (bp) |
Reference |
|
|
Forward |
Reverse |
||||
|
ermB |
ATTGGAACAGGTAAAGGGC |
GAACATCTGTGGTATGGCG |
50 |
442 |
Marimo´n et al. (2005) |
|
mefA |
AGTATCATTAATCACTAGTGC |
TTCTTCTGGTACTAAAAGTGG |
53 |
346 |
Marimo´n et al. (2005) |
|
tetM |
GAACTCGAACAAGAGGAAAGC |
ATGGAAGCCCAGAAAGGAT |
50 |
993 |
Lopardo et al. (2003) |
|
tetL |
TGAACGTCTCATTACCTG |
ACGAAAGCCCACCTAAAA |
50 |
189 |
Lopardo et al. (2003) |
|
bac |
TGTAAAGGACGATAGTGTGAAGAC |
CATTTGTGATTCCCTTTTGC |
50 |
530 |
Dmitriev et al. (2002) |
|
bca |
TAACAGTTATGATACTTCACAGAC |
ACGACTTTCTTCCGTCCACTTAGG |
51 |
535 |
Dmitriev et al. (2002) |
|
scpB |
CCAAGACTTCAGCCACAAGG |
CAATTCCAGCCAATAGCAGC |
57 |
591 |
Dmitriev et al. (2002) |
|
lmb |
ACCGTCTGAAATGATGTGG |
GATTGACGTTGTCTTCTGC |
51 |
572 |
Dmitriev et al. (2002) |
|
cyl |
ACGGCTTGTCCATAGTAGTGTTTG |
AACGACACTGCCATCAGCAC |
52 |
345 |
Dmitriev et al. (2002) |
|
glnA |
ACGTATGAACAGAGTTGGCTATAA |
TCCTCTGATAATTGCATTCCAC |
52 |
471 |
Dmitriev et al. (2002) |
|
cfb |
ATGGGATTTGGGATAACTAAGCTAG |
AGCGTGTATTCCAGATTTCCTTAT |
52 |
193 |
Dmitriev et al. (2002) |
|
hylB |
ACAAATGGAACGACGTGACTAT |
CACCAATTGGCAGAGCCT |
52 |
346 |
Dmitriev et al. (2002) |
into 1 mL liquid medium for 4 h by shaking culture. The donor and recipient were mixed at 1:3 (20 μL, 60 μL) and coated on the sterile filter membrane. The filter membrane was placed in the BHI agar plates at 37℃ for 18-24 h, after that was washed with 1 mL BHI broth and transplanted into BHI agar plates containing a certain concentration of erythromycin and tetracycline. The results were observed after 36-48 h. Single colony was selected and inoculated into LB broth at 37℃ for the identification of conjugants.
Conjugant identification
MIC and multiple PCR were used to identify the conjugants (Huys et al., 2004). MIC was detected by double dilution method.
Detection of virulence on bovine Streptococcus
LD50 assay was performed on strains with resistant phenotypes, resistant and virulence genes (bac, bca, scpB, LMB, cyl, glnA, CFB, hylB) after induction and plasmid conjugation. Half of the lethal dose (LD50) was determined by Bliss (1936) method. The experimental design was divided into a blank control group and six experimental groups. Three dilution degrees were set in equal ratio between the LD0 and LD100, with a total of 5 gradients in the
Table II.- MIC results of sensitive Streptococcus induced resistance by erythromycin.
|
Group |
Strain |
Species |
MIC (μg/mL) |
Induction algebra |
|
|
Before induction |
After induction |
||||
|
Blank control |
ATCC49619 |
S. pneumoniae |
0.25 |
0.25 |
— |
|
Negative control |
ATCC49619 |
S. pneumoniae |
0.25 |
0.25 |
— |
|
Experimental group |
ATCC49619 |
S. pneumoniae |
0.25 |
256 |
10 |
|
FL1 |
S. agalactiae |
0.12 |
128 |
12 |
|
|
FL2 |
S. agalactiae |
0.5 |
128 |
12 |
|
|
FL3 |
S. agalactiae |
0.25 |
128 |
10 |
|
|
FL4 |
S. agalactiae |
0.25 |
128 |
10 |
|
|
FL5 |
S. agalactiae |
0.12 |
64 |
10 |
|
|
FL6 |
S. agalactiae |
0.25 |
64 |
10 |
|
|
FL7 |
S. agalactiae |
0.5 |
256 |
12 |
|
|
FL8 |
S. agalactiae |
0.5 |
256 |
12 |
|
|
FL9 |
S. agalactiae |
0.25 |
256 |
10 |
|
|
FL10 |
S. agalactiae |
0.12 |
128 |
12 |
|
|
FL11 |
S. agalactiae |
0.12 |
64 |
10 |
|
|
FL12 |
S. agalactiae |
0.12 |
128 |
12 |
|
|
FL13 |
S. dysgalactiae |
0.25 |
256 |
10 |
|
|
FL14 |
S. dysgalactiae |
0.25 |
128 |
10 |
|
|
FL15 |
S. uberis |
0.5 |
128 |
10 |
|
Table III.- The MIC of conjugants, donor and receptor bacteria against antimicrobial agents.
|
Antimicrobial agents |
MIC(μg/mL) |
||||
|
Donor bacteria |
Receptor bacteria (ATCC49619-ERY) |
Conjugons |
|||
|
MIC50 |
MIC90 |
MIC |
MIC50 |
MIC90 |
|
|
Penicillin |
16 |
128 |
0.125 |
1 |
8 |
|
Ampicillin |
0.5 |
1 |
0.25 |
0.25 |
1 |
|
Amoxicillin |
2 |
16 |
0.125 |
2 |
32 |
|
Erythromycin |
0.25 |
0.5 |
256 |
﹥256 |
﹥256 |
|
Chloramphenicol |
8 |
32 |
2 |
1 |
64 |
|
Ofloxacin |
1 |
8 |
1 |
0.5 |
1 |
|
Levofloxacin |
0.25 |
2 |
0.063 |
0.125 |
0.25 |
|
Tetracycline |
64 |
128 |
1 |
64 |
128 |
|
Clindamycin |
8 |
32 |
0.125 |
16 |
64 |
|
Vancomycin |
1 |
4 |
0.25 |
1 |
2 |
|
Kanamycin |
64 |
256 |
4 |
128 |
128 |
MIC50 value is the MIC value that inhibited at least 50% of the isolates, MIC90 value is the MIC value that inhibited at least 90% of the isolates.
experimental group. After inoculation, the symptoms, time of death and the number of deaths were recorded.
Results
Erythromycin-sensitive strain induced resistance
MIC values of all strains after erythromycin induction were shown in Table II. The results showed that 15 clinical isolates and S.pneumoniae ATCC49619 developed high resistance after induction for more than 10 generations (MIC ≥ 64 μg/mL). MIC value of S.pneumoniae ATCC49619 reached 256 μg/mL. Only 3 S. agalactiae had been 64 μg/mL after induction, and other isolates had MIC ≥ 128 μg/mL. The MIC value of resistant offspring was not changed after culturing in a drug-free medium for 5 generations. The resistance was stable.
Antimicrobial resistance genes
Resistant genes were detected by PCR after inducing. 15 strains amplified a fragment of 442bp (ermB), and 1 strain amplified a fragment of 346bp (mefA). Partial test results were shown in Figure 1.
Plasmid conjugation test
Plasmid conjugation was performed between 20 donor and the recipient bacteria (ATCC49619-ERY), respectively. Conjugation and parent strains were also tested for their susceptibility to 11 antimicrobial agents and the results are shown in Table III. The MIC value of the recipient bacteria against erythromycin was 256 μg/mL. At least 50% of the donor bacteria showed resistance to tetracycline (MIC50 value = 64 μg/mL and MIC90 value = 128 μg/mL). The MIC50 and MIC90 values of conjugation against erythromycin were greater than 256 μg/mL, MIC50 to tetracycline was 64 μg/mL, and MIC90 was 128 μg/mL after plasmid conjugation test. In addition, the resistant phenotypes of β-lactams, quinolones, amides and vancomycin did not transfer to the conjugation, while the resistant phenotypes of lincomines in the donor bacteria were more consistent with conjugation.
Table IV. Distribution of virulence genes and resistance in tested strains.
|
Tested strains |
||||||
|
Donor bacteria WR38 |
Receptor bacteria ATCC49619-ERY |
Conjugon PC12 |
S. dysgalactiae CVCC3701 |
S. dysgalactiae CVCC3701-PEN |
||
|
R-phenotype |
TET+ , PEN+ |
ERY+ |
TET+, ERY+ |
— |
PEN+ |
|
|
Resistance genes |
||||||
|
tetM |
+ |
﹣ |
+ |
﹣ |
﹣ |
|
|
tetL |
+ |
﹣ |
+ |
﹣ |
﹣ |
|
|
ermB |
﹣ |
+ |
+ |
﹣ |
﹣ |
|
|
mefA |
﹣ |
﹣ |
﹣ |
﹣ |
﹣ |
|
|
Pbp1a |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
pbp2b |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
Virulence genes |
||||||
|
bac |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
bca |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
scpB |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
lmb |
﹣ |
﹣ |
﹣ |
﹣ |
+ |
|
|
cyl |
+ |
﹣ |
﹣ |
+ |
+ |
|
|
glnA |
+ |
﹣ |
﹣ |
﹣ |
+ |
|
|
cfb |
+ |
﹣ |
﹣ |
﹣ |
+ |
|
|
hylB |
+ |
﹣ |
﹣ |
﹣ |
+ |
|
Identification of conjugons
The DNA of conjugation was extracted and multiplex PCR was performed. Partial electrophoresis results are shown in Figure 2. The results showed that the tetracycline resistance genes tetM (740bp) and tetL (993bp) be detected in the donor bacteria with high tetracycline resistance, ermB (442bp) be detected in the recipient bacteria with high erythromycin resistance, and both tetracycline and erythromycin resistance genes be detected in the conjugation.
Table V.- LD0 and LD100 of tested strains.
|
Tested Strains |
Lethal dose (CFU∕mL) |
|
|
LD0 |
LD100 |
|
|
Donor bacteria WR38 |
4.9×106 |
4.9×1010 |
|
Receptor bacteria ATCC49619-ERY |
2.6×105 |
2.6×109 |
|
Conjugon PC12 |
2.0×106 |
1.6×108 |
|
S. dysgalactiae CVCC3701 |
4.0×105 |
1.0×108 |
|
S. dysgalactiae CVCC3701-PEN |
1.4×108 |
1.4×1010 |
Virulence of Streptococcus
LD50 was performed on 5 strains of induced resistance and plasmid conjugation. The genes of resistance and virulence are shown in Table IV. According to the preliminary experimental results, the LD0 and LD100 of all the tested strains are shown in Table V, and the LD50 results are shown in Table VI. The LD50 of donor bacteria (name: WR38), recipient bacteria (name: ATCC49619-ERY) and conjugation (name: PC12) from plasmid conjugation transfer test were analyzed by Bliss method, the results showed that the virulence of conjugation PC12 was decreased compared with that of the recipient ATCC49619-ERY, and its LD50 was increased by 1.6 times compared with that of the recipient.
The results of CVCC3701 and CVCC3701-PEN of S. dysgalactiae from the induced resistance test showed that the LD50 value of the strain was significantly different before and after induction, and the LD50 of the strain after induction was increased by 1.1×102 times compared with that before, indicating that the virulence of the strain after induction decreased significantly.
Table VI.- The LD50 of tested strains on the mouse. A dose (0.5 mL) of vaccine was administered to 8 mice i.p. for each experimental group.
|
Tested dtrains |
Group |
Concentration (CFU∕ mL) |
Deaths |
LD50 (CFU∕ mL) |
|
Sterile LB broth |
Blank control |
— |
0 |
— |
|
Donor bacteria WR38 |
1-LD100 |
4.9×1010 |
8 |
1.13×108 |
|
1-n13LD0 |
4.9×109 |
5 |
||
|
1-n12LD0 |
4.9×108 |
2 |
||
|
1-n1LD0 |
4.9×107 |
1 |
||
|
1-LD0 |
4.9×106 |
0 |
||
|
Receptor bacteria ATCC49619-ERY |
2-LD100 |
2.6×109 |
8 |
5.41×106 |
|
2-n23LD0 |
2.6×108 |
7 |
||
|
2-n22LD0 |
2.6×107 |
3 |
||
|
2-n2LD0 |
2.6×106 |
2 |
||
|
2-LD0 |
2.6×105 |
0 |
||
|
Conjugon PC12 |
3-LD100 |
1.6×108 |
8 |
8.92×106 |
|
3-n33LD0 |
5.3×107 |
4 |
||
|
3-n32LD0 |
1.7×107 |
2 |
||
|
3-n3LD0 |
6.0×106 |
1 |
||
|
3-LD0 |
2.0×106 |
0 |
||
|
S. dysgalactiae CVCC3701 |
4-LD100 |
1.0×109 |
8 |
5.45×106 |
|
4-n43LD0 |
1.4×108 |
7 |
||
|
4-n42LD0 |
1.98×107 |
3 |
||
|
4-n4LD0 |
2.8×106 |
1 |
||
|
4-LD0 |
4.0×105 |
0 |
||
|
S. dysgalactiae CVCC3701-PEN |
5-LD100 |
1.4×1010 |
8 |
5.82×108 |
|
5-n53LD0 |
4.4×109 |
7 |
||
|
5-n52LD0 |
1.1×109 |
6 |
||
|
5-n5LD0 |
4.4×108 |
3 |
||
|
5-LD0 |
1.4×108 |
0 |
DISCUSSION
Erythromycin-sensitive Streptococcus induced resistance
Streptococcus as the main pathogens that cause a variety of suppurative inflammation in animals and humans, such as mastitis, endometritis, sepsis and neonatal sepsis, meningitis. Macrolides are a class of antibiotics used in the treatment of gram-positive bacterial infections. Some of them are also added into the feed, resulting in the gradual increase of resistance.
At present, the resistance rate of S. agalactiae to erythromycin in mastitis was as high as 94.1% from some parts of China, while India was 33.3% (Jain et al., 2012). Previous studies also found that the resistance rate of group B Streptococcus against erythromycin was also increasing by years in Canada and Taiwan (Sherman et al., 2012; Ko et al., 2001; Helena et al., 1997). The resistance rate of Streptococcus suis to macrolides was more than 50% (Martel et al., 2001), In Asia, such as China, Vietnam and Korea, clinical isolates of S. pneumoniae had resistance rates of over 70% to macrolides (Song et al., 2004; Sahm et al., 2008). Erythromycin resistance model was successfully established by induction in vitro, and the adaptability of Streptococcus was proved to be different due to antibiotic differences in the experiment. ErmB gene was detected in most resistant Streptococcus in the test, suggesting that erythromycin resistance methylase may be the major mechanism of resistance in the present study. The results suggest that low doses and concentrations of drugs will not kill bacteria, but it will adapt to the environment by producing the corresponding resistance genes or genetic mutations to escape clinically. The standard strain ATCC49619-ERY of S. pneumoniae resistant only to erythromycin was obtained through the model, and the changes in virulence characteristics of the same strain before and after induction of resistance could be more directly compared, which provided a single resistant strain for subsequent plasmid conjugating tests.
Plasmid conjugation test of bovine Streptococcus
Bacterial resistance includes intrinsic and acquired resistance. Studies have shown that many resistant genes are located on mobile DNA components such as plasmids, transposons and integrons, and can also be transmitted between bacteria by conjugation plasmids, transposons, integrons and phages (Zhao et al., 2011). The acquisition of resistant plasmids is the most common mechanism of bacterial resistance (Bruinsma et al., 2004), conjugation is the primary mode of transmission of resistant genes in bacteria (Brown et al., 1999).
In this study, a high tetracycline-resistant Streptococcal plasmid conjugation and transfer test was carried out by membrane grafting method. The resistance of tetracycline and related resistance genes (tetM and tetL) were successfully transferred into the recipient bacteria by 20 strains of highly tetracycline resistant donor. More than 80% of the colonies growing in the two antibiotics screening plate acquired the properties of the donor and recipient bacteria, while the remaining colonies only acquired the resistance phenotype of tetracycline but did not detect genes. The two antibiotics concentration was selected for screening to determine the conjugation and distinguish from donor and recipient bacteria.
The resistance to tetracycline is mainly acquired through the resistance gene transfering in conjugation plasmids, and the tetL gene encodes efflux pump protein which often exists in small plasmids with transmissibility. TetM gene encodes ribosomal protective proteins which mainly located in transposons of the Tn916-Tn1545 family (Huys et al., 2004). The family forms a ring structure, which can transfer intracellular and intercellular. Tn916 has a wide host range and can transfer the tetM gene to gram-negative bacteria and even to mycoplasma (Lancaster et al., 2004), which may be the reason why tetracycline is susceptible to transfer to others. It is worth noting that the MIC of clindamycin in conjugation is improved compared with the recipient bacteria. Lincomines can be methylated by ribosomes, and produced cross-resistant with macrolidenes. The macrolidene resistance gene ermB is usually located in Tn1545 and Tn917 (Okitsu et al., 2005), suggesting that the transfer of resistance of lincomines may be related to transposon Tn1545.
LD50 of bovine Streptococcus before and after resistance
In order to demonstrate the changes in resistance and virulence characteristics of Streptococcus, we used plasmid conjugation and in vitro induced resistance tests to gradually transform the sensitive into resistant Streptococcus with clear background to demonstrate the changes of the same strain in the process of resistance. The results showed that the LD50 value of the inducted strain CVCC3701-PEN increased by 1.1×102 times compared with that of the parent strain before induction. the LD50 value of conjugation increased by 1.6 times compared with that of the recipient bacteria, indicating that the virulence of the sensitive bacteria decreased after acquiring resistance. Some researchers had found that virulence and resistance genes can be transmitted and transformed to a certain extent (Alexander et al., 2011; Barton, 2000), antibiotic resistance also existed in genes that encode bacteriocins (Chelliah et al., 2019), iron carriers (Zhang et al., 2017), cytotoxins (Carlson et al., 2001), and adhesion factors (Laporta et al., 1986).
Pathogenicity islands (PAI) is a special genomic island that contains multiple virulence genes as well as plasmids, transposons and integrons. PAI constructed a new genomic island by horizontal transfer of virulence genes through plasmids or transposons, thereby expanding the bacterial spectrum of the virulence island. However, PAI was often associated with a tRNA gene or insertion sequence, and present in strong strains generally, but rarely distributed in the associated weak or no strains (Zhu et al., 2013). It is suggested that the donor bacteria may not exist a PAI due to its weak virulence (LD50 = 1.13×108 CFU/mL), and virulence factors are difficult to transfer horizontally.
It has demonstrated that penicillin-resistant S. pneumoniae may be less virulent than sensitive strains (Azoulay et al., 2000), multiple drug resistance leading to reduced virulence (Lehtolainen et al., 2003). Resistance to rifampicin leaded to a decrease in virulence (Neill et al., 2006). The expression of virulence genes was decreased in fluoroquinolone-resistant strains (Schaeffer, 2002; Liu et al., 2009). In this regard, many scholars put forward the concept of biological adaptability cost, the decrease of fitness caused by resistance mutation (Andersson, 2006). Therefore, abnormal bacterial regulation may occur when movable elements are engaged, and that is the increased cost of adaptation. Björkman et al. (1998) reported that resistant Salmonella typhimurium was less virulent to mice due to mutations in rpsL, rpoB and gyrA genes, but it quickly repaired its adaptability and virulence by compensating mutations. It is suggested that the toxicity of resistant bacteria decreased, while a variety of virulence genes were detected after induction of resistance, which may be caused by the fact that S. dysgalactiae CVCC3701-PEN stimulated compensatory adaptation, that needs to be further verified.
Conclusion
To summarize, based on the findings of the above three experiments, this study applied the standard strain of S. pneumoniae and S. dysgalactiae, and obtained different resistant strains with different drug resistance transfer methods, the results that the virulence of the resistant strain decreased compared with the parent strain, so that the results were mutually supported and verified.
Data availability statement
All public data generated or analyzed during this study are included in this article. Data sharing is not applicable to this article as no new data were created or analyzed in this study.
Statement of conflict of interest
The authors report that they have no conflicts of interest.
References
Alexander, T.W., Yanke, J.L., Reuter, T., Topp, E., Read, R.R., Selinger, B.L. and McAllister, T.A., 2011. Longitudinal characterization of antimicrobial resistance genes infeces shed from cattle fed different subtherapeutic antibiotics. BMC Microbiol., 11: 19. https://doi.org/10.1186/1471-2180-11-19
Andersson, D.I., 2006. The biological cost of mutational antibiotic resistance: Any practical conclusions? Curr. Opin. Microbiol., 9: 461-465. https://doi.org/10.1016/j.mib.2006.07.002
Azoulay-Dupuis, E., Rieux, V., Muffat-Joly, M., Bedos, J., Vallee, E., Rivier, C., Isturiz, R., Carbon, C. and Moine, P., 2000. Relationship between capsular type, Penicillin susceptibility, and virulence of human Streptococcus pneumoniae isolates in mice. Antimicrob. Agents Chemother., 44: 1575-1577. https://doi.org/10.1128/AAC.44.6.1575-1577.2000
Azzam, M.I., Ezzat, S.M., Othman, B.A. and Eldougdoug, K.A., 2017. Antibiotics resistance phenomenon and virulence ability in bacteria from water environment. Water Sci., 31: 109-121. https://doi.org/10.1016/j.wsj.2017.10.001
Barton, M.D., 2000. Antibiotic use in animal feed and its impact on human health. Nutr. Res. Rev., 13: 279-299. https://doi.org/10.1079/095442200108729106
Bliss, C.I., 1936. The calculation of dosage-mortality curve. Annls. appl. Biol., 22: 134-167. https://doi.org/10.1111/j.1744-7348.1935.tb07713.x
Björkman, J., Hughes, D. and Andersson, D.I., 1998. Virulence of antibiotic-resistant Salmonella typhimurium. Proc. natl. Acad. Sci. U.S.A., 95: 3949-3953. https://doi.org/10.1073/pnas.95.7.3949
Brown, N.M., Millar, M.R., Frost, J.A. and Rowe, B., 1999. Ciprofloxacin resistance in Salmonella paratyphi A. J. Antimicrob. Chemother., 33: 1258-1259. https://doi.org/10.1093/jac/33.6.1258
Bruinsma, N., Kristinsson, K.G., Bronzwaer, S., Schrijnemakers, P., Degener, J.E., Tiemersma, E., Hryniewicz, W., Monen, J. and Grundmann, H., 2004. Trends of Penicillin and erythromycin resistance among invasive Streptococcus pneumoniae in Europe. J. Antimicrob. Chemother., 54: 1045-1050. https://doi.org/10.1093/jac/dkh458
Carlson, S.A., Meyerholz, D.K., Stabel, T.J. and Jones, B.D., 2001. Secretion of a putative cytotoxin in multiple antibiotic resistant Salmonella enterica serotype Typhimurium phagetype DT104. Microb. Pathogen., 31: 201-204. https://doi.org/10.1006/mpat.2001.0461
Chelliah, R., Wei, S., Park, B., Park, J., Park, Y. and Kim, S., 2019. New perspectives on mega plasmid sequence (poh1) in Bacillus thuringiensis ATCC 10792 harbouring antimicrobial, insecticidal and antibiotic resistance genes. Microb. Pathogen., 126: 14-18. https://doi.org/10.1016/j.micpath.2018.10.013
Ding, Y., Zhao, J., He, X., Li, M., Guan, H., Zhang, Z. and Li, P., 2016. Antimicrobial resistance and virulence-related genes of Streptococcus obtained from dairy cows with mastitis in Inner Mongolia, China. Pharmaceut. Biol., 54: 162-167. https://doi.org/10.3109/13880209.2015.1025290
Dmitriev, A., Shakleina, E., Tkacikova, L., Mikula, I. and Totolian, A.A., 2002. Genetic heterogeneity of the pathogenic potentials of human and bovine group B Streptococci. Folia Microbiol., 47: 291-295. https://doi.org/10.1007/BF02817655
Gautier, A.V., Reinhardt, A.K. and Kobisch, M., 2002. In vitro development of resistance to enrofloxacin, erythromycin, tylosin, tiamulin and oxytetracycline in Mycoplasma gallisepticum, Mycoplasma iowae and Mycoplasma synoviae. Vet. Microbiol., 88: 47-58. https://doi.org/10.1016/S0378-1135(02)00087-1
Ghorbel, D., Hadrich, I., Neji, S., Trabelsi, H., Belaaj, H., Sellami, H., Cheikhrouhou, F., Makni, F. and Ayadi, A., 2019. Detection of virulence factors and antifungal susceptibility of human and avian Aspergillus flavus isolates. J. med. Mycol., 29: 292-302. https://doi.org/10.1016/j.mycmed.2019.100900
Guo, Y., Zhao, Z.H., Pan, Z.Y., An, L.L., Balasubramanian, B. and Liu, W.C., 2020. New insights into the role of dietary marine-derived polysaccharides on productive performance, egg quality, antioxidant capacity, and jejunal morphology in late-phase laying hens. Poult. Sci., 99: 2100-2107. https://doi.org/10.1016/j.psj.2019.12.032
Huys, G., Haene, K., Collard, J.M. and Swings, J., 2004. Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl. environ. Microbiol., 70: 1555-1562. https://doi.org/10.1128/AEM.70.3.1555-1562.2004
Helena, S., Timo, K. and Jaana, V., 1997. The effect of changes in the consumption of macrolide antibiotics on erythromycin resistance in group A Streptococci in Finland. New Engl. J. Med., 337: 441-446. https://doi.org/10.1056/NEJM199708143370701
Jain, B., Tewari, A., Bhandari, B.B., Jhala, M.K., 2012. Antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Vet. Arhiv, 82: 423-432.
Johnson, T.J., Johnson, S.J. and Nolan, L.K., 2006. Complete DNA sequence of a colbm plasmid from avian pathogenic Escherichia coli suggests that it evolved from closely related ColV virulence plasmids. J. Bact., 188: 5975-5983. https://doi.org/10.1128/JB.00204-06
Johnson, J.R., Kuskowski, M.A., O’Bryan, T.T., Colodner, R. and Raz, R., 2005. Virulence genotype and phylogenetic origin in relation to antibiotic resistance profile among Escherichia coli urine sample isolates from Israeli women with acute uncomplicated cystitis. Antimicrob. Agents Chemother., 49: 26-31. https://doi.org/10.1128/AAC.49.1.26-31.2005
Ko, W.C., Lee, H.C., Wang, L.R., Lee, C.T., Liu, A.J. and Wu, J.J., 2001. Serotyping and antimicrobial susceptibility of group B Streptococcus over an eight-year period in southern Taiwan. Eur. J. clin. Microbiol. Infect. Dis., 20: 334-339. https://doi.org/10.1007/s100960100505
Lancaster, H., Roberts, A., Bedi, R., Wilson, M. and Mullany, P., 2004. Characterization of Tn916S, a Tn916- like element containing the tetracycline resistance determinant tet(S). J. Bact., 186: 4395-4398. https://doi.org/10.1128/JB.186.13.4395-4398.2004
Laporta, M.Z., Silva, M.L., Scaletsky, I.C. and Trabulsi, L.R., 1986. Plasmids coding for drug resistance and localized adherence to Hela cells in Enteropathogenic Escherichia coli O55:H-and O55:H6. Infect. Immun., 51: 715-717. https://doi.org/10.1128/iai.51.2.715-717.1986
Lehtolainen, T., Shwimmer, A., Shpigel, N.Y., Honkanenbuzalski, T. and Pyorala, S., 2003. In vitro antimicrobial susceptibility of Escherichia coli isolates from clinical bovine mastitis in Finland and Israel. J. Dairy Sci., 86: 3927-3932. https://doi.org/10.3168/jds.S0022-0302(03)74001-6
Liu, M.C., Wu, C.M., Liu, Y.C., Zhao, J.C., Yang, Y.L. and Shen, J.Z., 2009. Identification, susceptibility, and detection of integron-gene cassettes of Arcanobacterium pyogenes in bovine endometritis. J. Dairy Sci., 92: 3659-3666. https://doi.org/10.3168/jds.2008-1756
Liu, W., Yuan, Y., Sun, C., Balasubramanian, B., Zhao, Z. and An, L., 2019. Effects of dietary betaine on growth performance, digestive function, carcass traits, and meat quality in indigenous yellow-feathered broilers under long-term heat stress. Animals, 9: 506. https://doi.org/10.3390/ani9080506
Liu, W.C., Zhou, S.H., Balamuralikrishnan, B., Zeng, F.Y., Sun, C.B. and Pang, H.Y., 2020. Dietary seaweed (Enteromorpha) polysaccharides improves growth performance involved in regulation of immune responses, intestinal morphology and microbial community in banana shrimp Fenneropenaeus merguiensis. Fish Shellf. Immunol., 104: 202-212. https://doi.org/10.1016/j.fsi.2020.05.079
Lopardo, H.A., Vidal, P., Jeric, P., Centron, D., Paganini, H., Facklam, R.R. and Elliott, J., 2003. Six-month multicenter study on invasive infections due to group B Streptococci in Argentina. J. clin. Microbiol., 41: 4688–4694. https://doi.org/10.1128/JCM.41.10.4688-4694.2003
Marimo´n, J.M., Valiente, A., Ercibengoa, M., Garciaarenzana, J.M. and Pereztrallero, E., 2005. Erythromycin resistance and genetic elements carrying macrolide efflux genes in Streptococcus agalactiae. Antimicrob. Agents Chemother., 49: 5069-5074. https://doi.org/10.1128/AAC.49.12.5069-5074.2005
Martel, A., Baele, M. and Deviese, L.A., 2001. Prevalence and mechanism of resistance against macrolides and Lincosamides in Streptococcus suis isolates. Vet. Microbiol., 83: 287-297. https://doi.org/10.1016/S0378-1135(01)00426-6
Moran, R.A., Holt, K.E. and Hall, R.M., 2016. pCERC3 from a commensal ST95 Escherichia coli: A ColV virulence-multiresistance plasmid carrying a sul3-associated class 1 integron. Plasmid, 85: 11-19. https://doi.org/10.1016/j.plasmid.2016.02.002
Wu, J., Su, Y., Deng, Y., Guo, Z., Cheng, C., Ma, H., Liu, G., Xu, L. and Feng, J., 2019. Spatial and temporal variation of antibiotic resistance in marine fish cage-culture area of Guangdong, China. Environ. Pollut., 246: 463-471. https://doi.org/10.1016/j.envpol.2018.12.024
Martínez, J.L. and Baquero, F., 2002. Interactions among strategies associated with bacterial infection: Pathogenicity, epidemicity, and antibiotic resistance. Clin. Microbiol. Rev., 15: 647-679. https://doi.org/10.1128/CMR.15.4.647-679.2002
Neill, A.J.O., Huovinen, T.C., Fishwick, G. and Chopra, I., 2006. Molecular genetic and structural modeling studies of Staphylococcus aureus RNA polymerase and the fitness of Rifampin resistance genotypes in relation to clinical prevalence. Antimicrob. Agents Chemother., 50: 298-309. https://doi.org/10.1128/AAC.50.1.298-309.2006
Okitsu, N., Kaieda, S. and Yano, H., 2005. Characterization of ermB gene transposition by Tn1545 and Tn917 in macrolide-resistant Streptococcus pneumonia isolates. J. clin. Microbiol., 43: 168-173. https://doi.org/10.1128/JCM.43.1.168-173.2005
Rathnayake, I.U., Hargreaves, M. and Huygens, F., 2012. Antibiotic resistance and virulence traits in clinical and environmental Enterococcus faecalis and Enterococcus faecium isolates. Syst. appl. Microbiol., 35: 326-333. https://doi.org/10.1016/j.syapm.2012.05.004
Reid, C.J., McKinnon, J. and Djordjevic, S.P., 2019. Clonal ST131-H22 Escherichia coli strains from a healthy pig and a human urinary tract infection carry highly similar resistance and virulence plasmids. Microb. Genom., 9: 1-12. https://doi.org/10.1099/mgen.0.000295
Sahm, D.F., Brown, N.P., Thornsberry, C. and Jones, M.E., 2008. Antimicrobial susceptibility profiles among common respiratory tract pathogens: A Global perspective. Postgrad. Med., 120: 16-24. https://doi.org/10.3810/pgm.2008.09.suppl52.280
Schaeffer, A.J., 2002. Decreased invasive capacity of Quinolone-resistant Escherichia coli in patients with urinary tract infections. J. Urol., 168: 393-394. https://doi.org/10.1016/S0022-5347(05)64960-9
Sherman, K., Whitehead, S., Blondel-Hill, E., Wagner, K. and Cheeptham, N., 2012. Penicillin susceptibility and macrolide-lincosamide-streptogramin B resistance in group B Streptococcus isolates from a Canadian hospital. Canadian J. Infect. Dis. med. Microbiol., 23: 196-198. https://doi.org/10.1155/2012/540127
Song, J.H., Chang, H.H. and Suh, J.Y., 2004. Macrolide resistance and genotypic characterization of Streptococcus pneumoniae in Asian countries: A study of the Asian network for surveillance of resistant pathogens. J. Antimicrob. Chemother., 53: 457-463. https://doi.org/10.1093/jac/dkh118
Vila, J., Simon, K., Ruiz, J., Horcajada, J.P., Velasco, M., Barranco, M., Moreno, A. and Mensa, J., 2002. Are Quinolone-resistant uropathogenic Escherichia coli less virulent? J. Infect. Dis., 186: 1039-1042. https://doi.org/10.1086/342955
Villa, L. and Carattoli, A., 2005. Integrons and transposons on the Salmonella enterica serovar typhimurium virulence plasmid. Antimicrob. Agents Chemother., 49: 1194-1197. https://doi.org/10.1128/AAC.49.3.1194-1197.2005
Wang, B., Li, B., Liang, Y., Li, J., Gao, L., Chen, L., Duan, K. and Shen, L., 2016. Pleiotropic effects of temperature-regulated 2-OH-lauroytransferase (PA0011) on Pseudomonas aeruginosa antibiotic resistance, virulence and type III secretion system. Microb. Pathogen., 91: 5-17. https://doi.org/10.1016/j.micpath.2015.11.003
Werner, G., Willems, R.J., Hildebrandt, B., Klare, I. and Witte, W., 2003. Influence of transferable genetic determinants on the outcome of typing methods commonly used for Enterococcus faecium. J. clin. Microbiol., 41: 1499-1506. https://doi.org/10.1128/JCM.41.4.1499-1506.2003
Zhang, W., Zhang, Y., Wang, X., Ding, F., Fu, Y., Zhao, J., Song, W., Opiyo, O.J., Zhang, F. and Chen, X., 2017. Siderophores in clinical isolates of Klebsiella pneumoniae promote ciprofloxacin resistance by inhibiting the oxidative stress. Biochem. biophys. Res. Commun., 491: 855-861. https://doi.org/10.1016/j.bbrc.2017.04.108
Zhu, J. and Wang, C.J., 2013. Research progress on 89K pathogenicity island of Streptococcus suis serotype 2. Microbiol. China, 40: 1487-1492.
Zhao, H.X., Shen, J.Z., An, X.P., Fan, H., Cao, J. and Li, P., 2011. Characterization of integrons in multiple antimicrobial resistant Escherichia coli isolates from bovine endometritis. Res. Vet. Sci., 91: 412-414. https://doi.org/10.1016/j.rvsc.2010.09.004