Research Article
Traditional and Molecular Detection of Cryptosporidium Parasite in Quails (Coturnix coturnix) in Baghdad Province, Iraq
Khitam J. Yahya*, Mohammed T. S. Al-Zubaidi
Department of Parasitology, College of Veterinary Medicine, University of Baghdad.
Abstract | Cryptosporidiosis is a wildword disease among birds. Detection of cryptosporidiosis in quails required to be more sensitivity and specificity using molecular analysis and sequences. A total of 100 fecal samples were collected from quails in various parts of Baghdad/ Iraq from January to September, and they were then tested for the presence of Cryptosporidium spp. using molecular methods (PCR), followed by DNA sequencing. The overall infection rate was 37% (37/100) of the samples were Cryptosporidium-positive by using PCR. Three of five quails whose 18S gene was amplified by nested PCR and sequenced were found to belong to C. meleagridis in the sequence of this gene deposit on the website of the National Center for Biotechnology Information (NCBI) under accession number (HQ917077.1), while the others were found to be closely related to C. baileyi and had the accession number (MN410723.1). The finding suggests that Cryptosporidium parasites, which cause zoonotic disease transmission, are widespread among Baghdad quails.
Keywords | Cryptosporidium, Quail; nested PCR; Detection; Baghdad.
Received | March 29, 2023; Accepted | April 15, 2023; Published | April 25, 2023
*Correspondence | Khitam J Yahya, Department of Parasitology, College of Veterinary Medicine, University of Baghdad; Email: [email protected]
Citation | Yahya KJ, Al-Zubaidi MTS (2023). Traditional and molecular detection of cryptosporidium parasite in quails (coturnix coturnix) in baghdad province, Iraq. Adv. Anim. Vet. Sci. 11(6): 864-869.
DOI | http://dx.doi.org/10.17582/journal.aavs/2023/11.6.864.869
ISSN (Online) | 2307-8316
Copyright: 2023 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Among the most common enteric protozoan parasite that affects a variety of host animals is Cryptosporidium. Many Cryptosporidium spp. that have been linked to zoonotic illnesses across the globe include C. andersoni C. baileyi, C. bovis, C. canis, C. cuniculus, C. erinacei, C. fayeri, C. felis, C. hominis, C. meleagridis, C. muris, C. parvum, C. scrofarum, C. suis, C. tyzzeri, C. ubiquitum, and C. xiaoi, etc. (Ryan et al., 2021).
Tyzzer, (1929) initial description of Cryptosporidiosis in birds involved the caeca of a chicken. Numerous domestic, pet, commercial, and wild birds, including chicken, turkey, quail, duck, ostrich, pheasant, seagull, peafowl, psittacine, finches, cranes, falcon, sparrow, pigeon, flamingo, vulture, crow, dove, geese, and waterfowl, have been isolated and reported to harbor Cryptosporidium spp. (Kabir et al., 2020; Hamza and Hameed, 2020a). Avian species C. andersoni, C. baileyi, C. muris, C. parvum, and C. meleagridis which was the most significant zoonotic protozoan that can infect humans and responsible for 10% of zoonotic transmission (Faraj, 2014; Lu et al., 2022). Clinical sign involves intestinal Cryptosporidiosis characterized by brown foamy diarrhea, and respiratory Cryptosporidiosis show several signs, the most important of which are difficulty breathing, sneezing, and mucous respiratory secretions from nostrils (Wang et al., 2021). The diagnosis of Cryptosporidiosis in birds is depend generally on the traditional and more sensitive molecular test. Because of the widespread prevalence of this parasite and its veterinary and economic importance to it, the study was designed to explore the spread of the Cryptosporidium parasite in quail (Coturnix coturnix) and identified the species by sequences analysis of some samples.
Table 1: Cryptosporidium spp. primers of the nested PCR.
| Round | Primer sequence | Produce size | |
|
First round |
Crypto18S1F | TTCTAGAGCTAATACATGCG |
900 bp |
| Crypto18S1R |
CCCATTTCCTTCGAAACAGGA |
||
| Second round | Crypto18S2F | GGAAGGGTTGTATTTATTAGATAAAG |
830bp |
| Crypto18S2R |
CTCATAAGGTGCTGAAGGAGTA |
||
Table 2: the NCBI-BLAST Homology Sequence identity percentage between Cryptosporidium species quails isolates and NCBI-BLAST closed genetically related Cryptosporidium species isolate
|
Cryptosporidium Species isolate |
Accession number |
Homology sequence identity (%) | |||
|
Identical Cryptosporidium spp. |
Accession number | Related country | Identity (%) | ||
|
Cryptosporidium sp. Quails No. 1 isolate |
OP420778.1 | Cryptosporidium baileyi | MN410723.1 | China | 99.72% |
|
Cryptosporidium sp. Quail No. 2 isolate |
OP420779.1 |
Cryptosporidium meleagridis | HQ917077.1 | China | 99.74% |
|
Cryptosporidium sp. Quails No.3 isolate |
OP420780.1 | Cryptosporidium meleagridis | HQ917077.1 | China | 99.74% |
|
Cryptosporidium sp. Quails No.4 isolate |
OP420781.1 | Cryptosporidium meleagridis | HQ917077.1 | China | 99.74% |
|
Cryptosporidium sp. Quail No. 5 isolate |
OP420782.1 | Cryptosporidium baileyi | MN410723.1 | China |
99.86% |
Materials and methods
Field Study
Fresh dropping samples were collected from 100 quails in Baghdad at different ages from January 2022 to September 2022. Samples were collected and transferred to the parasitology laboratory of the Veterinary College University of Baghdad,
Samples collection
Each sample was divided into two parts, the first for direct examination for parasite investigation by both direct examination and confirmed by modified Ziehl-Neelson stain and the second was stored at -20 °C for molecular techniques examination which was done in the internal and preventive medicine department of the veterinary college. All samples were examined by nested PCR targeting the 18S rRNA gene as described below according to the method described by (Yu et al., 2009).
Extraction of Genomic DNA
Dropping-sample-based extraction was conducted by AccuPrep® stool DNA Extraction Kit and according to the company protocol (Bioneer from Korea).
Primers of PCR
The lyophilized primers for the PCR were provided, and the final primer stock concentration of 100 Pico moles/µl was achieved by dissolving the primers in De-ionized water. Before usage, these were stored at -20ºC. The working concentration of the primers in the entire PCR experiment was (0.5 Pico mole/ 20µl in the total PCR reaction). All these primers were supplied from Micro gen / Korea (Table 1) and all primer sequences used here were taken from (Xiao et al., 1999).
PCR reaction component preparation: PCR construction was prepared by using (Maxime PCR PreMix Kit) 10µl, 3µl of DNA template, 1µl of 18SrRNA forward primer 1(10 p mol), 1µl of 18SrRNA reverse primer1 (10 p mol), and 5µl of PCR water) for first round and (10µl master mix, 1µl DNA of PCR product, 1µl of 18SrRNA forward primer 2 (10p mol), 1µl of 18SrRNA reverse primer2 (10 pmol), and 7µl of PCR water). The PCR master mix component was placed in standard Maxime (PCR PreMix) which contains (Taq DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, MgCl2, stabilizer, and tracking dye). Then, all the PCR tubes were transferred into an Exispin vortex centrifuge at (3000 rpm for 3 min.). Then placed in a PCR thermocycler. The cycling conditions consist of a hot start at 94ºC for 5 min followed by 30 cycles with denaturation at 94ºC for 30 seconds, annealing at 58ºC for 30 seconds, and at 72ºC for 30 seconds, and a final extension at 72ºC for 5 minutes then holding at 4ºC forever (Ruecker et al., 2013).
Amplicon sequencing and analysis
Five amplicons were selected randomly for DNA sequencing and phylogenetic analysis after registering them in the gene bank (NCBI) in Macro Gen Company (Korea).
Results
The oocysts of Cryptosporidium spp. under lenses by traditional methods appear oval to spherical shape by direct examination and red cycle body, blue background, and a clear hallow around it by modified Ziehl-Neelson stain Figure (1).
The infection rate of Cryptosporidium spp. in quails by using nested PCR technique
The molecular diagnosis showed that the infection rate in quails was 37% (37/100), the samples were collected randomly from 100 quails in Baghdad city. All drop samples showed a unique 830 bp on agarose gel for Cryptosporidium spp. as shown in Figure (2).
Phylogenetic analysis of Cryptosporidium spp. in quails.
The 18S rRNA gene was used for genetic species typing analyses in local Cryptosporidium species from quail-isolated Cryptosporidium species isolates from NCBI-Genbank. The phylogenetic tree relationship analysis revealed that the Cryptosporidium species quails isolates (No.2, No.3, and No.4) showed closed relationships to NCBI-BLAST Cryptosporidium meleagridis (HQ917077.1) and the Cryptosporidium species quails isolates (No.1 and No.5) showed closed related to NCBI-BLAST Cryptosporidium baileyi (MN410723.1) at total genetic change (0.01-0.04%) as showed in Figure (3).
The genetic homology sequence identity from (88-98%) according to the phylogenetic tree similarity study between local Cryptosporidium spp. isolates and NCBI-Genbank-related Cryptosporidium spp. according to NCBI-BLAST results, the genetic homology sequence identity between local Cryptosporidium species quails closely related to C. meleagridis (HQ917077.1) and C. baileyi (MN410723.1) varied from (99.72-99.74%) Table (2).
Discussion
Numerous spp. of Cryptosporidium have been identified using a nested PCR technique that amplified DNA from just one oocyst and targeted the 18S rRNA gene, which has been found to be very sensitive (Karanis et al., 2010; Thigeel, 2016) Compared to the modified Ziehl-Neelsen (mZN) staining method. Therefore, in the current work, Cryptosporidium spp. detection was focused on the 18S rRNA gene fragment due to their repeating organization inside the genome even in the tiniest species that offers an abundance of template DNA for PCR. All living beings are subject to similar selective pressures on the 18S rRNA gene, which is composed of the ribosomal functional core (Lambert et al., 2019). Nested PCR results showed that 37% of quails had an overall infection rate with Cryptosporidium spp.
This finding concurs with that of Al-Zubaidi et al. (2018) who discovered a 35% infection rate in broiler chickens. Al-Ghezey and Al-Zubaidi, (2020) found that the infection rate in layers was 36% which agrees with our result and disagrees with them the same research which recorded the infection rate of broilers as 64% and agreement with Al-Tamimi and Al-Zubaidi, (2021) in Babylon, who discovered that 13/21 (61.90%) of pigeons had been infected with C. meleagridis, followed by 7/21 (33.33%) with C. baileyi, and only one (1/21) (4.76%) with C. hominis. According to Hamza and Hameed, (2020b), ostriches had a 26.5% infection rate. In contrast, Al- Taei, (2015) discovered a 4.4% infection rate in broiler chickens in Babylon and also disagree with Jasim and Marhoon, (2015) in Al-Diwania discovered that the quail infection rate was 76.7%. This result is in conflict with Saeed et al. (2021) indicated that 31/160 (19.4%) of the sample were positive for Cryptosporidium a total of 26.6% (8/30) of turkeys, 17% (17/100) of the domestic chicken, and 23.3% (7/30) of wild ducks tested positive for Cryptosporidium. The lowest infection rate was 1.9% (5/263) recorded in Beijing Zoo and Harbin North Forest Zoo by Lu et al. (2022). Quails infected with coccidian have the highest infection rate (64.54%) recorded by (AL-Zarkoushi and AL-Zubaidi, 2022).
Birds are thought to spread a range of infections over the world, with the genus Cryptosporidium being among the most significant due to its widespread diagnosis in birds. There have been few studies that have attempted to identify Cryptosporidium in quails. The high rate of infection in various types of birds may be due to poor management of the birds in the same cage, stressing conditions, area of sampling (farming/ captive), the sampling methods and samples size the presence of small mammals in pet stores that may be infected with Cryptosporidium spp., and possibly other factors could have caused the spread of oocyst in the surrounding and birds may be considered as mechanical transporters of Cryptosporidium spp. (Al-khayat and Al-Zubaidi, 2015; Lin et al., 2022).
DNA sequencing and phylogenetic analysis have emerged as the most popular methods for identifying Cryptosporidium species isolated from various geographic and host origins. Based on the rRNA analysis used in this work, DNA sequences are identical to those used in several earlier investigations (Al-Amery and Al-Amery, 2022; Liao et al., 2018).
According to this study, quail C. meleagridis and C. baileyi sequences are present in the 18S rRNA gene sequences which support the finding of Hamza and Hameed (2020 b), who discovered that ostriches in the central and southern districts of Iraq four different species of Cryptosporidium, including C. parvum, C. meleagridis, C. baileyi, and C. galli. The nested PCR test in Al- Diwaniya which was done by Saeed et al. (2020) found C. meleagridis in 50% of domestic chickens, 27% of turkeys, and 19% of wild ducks and show that C. meleagridis is widely distributed among domestic bird species. Our findings resembled those of Kabir et al. (2020), who recovered three cases of Cryptosporidium spp. from chicken in Bangladesh. These cases included C. baileyi, C. meleagridis, and C. parvum. Eight of 48 chicken samples from Hubei province tested positive for C. baileyi, and one had C. meleagridis infection (Liao et al., 2018). The result of the sequence analysis of the Cryptosporidium spp. in Algerian farm chicken broilers matched those of our study (Holubova et al., 2017). Lin et al. (2022) in China determined cryptosporidiosis in birds by 13.2% with two species C. meleagridis (7.8%) and C. baileyi (4.8%), Hotan Black Chinese Chicken have an infection with C. meleagridis and C. baileyi with infection rate 11.5% (Feng et al., 2022), according to Yao et al. (2017), another kind of birds in China called Java sparrows infected with C. baileyi about 13.42%. sequencing supported the existence of C. parvum and C.baileyi which is in contrast to Jian et al., (2021) findings, who investigated Cryptosporidium spp. in wild birds near Qinghai Lake in China with an infection rate of 8.98%.
By analyzing the 18S rRNA gene at the molecular level, C. meleagridis and C. baileyi were confirmed. This finding was in line with earlier research on several bird species, which are key Cryptosporidium reservoirs. Both C. meleagridis and C. baileyi have regularly been found in humans all around the world, particularly in immunocompromised people like newborns and people with HIV/AIDS (Qamar et al., 2021). After C. hominins and C. parvum. C. meleagridis is the third pathogen that affects humans. Additionally, it was found in multiple investigations that humans and birds shared the same species, indicating that there may be cross-species transmission between birds and humans. Birds may act as a source of infection as well as a vector by shedding oocysts into the environment. Foreign travel is a key element in the spread of sickness, and the export of birds from countries where the disease is endemic also helps (Zaheer et al., 2021).
Conclusions
Cryptosporidium spp. was widespread in quails and therefore the result obtained in the present study suggests that birds may be considered mechanical transporters of Cryptosporidium oocysts. The ducks, chicks, and quails could be purchased for these children and kept as pets inside households, becoming a risk for infection to humans of all ages.
Recommendations
Future studies might focus on investigating the prevalence of ‘zoonotic’ subtypes of Cryptosporidium meleagridis in various species of wild and domesticated birds, and on comparing them with those found in humans in Iraq and other countries.
Acknowledgments
I would like to thank Prof. Dr. Mohammed Thabit for his flexibility, professional ideas, and advice throughout my study and to the staff of the Parasitology Department / College of Vet. Med. Baghdad University.
Conflicts of interest
There were no conflicts of interest during this investigation.
Novelty statement
There is no data available in Iraq about cryptosporidiosis in quails and due to the extensive prevalence of this parasite and its veterinary and economic importance to it, the study was conducted to explore the spread of cryptosporidium parasite in quail (Coturnix coturnix) and identified the species by sequencing analysis of selected samples.
Author’s contributions
Khitam J. Yahya made contributions to the idea and design of the study, data collection, analysis, and interpretation, as well as paper drafting and revision.
Mohammed T.S. Al-Zubaidi was involved in the collection of data, data analysis and interpretation, and paper revision. All authors agree on the journal to which the article has been submitted, granted their final approval of the version to be published, and pledged to take responsibility for every part of the work.
References
Al-Amery A. R., Al-Amery A. M. A. (2022). Molecular diagnosis of Cryptosporidium ssp. in water Buffaloes at Babylon province, Iraq. Iraqi J. Agricult. Sci., 53(1): 147-156. https://doi.org/10.36103/ijas.v53i1.1519
AL-Ghezey M. R., Al-Zubaidi M. T. (2020) Molecular detection of Cryptosporidium parasite in chickens (broiler and layer) in Thi-Qar province, Iraq. Plant Archiv., 20 (2): 7680-768.
Al-Khayat K. Kh. K., M.Th. S. Al- Zubaidi (2015). Some epidemiological studies of Cryptosporidium spp. in broiler chickens in some areas of Karbala Province. Iraqi J. Vet. Med., 39(1): 8-5.
Al-Taei H.A. (2015). A study in the epidemiology of Cryptosporidiosis in broiler chickens and ducks in Babylon province with an evaluation of some biochemical parameters in infected chickens. MSc thesis. The University of Baghdad, Baghdad, Iraq.
Altamimi M. K., Al-Zubaidi M. T. S. (2021). High Prevalence of Cryptosporidium meleagridis in Domestic Pigeons (Columba livia domestica) raises a Prospect of Zoonotic Transmission in Babylon Province, Iraq. Iraqi J. Vet. Med., 44(E0): 7–13. https://doi.org/10.30539/ijvm.v44i(E0).1012
AL-Zarkoushi M. M. F., AL-Zubaidi M. T. S. (2022). Molecular Study of Eimeria species in Quail birds (Coturnix coturnix japonica) in Thi-Qar Province, Southern Iraq. Indian J. Forensic Med. Toxicol., 16(1): 1674-1680. https://doi.org/10.37506/ijfmt.v16i1.17809
Al-Zubaidi M. T. S., Kadhim L. I., Ibrahim Z. I., Al-Rikabi A. S. (2018). Incidence and experimental infection of Cryptosporidium baileyi in chicken. Iraqi J. Agricult. Sci., 49(2): 269-278. https://doi.org/10.36103/ijas.v49i2.162
Faraj A.A. (2014). Distribution of Cryptosporidium spp infection in wild pigeons in Baghdad city -Iraq. Basrah J. Vet. Res., 13(2): 48-53. https://doi.org/10.33762/bvetr.2014.98793
Feng X., Xin L., Yu F., Song X., Zhang J., Deng J., Qi M., Zhao W. (2022). Genetic characterization of Cryptosporidium spp. in Hotan Black Chickens in China reveals two novel subtypes of Cryptosporidium meleagridis. Parasite., 29. https://doi.org/10.1051/parasite/2022051
Hamza A. Z. H., Hameed K. M. (2020a). Prevalence of Cryptosporidiosis in ostriches from central and south parts of Iraq. Iraqi J. Vet. Med., 44(1): 63-67. https://doi.org/10.30539/ijvm.v44i1.937
Hamza A. Z. H., Hameed K. M. (2020b). Molecular identification of Cryptosporidium species from ostriches in central and southern parts of Iraq. Plant Archiv., 20(1): 2747-2752. https://doi.org/10.30539/ijvm.v44i1.937
Holubová N., Sak B., Kváč M. (2017). Cryptosporidium meleagridis and C. baileyi (Apicomplexa) in domestic and wild birds in Algeria. Folia Parasitolog., 64. https://doi.org/10.14411/fp.2017.018
Jasim G. A., Marhoon I. A. (2015). Prevalence and molecular analysis of Cryptosporidium spp. isolated from wild and domestic birds. Acta Parasitolog. Global., 6(2): 65-70.
Jian Y., Zhang X., Li X., Schou C., Charalambidou I., Ma L., Karanis P. (2021). Occurrence of Cryptosporidium and Giardia in wild birds from Qinghai Lake on the Qinghai-Tibetan Plateau, China. Parasitol. Res., 120(2): 615-628. https://doi.org/10.1007/s00436-020-06993-w
Kabir M. H. B., Han Y., Lee S. H., Nugraha A. B., Recuenco, Murakoshi F., Xuan X., Kato K. (2020). Prevalence and molecular characterization of Cryptosporidium species in poultry in Bangladesh. One Health., 9: 100122. https://doi.org/10.1016/j.onehlt.2020.100122
Karanis P., Eiji T., Palomino L., Boonrod K., Plutzer Ongerth J., Lgarashi I. (2010). First description of Cryptosporidium bovis in Japan and diagnosis and genotyping of Cryptosporidium spp. in diarrheic pre-weaned calves in Hokkaido. Vet. Parasit., 169: 387-390. https://doi.org/10.1016/j.vetpar.2010.01.014
Lambert M., Benmoussa A., Provost P. (2019). Small non-coding RNAs derived from eukaryotic ribosomal RNA. Non-coding RNA., 5(1): 16. https://doi.org/10.3390/ncrna5010016
Liao C., T. Wang, A.V. Koehler, Y. Fan, M. Hu, R.B. Gasser (2018). Molecular investigation of Cryptosporidium in farmed chickens in Hubei Province, China, identifies ‘zoonotic’ subtypes of C. meleagridis. Parasit. Vectors., 11(1): 484. https://doi.org/10.1186/s13071-018-3056-5
Lin X., Xin L., Qi M., Hou M., Liao S., Qi N., Sun M. (2022). Dominance of the zoonotic pathogen Cryptosporidium meleagridis in broiler chickens in Guangdong, China, reveals evidence of cross-transmission. Parasit. Vect., 15(1): 1-8. https://doi.org/10.1186/s13071-022-05267-x
Lu Y., Pu T., Ma B., Wang L., Zhou Chen Y., Li X., Zheng X., Liu H., Lin J., Guan C., Yu H., Dai C., Huang Y., Yang Y., Peng Z., Han L., Chai H., Hou Z., (2022). A survey of Cryptosporidium prevalence among birds in two zoos in China. PeerJ, 10: e12825. https://doi.org/10.7717/peerj.12825
Qamar M. F., Abbas R. Z., Zaman M. A., Ali K., Atif F.A., Hussain T., Liaqat I., Kiran M., Fadladdin Y.A., Bibi A., Londhe M.V., Saeed J. (2021). Molecular Detection of Fancy Birds Parasites for Clinical Diagnosis and Epidemiology-A Review.
Ryan U., Zahedi A., Feng Y., Xiao L. (2021). An update on zoonotic Cryptosporidium species and genotypes in humans. Animals., 11(11): 3307. https://doi.org/10.3390/ani11113307
Ruecker N.J., Matsune J.C., Lapen D.R., Topp E., Edge T., Neumann N.F. (2013). The detection of Cryptosporidium and the resolution of mixtures of species and genotypes from water. Infect Genet. Evol., 15: 3-9. https://doi.org/10.1016/j.meegid.2012.09.009
Saeed A. A., Meteab B. K., AL-Shuwaili M. A. R. (2021). Molecular diagnosis and prevalence of Cryptosporidium parasite in domestic bird in Diwaniya city, Iraq. Iranian J. Ichthyol., 8: 145-149.
Thigeel H. (2016). A study of factors associated with Giardia and Cryptosporidium infections in humans, dogs, and cats in the USA. Ph.D. Thesis University of Colorado State, 299 pp.
Tyzzer E. E. (1929). Coccidiosis in gallinaceous birds. American J. Trop. Med. Hyg. 10: 269-349. https://doi.org/10.1093/oxfordjournals.aje.a112759
Wang Y., Zhang K., Chen Y., Li X., Zhang L. (2021). Cryptosporidium and Cryptosporidiosis in wild birds: A One Health perspective. Parasitol. Res., 120(9): 3035-3044. https://doi.org/10.1007/s00436-021-07289-3
Xiao L., Morgan U. M., Limor J., Escalante A., Arrowood, Shulaw W., Thompson R. C. A., Fayer R., Lal A.A. (1999). Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl. Environ. Microbiol., 65(8): 3386-3391. https://doi.org/10.1128/AEM.65.8.3386-3391.1999
Yao Q. X., Zhang X. X., Chen K., Ma J. G., Zheng W. B., Xu X. Q., Zhu X.Q. (2017). Prevalence and genetic characterization of Cryptosporidium infection in Java Sparrows (Lonchura oryzivora) in northern China. BioMed. Res. Int., 2017: 2318476. https://doi.org/10.1155/2017/2318476
Yu J. R., Lee S. U., Park W. Y. (2009). Comparative sensitivity of PCR primer sets for detection of Cryptosporidium parvum. Korean J. Parasitol., 47(3): 293. https://doi.org/10.3347/kjp.2009.47.3.293
Zaheer T., Imran M., Abbas R. Z., Zaheer I., Malik M. A. (2021). Avian cryptosporidiosis and its zoonotic significance in Asia. World’s Poult. Sci. J., 77(1): 55-70. https://doi.org/10.1080/00439339.2020.1866961