Research Article
Sumbal Nazir1*, Farkhanda Manzoor2, Ishrat Perveen3, Anum Rana2, Irum Naureen1, Abad Ali Nadeem3 and Hafiza Najma Naeem2
1School of Zoology, Minhaj University Lahore, Pakistan; 2 Department of Zoology, Lahore College for Women University Lahore, Pakistan; 3Gene Editing Lab, Food and Biotechnology Research Centre, PCSIR Labs Complex, Ferozepur Road, Lahore, Pakistan.
Abstract | Honeybees are the world’s most important pollinators of food crops. Honeybee plays an essential role in pollination of commercial crops. Some viral, bacterial, protozoan, and fungal pathogens are attached on the honeybees worldwide. These pathogens affect the honeybee population by creating disease in it, which also effect the economy of country. It destroys the honey production and causes a subsequent reduction in the crop yield. In this present work, we isolated and screened various honeybee pathogens i.e., Nosema apis, Nosema cerus, Acute bee paralysis virus (ABPV), Black queen cell virus (BQCV), Sacbrood virus (SBV), Deformed wing virus (DWV), Kashmir bee virus (KBV), Black queen cell virus (BQCV), chronic bee paralysis virus (CBV) and Israeli acute paralysis virus (IAPV). For the pathogen screening, collection of guts from the diseased honeybee colonies was followed by RNA isolation. The RNAs were quantified on spectrophotometer. Results have shown the occurrence of fungus and/or pathogen infestation which was caused by microsporidium Nosema apis with 277bp. It has been observed that the honeybee colonies were badly affected due to Nosemosis disease which was caused by microsporidian fungus Nosema apis. This microsporidian fungus causes dysentery in the honeybees, may impede the survival rate of bees, and thus may further cause a subsequent reduction in the honey production and pollination rate which may ultimately cause the reduction in crop yield.
Received | January 02, 2023; Accepted | April 12, 2023; Published | May 05, 2023
*Correspondence | Sumbal Nazir, School of Zoology, Minhaj University Lahore, Pakistan; Email: [email protected]
Citation | Nazir, S., Manzoor, F., Perveen, I., Rana, A., Naureen, I., Nadeem, A.A., and Naeem, H.N., 2023. Isolation, screening and characterization of the viral pathogens from Apis mellifera colonies. Journal of Innovative Sciences, 9(1): 88-94.
DOI | https://dx.doi.org/10.17582/journal.jis/2023/9.1.88.94
Keywords | Nosemosis, Apis mellifera, Honeybee, Viral infection, RT-PCR
Copyright: 2023 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
1. Introduction
Several agricultural crops benefit from the valuable pollination services provided by the western honeybee (Apis mellifera L.). This specie of honeybee is the most common pollinator of crops in the world (Geoffery et al., 2014; Hung et al., 2018). Honeybees aid in the maintenance and sustainability of productive agriculture and non-agricultural ecosystem. Honeybees play a pivotal role in crop pollination and subsequent production of valuable crops for human consumption (Hristov et al., 2020). A global concern has been raised in the recent decades due to a drastic reduction in honeybee population (Porto et al., 2020; Van Engelsdorp and Meixner, 2010).
This specie of honeybee (A. mellifera) is the first domesticated specie which has been found to produce honey during winter seasons. This specie is widely recognised as the primary specie which can be maintained to produce honey and pollination activities by beekeepers. Human assistance has made this specie currently prevalent in every continent except antarctica (Conte and Navajas, 2008; Han et al., 2012). Seven common bee viruses include BQCV, DWV, CBPV, SBV, IAPV, ABPV, and KBV are capable of inflicting serious diseases in A. mellifera. DWV, however, was considered as one of the widely spread virus (Khalifa et al., 2021).
Fungi kingdom contains obligate intracellular parasite, termed as microsporidia. Microsporidia, on the other hand, were more recently considered as to be highly derived parasitic protists. The microsporidium Nosema apis was the first to be discovered infecting western honeybees (A. mellifera), and it has now been discovered on every continent. Nosema ceranae, a different microsporidium, was discovered naturally infecting A. mellifera colonies in Europe at the start of the twenty-first century. Its global expansion in this and other Hymenopteran hosts was subsequently established (Higes et al., 2020).
Honeybees are prone to various diseases due to the attack of different pests which may include protozoan, bacterial, and viral pathogens like varroa destructor and Nosema spp. (Tantillo et al., 2015; Lannutti et al., 2022). The interspecific transfer of honeybee pests and pathogens may further contribute to the decline in pollinator populations (Cilia et al., 2022). Bee virus outbreaks in Asian apiaries had hardly ever been documented. Current study involves the isolation, determination, and characterisation of seven honeybee viruses by using RT-PCR. This has been done to check the prevalence and spread of viruses through the apiaries in the Asian region (Sanpa and Chantawannakul, 2009; Ali et al., 2012; Forsgren et al., 2015). Keeping in view the above-mentioned facts, current study was designed to investigate the prevalence, occurrence, detection, and characterization of seven bee-viruses and the two Nosema spp. by the isolation and characterization of pathogens from honeybee (Apis mellifera) colonies and subsequent RT-PCR assay of the isolated pathogens.
2. Materials and Methods
2.1 Installation of apiaries
Apiaries were installed in bee farm far from the resident areas. They were kept under continuous observation. High level of varroa mites infection and infestation was obvious.
2.2 Honeybee samples collection
Sampling of honeybees was carried out from various colonies. Sampling was done on non-windy and sunny days. The average temperature these days was about 19 °C.
2.3 Isolation of gut from the Honeybee
After collection of samples, honeybees were taken in the dissecting tray then legs and wings removed the with the help of fine autoclaved scissors. The gut was removed gently from the abdomen by using the autoclaved forceps. Isolated gut was taken in autoclaved petridish and then stored in -40°C for the further investigation.
2.4 RNA extraction from honeybees
Trizol method (Simms et al., 1993) was used for RNA isolation and screening of pathogens from stored honeybees’ guts. Then isolated RNA was quantified on the spectrophotometer.
2.5 cDNA synthesis
cDNA synthesis was taken by making dilutions in primer’s tube. Distilled water (90µl) was added followed by labelling of primer names on each Eppendorf. This was followed by the addition of 10µl original primer solutions in each respective Eppendorf (Table 1).
Table 1: Composition of reaction mixture for cDNA synthesis and gene amplification.
|
Components |
Amount (µl) |
|
10X Reaction Buffer |
2.0 |
|
2.5 mMdNTPs |
2.0 |
|
10pmol Forward primer |
1.0 |
|
10 pmol Reverse primer |
1.0 |
|
reverse transcriptase |
2.0 |
|
RNA |
10.0 |
|
ddH2O |
2.0 |
|
Total volume |
20.0 |
Table 2: Target genes along with their forward and reverse primer sequences and base pairs.
|
Target |
Primer sequence |
Size |
References |
|
ABPV |
F – TCATACCTGCCGATCAAG |
197 |
(De Miranda,2008) |
|
R- CTGAATAATACTGTGCGTATC |
|||
|
IAPV |
F– CCATGCCTGGCGATTCAC |
203 |
(De Miranda,2008) |
|
R– CTGAATAATACTGTGCGTATC |
|||
|
KBV |
F – CCATACCTGCTGATAACC |
200 |
(De Miranda,2008) |
|
R – CTGAATAATACTGTGCGTATC |
|||
|
Nosema apis |
F – CTAGTATATTTGAATATTTGTTTACAATGG |
277 |
(De Miranda,2008) |
|
R – GCTATGATCGCTTGCC |
|||
|
BQCV |
F – AGTGGCGGAGATGTATGC |
294 |
(De Miranda,2008) |
|
R - GGAGGTGAAGTGGCTATATC |
|||
|
SBV |
F – TTGGAACTACGCATTCTCTG |
335 |
(De Miranda,2008) |
|
R – GCTCTAACCTCGCATCAAC |
|||
|
CBPV |
F – CAACCTGCCTCAACACAG |
296 |
(De Miranda,2008) |
|
R– AATCTGGCAAGGTTGACTGG |
|||
|
Nosema ceranae |
F– TATTGTAGAGAGGTGGGAGATT |
315 |
(De Miranda,2008) |
|
R – GCTATGATCGCTTGCC |
|||
|
DWV |
F– CAACTACCTGTAATGTCGTCGTGTT |
206 |
(Yang and Cox-foster, 2005) |
|
R –GACAAAATGACGAGGAGATTGTT |
2.6 Primer sequencing and amplification
Amplification of the desired pathogens were performed by using primers already available in literature (De Miranda, 2008; Yang and Coxfoster, 2005). Primer sequences on each group of genes their match and mismatch sequences or positions of their awaited amplicon sizes along with the amplification of matched positions and their subsequent sequences of eight primers has been shown in Table 2.
2.7 Thermo-cycling conditions of PCR
First regular cycling event comprised of heating for 5 minutes at 94°C. This was followed by second regular cycling event of annealing which was comprised of heating for 1 minutes at 94° at 50°C. Third step was extension which was comprised of 7 minutes at 72°C (Figure 1).
2.8 Gel electrophoresis
Gel electrophoresis was used to detect the pathogens affecting the honeybee population by using PCR products. This was followed by photographing under UV light.
3. Results and Discussion
3.1 Primer designing and detection of pathogens
RT-PCR was run by using the thermo-cycling conditions (Sigma-Aldrich). Primers were designed by following the Yang and Cox-Foster (2005) and De Miranda (2008). Primers were cost effective and had good target sites. They were designed to discriminate between the two Nosema spp. and the seven most commonly occurring viruses i.e., ABPV, DWV, BQCV, CBPV, KBV, IAPV, and SBV). The detail has been given in Table 2.
3.2 RNA extraction
Isolation of gut and abdomen samples was done from the one hundred and thirty honeybees by Trizol method (Simms et al., 1993). This was followed by extraction of thirty (30) RNAs (Figures 2, 3).
3.3 Quantification of RNA
The extracted RNAs were quantified on spectrophotometer. This was followed by the synthesis of cDNA by using the PCR. The synthesis of cDNA was done by using the polymerase chain reaction (PCR).
3.4 Gel electrophoresis
The results of PCR reaction are usually visualized (made visible) by using gel electrophoresis. Gel electrophoresis technique is used in which DNA fragments were pulled through a gel matrix by an electric current. It separates DNA fragments as per their sizes. To determine the size of fragments in the PCR samples, a standard and/or DNA ladder was added. The reaction samples were detected by agarose gel electrophoresis using PCR products. This was followed by staining with ethidium bromide. The results were shown by gel electrophoresis in the form of bands by photographing under UV light.
3.5 Pathogen extraction
The results have shown that eight samples of the PCR products were sequenced for each pair of primers. Selected RT-PCR fragments were shown and the pathogen Nosema apis (277bp size) were detected (Figure 4).
The present study showed only microsporidian fungus Nosema apis infestation, the predominant species affecting honeybee hives due to availability of hot arid climatic conditions. Other microsporidian fungus Nosema ceranae was also not detected due to the non-availability of suitable climatic conditions for their prevalence (Ansari et al., 2017; Hong et al., 2011). Honeybee viral infections of ABPV, DWV, BQCV, CBPV, KBV, IAPV, and SBV were not detected due to nonavailability of proper viral transmission routes and climatic conditions (Yanez et al., 2020). The RT-PCR technique is used in this study could become a standard method. By RT-PCR describing the screening of pathogens preparations which are used in research. RT-PCR technique is suitable, unique and sensitive. The PCR (polymerase chain reaction) following reverse transcription (RT-PCR) and has been successfully applied for the detection of Nosema species in honeybee colonies Apis mellifera. RT-PCR technique has been used by other researchers to diagnose various honeybee pathogens.
It was observed that the Nosema affected colony having sudden loss of honeybee production as well as honey production (Botias et al., 2013). It can be detected in summer when no suitable climate situation occurs for the fungus growth. However, while in temperate regions Nosema apis infections normally show high level in the spring, it reduces in the summer and then boost up again in the fall season before reducing during the early winter months (Higes et al., 2010). This fungus also effects on neural signalling process which reduced learning and memory factors of honeybees. Western honeybees (Apis mellifera) are ecologically and economically important pollinators world-wide, with pollination services contributing billions of dollars annually. In summer season, most of honeybee colonies show the infections and infestations of many pathogens which having the outcome on the whole colony. Spores may also keep carry on the combs. However, when the weather changes in autumn, the effect of spores may start an eruption of Nosema. Declining of the bee size at this stage may be very heavy. When the bees started defecating inside the hives in the winter season it can also infect the colony population of honeybees with defecation it also secretes the excreta of spores. These conditions cause the effect of declining honeybee population also in the autumn season with producing spores. Nosema infection caused sick or creeping bees outside the hive entrance, dead bees lay down on the ground and defecate (dysentery) on hive but may equally be caused by other diseases and unnatural conditions.
The signs and symptoms caused by infection Nosema apis are very easy to identify. Their symptoms are like high mortality rate within the colony and another important sign is the stains of diarrhoea at the entrances of hive and these symptoms indicating gastrointestinal disorders (Bourgeois et al., 2010; Araneda et al., 2015).
Negative effects on honeybees are done by Nosema infections and are very specific. One week old worker bees normally take food and they do not digest that food very well as well as they are not having the potential to prepare the food digesting secretions. However, at a very young age they become foragers and come out in the rearing phase of life. Up to 78%, their life spans can be decline. Within a month that young queens which ingest Nosema apis spores, it become superseded. Our results were related with Kurze et al. (2018). They determined Nosema ceranae which infects epithelial cells of the honeybee (Apis mellifera) midgut. Microsporidian fungus Nosema could be change the apoptosis and cell renewal in honeybees ‘colonies. This infection occurs in honeybees due to the ingestion of contaminated food and water spores. This infection also happened in bees during the nest cleaning activities and exchange of food. This infection may be due to sexually transmitted to a healthy queen through contact with spore-containing semen during mating (Higes et al., 2020).
Conclusions and Recommendations
It has been concluded that the honeybee colonies were badly affected due to nosemosis disease which was caused by microsporidian fungus Nosema apis. This microsporidian fungus causes dysentery in the honeybees, may impede the survival rate of bees, and thus may further cause a subsequent reduction in the honey production. Our results have shown the prevalence and characterization of microsporidian fungus Nosema apis with 277bp by using RT-PCR assay. Honeybee colonies with Nosema apis infections have shown high risk factors for honeybee population by increasing the mortality rate, declining the honeybee colonies and by negatively affecting the immune system of honeybees (Apis mellifera). Hence, it has become pertinent to find out various ways which may aid in the reduction of microsporidian growth on honeybee colonies. Moreover, the development of multiplex PCR system would play pivotal role in the simultaneous identification of multiple pathogens.
Acknowledgement
We are thankful to the Higher Education Commission for providing the funds for the completion of this research project.
Novelty Statement
This article showed about the detection of pathogens in honey bees (Apis mellifera).
Author’s Contribution
All the authors showed its contribution in research conduction and data handling of research work.
Abbreviations
PCR, polymerase chain reaction; ABPV, acute bee paralysis virus; BQCV, black queen cell virus; SBV, sacbrood virus; DWV, deformed wing virus; KBV, Kashmir bee virus; BQCV, black queen cell virus; CBV, chronic bee paralysis virus; IAPV, Israeli acute paralysis virus.
Conflict of interest
The authors have declared no conflict of interest.
References
Ali, H., Yan, X., and Han, R., 2012. Occurrence and prevalence of seven bee viruses in Apis mellifera and Apis cerana apiaries in China. Journal of Invertebrate Pathology, 109: 160–164. https://doi.org/10.1016/j.jip.2011.10.006
Ansari, M.J., Ghamdi, A.A., Abgaba, N., Khan, K.A., and Alattal, Y., 2012. Geographical distribution and molecular detection of Nosema ceranae from indigenous honey bees of Saudi Arabia. Saudi Journal of Biological Sciences, 24: 983-991. https://doi.org/10.1016/j.sjbs.2017.01.054
Araneda, X., Cumianb, M., and Moralesa, D., 2015. Distribution, epidemiological characteristics and control methods of the pathogen Nosema ceranae Fries in honey bees Apis mellifera L. (Hymenoptera, Apidae). Archiology Medicine Vetary, 47: 129–138. https://doi.org/10.4067/S0301-732X2015000200002
Botias, C., Hernandez, R.M., Barrios, L., Meana, A., and Higes, M., 2013. Nosema spp. infection and its negative effects on honey bees (Apis mellifera iberiensis) at the colony level. Veterinary Research, 44: 25. https://doi.org/10.1186/1297-9716-44-25
Bourgeois, A.L., Rinderer, T.E., Beaman, L.D., and Danka, R.G., 2010. Genetic detection and quantification of Nosema apis and Nosema ceranae in the honey bee. J. Invert. Pathol., 103: 53–58. https://doi.org/10.1016/j.jip.2009.10.009
Charbonneau, L.R., Hiller, N.K., Rogers, R.E.L., Williams, G.R., and Shutler, D., 2013. Effects of Nosema apis, N. ceranae, and coinfections on honey bee (Apis mellifera) learning and memory. Scientific Reports. 6: 22626. https://doi.org/10.1038/srep22626
Cilia, G., Flaminio, S., Zavatta, L., Ranalli, R., Quaranta, M., Bortolotti, L., and Nanetti, A., 2022. Occurrence of Honeybee (Apis mellifera L.) pathogens in wild pollinators in northern Italy. Front. Cell. Infect. Microbiol., https://doi.org/10.1098/rspb.2017.2140
Conte, Y.L., and Navajas., 2008. Climate change: Impact on honey bee populations and diseases. Rev. Sci. Tech., 27(2): 485-97, 499-51. https://doi.org/10.20506/rst.27.2.1819
De- Miranda, J., Cordoni, G., and Budge, G., 2010. The acute bee paralysis virus Kashmir bee virus Israeli acute paralysis virus complex. J. Inverte. Pathol., 103: 30–47. https://doi.org/10.1016/j.jip.2009.06.014
Forsgren, E., Wei, S., Guiling, D., Zhiguang, L., Tran, T.V., Tang, P.T., Truong, T.A., Dinh, T.Q., and Fries, I., 2015. Preliminary observations on possible pathogen spill over from Apis mellifera to Apis cerana. Apidologie. 46: 265 –275. https://doi.org/10.1007/s13592-014-0320-3
Geoffrey, R.W., Dave, S., Karen, L., Burgher-Mac, L., and Richard, E.L.R., 2014. Infra-population and community dynamics of the parasites Nosema apis and, Nosema cerana and consequences for honey bee (Apis mellifera). Plos One. 20: 90-132.
Han, F., Wallberg, A., and Websrter, M.T., 2012. From where did the Western honeybee (Apis mellifera) originate? Ecol. Evol., 2(8): 1949-1957. https://doi.org/10.1002/ece3.312
HigesGarcía-PalenciaUrbieta, A., Nanetti, A., andR.M., 2020. Nosema apis and Nosema ceranae tissue tropism in worker honey bees (Apis mellifera). Vet. Pathol., 57(1): 132-138. https://doi.org/10.1177/0300985819864302
Hong, I.P., Woo, S.O., Choi, Y.S., Han, S.M., Kim, N.S., Kim, H.K., Han, S.H., Lee, M., Lee, M.Y.B., and Yeon, K.H., 2011. Prevalence of Nosema and virus in honeybee (Apis mellifera L.) colonies on flowering Period of Acacia in Korea. Mycobiology, 39(4): 317–320. https://doi.org/10.5941/MYCO.2011.39.4.317
Hristov, P., Shumkova, R., Palova, N., and Neov, B., 2020. Factors associated with honeybee colony losses: A mini-review. Vet. Sci., 7(4): 166. https://doi.org/10.3390/vetsci7040166
Hung, K.L.J., Kingston, J.M., Albrecht, M.H., Holway, D.A., and Joshua, R.K., 2018. The worldwide importance of honeybees as pollinators in natural habitats. Proc. Biol. Sci., 10: 285. https://doi.org/10.1098/rspb.2017.2140
Khalifa, S.A.M., Elshafiey, E.H., Shetaia, A.A., El-Wahed, A.A., Algethmi, A.F., A.F.; Musharraf, S.G.; AlAjmi, M.F.; Zhao, C.; Masry, S.H.D.; Abdel-Daim, M.M.; Halabi, M.F.; Kai, G.; Al Naggar, Y.; Bishr, M.; Diab, M.A.M.; El-Seedi, H.R. 2021. Overview of bee pollination and its economic value for crop production. Insects. 12(8): 688. https://doi.org/10.3390/insects12080688
Kurze, C., Le-Conte, Y., Kryger, P., Lewkowski, O., Müller, T., and Moritz, R., 2018. Infection dynamics of Nosema ceranae in honey bee midgut and host cell apoptosis. J. Inverte. Pathol.,154: 1-4. https://doi.org/10.1016/j.jip.2018.03.008
Lannutti, L., Gonzales, F.N., Dus Santos, M.J., Florin-Christensen, M., and Schnittger, L., 2022. Molecular detection and differentiation of arthropod, fungal, protozoan, bacterial and viral pathogens of honeybees. Vet. Sci., 9: 221. https://doi.org/10.3390/vetsci9050221
Porto, R.G., de Almeida, R.F., Cruz-Neto, O., Tabarelli, M., Viana, B.F., Peres, C.A., Lopes, A.V. 2020. Pollination ecosystem services: A comprehensive review of economic values, research funding and policy actions. Food Secur., 12: 1425–1442. https://doi.org/10.1007/s12571-020-01043-w
Sanpa, S., and Chantawannakul, P., 2009. Survey of six bee viruses using RT-PCR in Northern Thailand. J. Inverte. Pathol., 100: 116–119. https://doi.org/10.1016/j.jip.2008.11.010
Simms, D., Cizdziel, P., and Chomczynski, P., 1993. TRIzol: a new reagent for optimal single- step isolation of RNA . Focus (Madison). 15: 99–102.
Tantillo, G., Bottaro, M., Pinto, A.D., Martella, V., Pinto, P.D., and Terio, V., 2015. Virus infections of honeybees Apis Mellifera. Ital. J. Food Saf., 30(4): 5364. https://doi.org/10.4081/ijfs.2015.5364
VanEngelsdorp, D., and Meixner, M.D., 2010. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Inverte. Pathol., 103: 80–95. https://doi.org/10.1016/j.jip.2009.06.011
Yanez, O., Piot, N., Dalmon, A., DeMiranda, J.R., Chatanwakannul, P., Panziera, D., Amiri, E., Smagghe, G., Schroeder, D., and Chejanovosky, N., 2020. Bee viruses: Routes of infection in Hymenoptera. Front. Microbiol., 11: https://doi.org/10.3389/fmicb.2020.00943
Yang, X., and Cox-Foster, D., 2005. Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification. Proceedings of the National Academy of Sciences of the United States of America. https://doi.org/10.1073/pnas.0501860102