Corvidae in Pakistan are Represented by Two Distinct Clades Revealed through Maternally Inherited Gene Region
Fakhra Nazir1*, Sahar Fazal1 and Fakhar-i-Abbas2
1Department of Bioinformatics and Biosciences, Capital University of Science and Technology, Islamabad, Pakistan
2Centre for Bioresource Research, Islamabad, Pakistan
ABSTRACT
Corvidae is a species rich and morphologically diverse family of the order Passeriformes (Aves), generally well identified by barcodes globally. Species identification and phylogenetic analysis through DNA barcodes using mitochondrial COI gene (cytochrome c oxidase subunit I) was aimed for samples of birds collected from different regions of Pakistan. Mitochondrial DNA was successfully extracted from keel tissue and Folmer region of COI gene comprising ~650 bps was amplified using universal primers and PCR products were confirmed by 1% agarose gel electrophoresis. Sequencing was carried out by Sanger’s method and BLAST analysis identified these samples as five species (Urocissa flavirostris, Dendrocitta vagabunda, Corvus splendens, Corvus corax and Corvus macrorhynchos) from three genera of family Corvidae. The nucleotide sequences were submitted to the Barcode of Life Data System (BOLD) and the eligible sequences were assigned the Barcode Index Numbers (BINs). The COI gene sequence data of 8 species of family Corvidae were retrieved from GenBank (NCBI) database and phylogenetic relationship was established in these 13 barcodes. K2-parameter distances were calculated on MEGA7 software with overall average distance of 0.141 calculated at 1000 bootstrap repetitions. Phylogenetic tree reconstructed by neighbour joining method discriminated all species into two distinct clades initially and then into subclades based on similarity and variations in their sequences. Species of the same genera were grouped into one clade as genus Corvus. DNA barcoding was proved to be an effective tool for species molecular identification and their phylogenetic analysis during this study which may help in identification and biogeographic studies of birds in future.
Article Information
Received 09 December 2021
Revised 15 February 2022
Accepted 08 March 2022
Available online 06 June 2022
(early access)
Published 24 May 2023
Authors’ Contribution
SF and FN conceived and designed the study; FN executed the experiment, analyzed the tissue samples, analyzed and interpreted the data. SF and FA critically reviewed and FN revised the manuscript for important intellectual contents and approved the final version.
Key words
DNA barcoding, COI gene, Phylogenetic analysis, Corvidae, mitochondrial DNA
DOI: https://dx.doi.org/10.17582/journal.pjz/20211209111259
* Corresponding author: [email protected]
0030-9923/2023/0004-1509 $ 9.00/0
Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
The family Corvidae (crows and jays) is an important family of bird order Passeriformes with a worldwide distribution (Goodwin, 1976), comprising 21 genera and 131 species (Miller, 2017). The family is represented by 7 genera and 19 species in the fauna of Pakistan (Gill and Donsker, 2019).
Morphological characteristics provided the basis of taxonomy and phylogeny of species for a long time (Gibbs et al., 2001) but now genetic identification is considered as more reliable in species identification. Concept of DNA barcoding (Hebert et al., 2003a) has now been transformed into establishment of a public reference library for reliable species identification (Coissac, 2016). A 648 base pairs (bp) COI gene fragment (cytochrome c oxidase 1) from mitochondrial genome (mtDNA) a standard barcode (Hebert et al., 2003b; Cai et al., 2010; Breman et al., 2013) has been used for animal species identification, including birds (Hebert et al., 2004b; Kerr et al., 2007, 2009; Johnsen et al., 2010; Yang and Rannala, 2014). Recent mtDNA sequence based studies on phylogeny of Corvidae have changed the traditional relationships among its members (Ericson et al., 2005; Bonaccorso and Peterson, 2007).
Five species of family Corvidae were randomly collected from different regions of Pakistan based on their availability during the study period. Nucleotide sequences of other species of this family reported from Pakistan were retrieved from GenBank. The purpose of study was to identify samples genetically, find genetic distance among them and infer their phylogenetic relationship by reconstructing phylogenetic tree. The current research work on phylogenetic relationship among species of family Corvidae will help contribute in the construction of reference library of DNA barcodes of birds from different geographical areas of the world.
MATERIALS AND METHODS
Taxon sampling
Specimens of freshly killed birds, belonging to 5 species of family Corvidae; Urocissa flavirostris (yellow-billed blue-magpie), Dendrocitta vagabunda (Rufous treepie), Corvus splendens (house crow), Corvus corax (common raven), and Corvus macrorhynchos (large-billed crow), were provided by hunters. Samples were identified using morphological keys (Ali and Ripley, 1983; Roberts, 1991; Grzimek’s Encycloclpaedia, 2002). Keel muscle tissues were taken and preserved separately in 70 % alcohol in plastic bottles (Kress and Erickson, 2012) and stored at room temperature at Centre for Bioresource Research (CBR) for molecular analysis. Voucher specimens were deposited at Museum of CBR.
PCR amplification of mitochondrial COI gene
Genomic DNA from each tissue sample was extracted using phenol-chloroform extraction protocol with some modifications (Sambrook et al., 1989; Zou et al., 2005). Folmer region of CO1 gene (~650 bp) of mtDNA was amplified (Folmer et al., 1994; Hebert et al., 2004; Dawnay et al., 2007) by PCR sprint thermo cycler (Thermoelectron Corporation, USA) using universal primers (Ivanova et al., 2006) supplied by Oligo, MACRO GEN (Seoul, Republic of Korea) (Table I).
PCR reaction was carried out by denaturation of DNA for 5 minutes at 94 ℃; followed by 35 cycles for 1 min at 94 ℃, primers annealing for 1 min at 48 ℃ and the process of elongation for 2 min at 72 ℃, and the extension of the target region for 5 min at 72 ℃. Amplified PCR product confirmed using 1 % agarose gel by gel electrophoresis.
Nucleotide sequencing of mitochondrial COI PCR product
Sequencing was carried out by Sanger’s method (Sanger et al., 1977), edited using Bio Edit software Version 7.0.2 (https://bioedit.software.informer.com/7.0/), converted into FASTA format and after proof reading, BLAST (Basic Local Alignment Search Tool) was applied at NCBI (National Centre for Biotechnology Information) GenBank portal (http://blast.ncbi.nlm.nih.gov/Blast.cgi) for species genetic identification (Table II). Nucleotide sequences were then submitted to BOLD
Table I. Primers and amplicon size (bp) used for amplification of COI gene.
|
Primer |
Sequence (5` to 3`) |
Target gene |
Amplicon size (bp) |
Reference |
|
Bird F1 |
TTCTCCAACCACAAAGACATTGGCAC |
CO1 |
˜650 |
Ivanova et al., 2006 |
|
R1 |
ACGTGGGAGATAATTCCAAATCCTG |
|||
|
Falco F |
ATCAACAAACCACAAAGACATCGGCAC |
|||
|
Bird R2 |
ACTACATGTGAGATGATTCCGAATCCAG |
(www.boldsystem.org) database and Barcode Index Numbers (BINs) System assigned BINs to them (Ratnasingham and Hebert, 2013) and confirmed their molecular classification by comparing with current zoological nomenclature (Birky Jr, 2013; Fujisawa and Barraclough, 2013; Edwards et al., 2016).
Out of 19 species of family Corvidae reported from Pakistan (https://avibase.bsc-eoc.org), COI gene sequence data of 14 species was searched from GenBank at NCBI database; sequences of only 8 species were available and retrieved (Table III). COI gene region sequences data of six species of family Corvidae (Garrulus lanceolatus, Dendrocitta formosae, Nucifraga multipunctata, Corvus corone, Corvus cornix, Corvus ruficollis) was not available on NCBI database during study time therefore, was not included in this phylogenetic analysis of family Corvidae.
Table II. Accession numbers of COI gene sequences of species of family Corvidae with similarity percentage after BLAST analysis of five samples with data available at NCBI.
|
Species |
Similarity % |
Accession number |
|
Urocissa flavirostris |
96% |
JQ176603.1 |
|
Dendrocitta vagabunda |
99% |
KT240059.1 |
|
Corvus macrorhynchos |
97.98% |
AB842677.1 |
|
Corvus splendens |
99.56% |
GU326327.1 |
|
Corvus corax |
100% |
GQ481624.1 |
Table III. Name of species of family Corvidae with accession numbers retrieved from NCBI database used for phylogenetic analysis.
|
Common name |
Species |
Accession number |
|
Eurasian Jay |
Garrulus glandarius |
GQ481963 |
|
Red-billed Blue-Magpie |
Urocissa erythroryncha |
JQ176603 |
|
Eurasian Magpie |
Pica pica |
GQ482478 |
|
Eurasian Nutcracker |
Nucifraga caryocatactes |
GU571501 |
|
Red-billed Chough |
Pyrrhocorax pyrrhocorax |
GQ482576 |
|
Yellow-billed Chough |
Pyrrhocorax graculus |
GQ482571 |
|
Eurasian Jackdaw |
Corvus monedula |
GQ481647 |
|
Rook |
Corvus frugilegus |
GQ481640 |
Phylogenetic analysis
Multiple sequence alignment of nucleotide sequences of 13 species, reported from Pakistan, was performed by ClustalW software (Thompson et al., 2003). Pair wise distance of evolutionary divergence was calculated by K2 parameter method (Kimura, 1980), and 1000 bootstrap (Felsenstein, 1985) repetitions were used to find the variance in genetic distances between taxon pairs. Phylogenetic tree by the Neighbor-Joining method (Saitou and Nei, 1987) was reconstructed for final dataset of total 563 positions, including some positions (1st, 2nd, 3rd and noncoding codon) while excluding other positions (with gaps and missing data) in this analysis (Wei et al., 2014) by MEGA7 (Kumar et al., 2016).
RESULTS
MtDNA was successfully extracted from keel muscle tissues of 5 samples and COI gene amplified and nucleotide sequenced. BLAST analysis of nucleotide sequences confirmed the taxonomically determined species status of these specimen showing high similarity percentages with the respective sequences retrieved from NCBI database (Table II). The Accession numbers of 8 other species, retrieved from NCBI appear in Table III.
Multiple sequence alignment (MSA) of nucleotide sequences of 13 species of the family Corvidae, followed by estimates on evolutionary divergence, suggested overall average distance 0.141 at 1000 bootstrap repetitions, as calculated by K2 parameter method (Kimura, 1980) on MEGA7 (Kumar et al., 2016) for 563 positions in the final dataset. The distances between different species ranged between 0.195±0.026 (SE) between D. vagabunda and P. pyrrhocorax and 0.044±0.009 (SE) between C. splendens and C. macrorhynchos (Table IV). The values of genetic distances between different species were supported by phylogenetic tree also.
A bootstrap consensus tree of 13 nucleotide sequences of taxa of family Corvidae reported from Pakistan was inferred by the Neighbor Joining method using 1000 replicates to show their evolutionary relationships with final dataset of total 563 positions by MEGA7. This tree showed a very clear and close relationship among different species of same genus and distinct relationship among species of the different genera of family Corvidae as indicated in Figure 2.
COI gene region sequences of 13 species of family Corvidae were distinctly divided into two main clades. One was comprised of Pyrrhocorax genus with two species P. pyrrhocorax, P. graculus and other Nucifraga genus with one species N. caryocatactes while the rest of ten species were falling under the second main clade. This second main clade was further divided into two subclades one consisting of Corvus genus with all five available species C. monedula, C. splendens, C. frugilegus, C. macrorhynchos, and C. corax while, Garrulus genus with one species G. glandarius. The second subclade was comprised of three
Table IV. Estimates of evolutionary divergence between sequences of family Corvidae.
|
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
|
|
Dendrocitta vagabunda |
0.025 |
0.024 |
0.024 |
0.020 |
0.024 |
0.019 |
0.022 |
0.023 |
0.025 |
0.022 |
0.021 |
0.022 |
|
|
Corvus splendens |
0.188 |
0.014 |
0.009 |
0.022 |
0.020 |
0.021 |
0.020 |
0.021 |
0.021 |
0.019 |
0.016 |
0.014 |
|
|
Corvus corax |
0.174 |
0.086 |
0.013 |
0.017 |
0.019 |
0.016 |
0.019 |
0.017 |
0.021 |
0.018 |
0.014 |
0.013 |
|
|
Corvus macrorhynchos |
0.182 |
0.044 |
0.079 |
0.019 |
0.019 |
0.018 |
0.018 |
0.017 |
0.020 |
0.019 |
0.014 |
0.014 |
|
|
Urocissa flavirostris |
0.146 |
0.162 |
0.134 |
0.132 |
0.021 |
0.009 |
0.018 |
0.021 |
0.023 |
0.022 |
0.018 |
0.019 |
|
|
Garrulus glandarius |
0.188 |
0.151 |
0.135 |
0.132 |
0.151 |
0.020 |
0.020 |
0.021 |
0.021 |
0.018 |
0.018 |
0.019 |
|
|
Urocissa erythrorhyncha |
0.143 |
0.157 |
0.122 |
0.127 |
0.046 |
0.142 |
0.018 |
0.020 |
0.022 |
0.021 |
0.018 |
0.018 |
|
|
Pica pica |
0.173 |
0.155 |
0.139 |
0.128 |
0.132 |
0.145 |
0.140 |
0.019 |
0.021 |
0.020 |
0.019 |
0.021 |
|
|
Nucifraga aryocatact |
0.180 |
0.157 |
0.127 |
0.124 |
0.154 |
0.145 |
0.138 |
0.133 |
0.021 |
0.019 |
0.018 |
0.019 |
|
|
Pyrrhocorax pyrrhocorax |
0.195 |
0.171 |
0.178 |
0.163 |
0.193 |
0.172 |
0.183 |
0.173 |
0.156 |
0.016 |
0.020 |
0.023 |
|
|
Pyrrhocorax graculus |
0.172 |
0.141 |
0.133 |
0.138 |
0.168 |
0.143 |
0.159 |
0.156 |
0.139 |
0.107 |
0.019 |
0.018 |
|
|
Corvus monedula |
0.161 |
0.108 |
0.089 |
0.094 |
0.131 |
0.122 |
0.124 |
0.139 |
0.131 |
0.174 |
0.153 |
0.016 |
|
|
Corvus frugilegus |
0.165 |
0.084 |
0.071 |
0.092 |
0.135 |
0.135 |
0.124 |
0.162 |
0.138 |
0.189 |
0.136 |
0.099 |
genera Pica with one species P. pica, Urocissa genus, having U. erythroryncha and U. flavirostris two species and genus Dendrocitta having one species D. vagabunda (Fig. 2).
DISCUSSION
According to avibase database retrieved (2019) (https://avibase.bsc-eoc.org), 770 species of birds are reported from Pakistan out of which 45 are globally threatened species. The family Corvidae (crows and jays) belongs to order Passeriformes and suborder Passeri. This family of birds is comprised of 21 genera, with 131 species globally (Miller, 2017), and locally 7 genera with 19 species reported from Pakistan retrieved (2019) from (https://avibase.bsc-eoc.org). Out of these 131 species of Corvidae family, 14 species are near threatened (NT), 8 are vulnerable (VU), 3 are critical (CR), 4 are endangered (EN) and 1 is (EW) globally (Del Hoyo and Collar, 2016). Therefore, it is the need of time to study the geographical status of these species of family Corvidae to help take measure to conserve them.
These 13 species fall in least concern (LC) in the red list category of IUCN (2018). The justification for this is the reason that they show attributes which fall in the criteria of range size (the extent of occurrence is <20,000 km2), Population trends (>30 % decline over ten years or three generations) and population size (<10,000 mature individuals with a continuing decline estimated to be >10 % in ten years or three generations. All these qualities of the species under study help avoid approaching the thresholds for Vulnerability according to Bird Life International (2021), http://www.birdlife.org).
The morphological characteristics of an organism help in determining the taxonomy and phylogeny of a particular species (Gibbs and Matzkin, 2001). Collected samples were successfully identified on the bases of their morphological features and identified as species of family Corvidae, order Passeriformes (Manegold, 2008). In this study the COI region of mitochondrial genome was proved as rapid and accurate genetic marker capable of identifying unknown sample of birds to species level (Herbert et al., 2004) and same was proficient in reconstructing the phylogenetic relationship among bird species (Hebert et al., 2004; Hajibabaei et al., 2007; Kerr et al., 2007, 2009; Borisenko et al., 2008; Johnsen et al., 2010; Yang and Rannala, 2014).
MEGA7 software successfully determined the evolutionary history and reconstructed phylogenetic tree (Kumar et al., 2016) of 13 nucleotide sequences of species of family Corvidae reported from Pakistan. Genetic distances were compared between pairs of species resulted as follows: the pairwise distance between P. pyrrhocorax and D. vagabunda was observed 0.195 the highest and second highest was 0.193 again between P. pyrrhocorax and U. flavirostris. On the other hand, the species of genus Corvus showed least sequence divergence as highlighted in Table IV, and all five species of this genus showed least pairwise distances. For example, C. splendens shows 0.044 pairwise distance with C. macrorhynchos and C. corax has 0.079 pairwise distances from C. macrorhynchos. In the same way C. monedula and C. frugilegus also showed less pairwise distances in comparison with species of other genera (Ericson, 2005).
It was expected that the MEGA should keep all species of family Corvidae in the corresponding taxonomic clusters if the genetic alignments and the taxonomy were concordant. In this study most species were discriminated into their respective distinct clusters and all species of one genus were clustered together in one specific clade or sub clade (Fig. 2). Phylogenetic tree is an efficient representation of the genetic distance between different individuals under study. Phylogeny was constructed at 1000 bootstrap replications and p distance was found. The nearest-neighbour distance is the smallest distance to another species within a defined group (Kerr et al., 2007). A tree was reconstructed for 13 nucleotide sequences of family Corvidae. According to the phylogenetic analysis of mitochondrial COI gene by neibour joining method all species under study were segregated into two main clades. One main clade was comprised of genus Corvus whose all five species were closely related and clustered in one large sub clade (Huang et al., 2016) along with Garrulus genus with one species G. glandarius which is treated as conspecific with G. bispecularis and G. leucotis (http://www.birdlife.org).
The species of genus Dendrocitta, Urocissa and Pica were part of one main clade but were distinctly related to Corvus genus therefore were latter split into another subclade due to large clade distance. These three species belong to different genera but have more association with each other as compared to genus Corvus (Ericson et al., 2005; Ekman and Ericson, 2006). The U. flavirostris belongs to race cucullata which intergrades with nominate in Central Nepal (Madge and Burn, 1994; http://www.birdlife.org). The D. vagabunda species also occur in Indomalayan, Palearctic Realms with population decreasing slowly due to habitat loss and hunting (Tracewski et al., 2016; http://www.birdlife.org). Pica pica Eurasian Magpie species relationships are confused, differ widely or sometimes contradictory to limit species and subspecies concluded by phylogenetic analyses in various studies and advocate numerous splits, while others suggested to treat all taxa in this genus into single species; therefore, further research needed in this regard.
Members of genus Corvus were closely related to each other as considered genetically associated and were further segregated into smaller clades based on the similarity in their sequences C. macrorhynchos was separated as individual clade and C. splendens and C. corax were further grouped together as a clade on the basis of similarity in their sequences (Cibois and Pasquet, 1999). The C. splendens is suggested based on head and bill shape as an early offshoot and close to the “C. macrorhynchos complex”, and overlaps with the members of this group, but somewhat separated ecologically (http://www.birdlife.org). This analysis shows that C. splendens and C. corax have more association as compared to C. macrorhynchos irrespective of the fact that all belong to the same genus (Li et al., 2016; Huang et al., 2016; Johnsen, 2017; Iqbal et al., 2020).
The C. macrorhynchos in older literature was included in C. coronoides, and listed as C. levaillantii. Variations in vocal and morphometric characters have elevated many taxa to species level recently and there is a strong need for some integrative comprehensive review to fully establish an evidence-based species limits (http://www.birdlife.org). Recent genetic investigations on common raven C. corax (Haring et al., 2012) suggested three evolutionary paths occupied by this species therefore, any little genetic exchange between new world and old world populations, will allow these two groups to maintain slight, but distinct genetic signatures. A variety of morphological forms may have been especially distinct in old world, 1 million years ago, but today they do not show unique mitochrondrial signatures as intergrade extensively. Genetic diversity is reducing in the New World through similar process, in which mtDNA samples were used to recognize two clades currently (http://www.birdlife.org). Increasing populations of this species led to targeted killing campaigns to benefit crops in western U.S.A. (Marzluff et al., 2010) and currently, the human disturbance, removal of woodlands, and intensive farming, may affect the species (Hagemeijer and Blair, 1997). Molecular study on C. frugilegus Rook, has indicated that its subspecies form a clade with C. hawaiiensis; (Jonsson et al., 2012) but further investigation is required (http://www.birdlife.org). C. monedula Eurasian Jackdaw showed geographical variation complex, with clinal and individual variations. C. dauuricus along with C. monedula sometimes separated in Coloeus, but recent studies (Haring et al., 2012; Jonsson et al., 2012) found them to form a basal clade within present genus. The two species geographically replace each other in L Baikal and N Mongolia but sometimes considered conspecific, with few reports of mixed pairings.
In this study the species C. macrorhynchos and C. splendens had shown close relationship with each other therefore were grouped in one subclade while C. frugilegus, and C. corax were grouped in second subclade showing close relationship while C. monedula was separately assigned to third subclade indicating distinct relationship with other species of genus Corvus (Haring et al., 2012; Li et al., 2016).
Second main clade was comprised of Nucifraga and Pyrrhocorax genera in this phylogenetic analysis. The species of Pyrrhocorax genus (P. graculus, P. pyrrhocorax) were grouped in one clade showing close association among them than Nucifraga which was further split into another branch showing distinct relationship with them (Haring et al., 2012; Huang et al., 2016; Johnsen et al., 2017; Iqbal et al., 2020). N. caryocatactes (Northern nutcracker) is treated as conspecific with N. hemispila, and N. multipunctata and in Urals, its subspecies intergrades with C. macrorhynchos. On the basis of some minor differences its several populations have been separated racially and are best treated as synonyms (http://www.birdlife.org). P. pyrrhocorax (red-billed Chough) hybridizes with P. graculus (yellow-billed chough) but very rarely reported showing slight geographical variation.
Relationship between different species of family Corvidae resulted in our study were supported by the work of other researchers as citied above but the genetic markers and genetic distance estimation methods were varying some time.
In conclusion, DNA barcoding has been proved an effective tool for identification and inference of evolutionary relationship among species of family Corvidae. MEGA software was equally proved good to confirm the evolutionary relationship among different species. However, multiple genetic markers or whole genome sequences should be used in future studies to effectively infer the phylogenetic relationships among different species of Corvidae.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Ali, S., and Ripley, S.D., 1983. Handbook of the birds of India and Pakistan. Compact edition. Oxford University Press and BNHS, Mumbai.
Avibase, 2019. The world bird database, available at https://avibase.bsc-eoc.org. (Accessed in 2019).
Bird Life International, 2021. IUCN Red List for birds. (Downloaded from http://www.birdlife.org on 11/09/2021.
Birky, Jr, C.W., 2013. Species detection and identification in sexual organisms using population genetic theory and DNA sequences. PLoS One, 8: e52544. https://doi.org/10.1371/journal.pone.0052544
Bonaccorso, E., and Peterson, A.T., 2007. A multilocus phylogeny of new world jay genera. Mol. Phylogenet. Evol., 42: 467-476. https://doi.org/10.1016/j.ympev.2006.06.025
Borisenko, A.V., Lim, B.K., Ivanova, N.V., Hanner, R.H., and Hebert, P.D., 2008. DNA barcoding in surveys of small mammal communities: A field study in Suriname. Mol. Ecol. Resour., 8: 471-479. https://doi.org/10.1111/j.1471-8286.2007.01998.x
Breman, F.C., Jordaens, K., Sonet, G., Nagy, Z.T., Van Houdt, J., and Louette, M., 2013. DNA barcoding and evolutionary relationships in Accipiter Brisson, 1760 (Aves, Falconiformes: Accipitridae) with a focus on African and Eurasian representatives. J. Ornithol., 154: 265-287. https://doi.org/10.1007/s10336-012-0892-5
Cai, Y., Yue, B., Jiang, W., Xie, S., Li, J., and Zhou, M., 2010. DNA barcoding on subsets of three families in Aves. Mitochond. DNA Resour., 21: 132-137. https://doi.org/10.3109/19401736.2010.494726
Cibois, A., and Pasquet, E., 1999. Molecular analysis off the phylogeny off 11 genera off the Corvidae. IBIS, 141: 297-306. https://doi.org/10.1111/j.1474-919X.1999.tb07552.x
Coissac, E., Hollingsworth, P.M., Lavergne, S., and Taberlet, P., 2016. From barcodes to genomes: Extending the concept of DNA barcoding. pp. 1423-1428. https://doi.org/10.1111/mec.13549
Dawnay, N., Ogden, R., McEwing, R., Carvalho, G.R., and Thorpe, R.S., 2007. Validation of the barcoding gene COI for use in forensic genetic species identification. Forensic Sci. Int., 173: 1-6. https://doi.org/10.1016/j.forsciint.2006.09.013
Del Hoyo, J., and Collar, N.J., 2016. HBW, and birdlife international illustrated checklist of the birds of the world. Volume 2: Passerines. Lynx Editions, Barcelona.
Edwards, S.V., Xi, Z., Janke, A., Faircloth, B.C., McCormack, J.E., Glenn, T.C., and Davis, C.C., 2016. Implementing and testing the multispecies coalescent model: A valuable paradigm for phylogenomics. Mol. phylogenet. Evol., 94: 447-462. https://doi.org/10.1016/j.ympev.2015.10.027
Ekman, J. and Ericson, P.G., 2006. Out of Gondwanaland; the evolutionary history of cooperative breeding and social behaviour among crows, magpies, jays and allies. Proc. R. Soc. Lon. Ser. B. Biol. Sci., 273: 1117-1125. https://doi.org/10.1098/rspb.2005.3431
Ericson, P.G., Jansén, A.L., Johansson, U.S. and Ekman, J., 2005. Inter-generic relationships of the crows, jays, magpies and allied groups (Aves: Corvidae) based on nucleotide sequence data. J. Avian Biol., 36: 222-234. https://doi.org/10.1111/j.0908-8857.2001.03409.x
Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39: 783-791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x
Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates Mol. Mar. Biol. Biotechnol., 3: 294–299.
Fujisawa, T. and Barraclough, T.G., 2013. Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: A revised method and evaluation on simulated data sets. Syst. Biol., 62: 707-724. https://doi.org/10.1093/sysbio/syt033
Gibbs, A.G. and Matzkin, L.M., 2001. Evolution of water balance in the genus Drosophila. J. exp. Biol., 204: 2331-2338. https://doi.org/10.1242/jeb.204.13.2331
Gill, F. and Donsker, D., 2019. IOC world bird list (v9.1). 2019. Avaialble online at https://www. worldbirdnames.org/ioc-lists.
Goodwin, D., 1976. Crows of the world. British Museum (National History), London.
Grzimek’s, B., 2002. Animal life encyclopedia, 2nd edn. Vol 8, Birds. Gale Group, United Estates.
Hagemeijer, W.J. and Blair, M.J., 1997. The EBCC atlas of European breeding birds. Poyser, London, pp. 479.
Hajibabaei, M., Singer, G.A., Hebert, P.D. and Hickey, D.A., 2007. DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends Genet., 23: 167-172. https://doi.org/10.1016/j.tig.2007.02.001
Handbook of the Birds of the World and BirdLife International digital checklist of the birds of the world, 2020. Version 5. Available at: http://datazone.birdlife.org
Haring, E., Däubl, B., Pinsker, W., Kryukov, A. and Gamauf, A., 2012. Genetic divergences and intraspecific variation in corvids of the genus Corvus (Aves: Passeriformes: Corvidae)–a first survey based on museum specimens. J. Zool. Syst. Evol., 50: 230-246. https://doi.org/10.1111/j.1439-0469.2012.00664.x
Hebert, P.D., Cywinska, A., Ball, S.L. and DeWaard, J.R., 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Biol. Sci., 270: 313-321. https://doi.org/10.1098/rspb.2002.2218
Hebert, P.D., Ratnasingham, S. and De Waard, J.R., 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. B. Biol. Sci., 270(suppl_1): S96-S99. https://doi.org/10.1098/rsbl.2003.0025
Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., Francis, C.M. and Godfray, C., 2004. Identification of birds through DNA barcodes. PLoS. Biol., 2: e312. https://doi.org/10.1371/journal.pbio.0020312
Huang, Z., Yang, C. and Ke, D., 2016. DNA barcoding and phylogenetic relationships in Anatidae. Mitochond. DNA Part A, 27: 1042-1044. https://doi.org/10.3109/19401736.2014.926545
Iqbal, F., Ayub, Q., Song, B.K., Wilson, R., Fahim, M. and Rahman, S., 2020. Sequence and phylogeny of the complete mitochondrial genome of the Himalayan jungle crow (Corvidae: Corvus macrorhynchos intermedius) from Pakistan. Mitochond. DNA, Part B., 5: 348-350. https://doi.org/10.1080/23802359.2019.1704637
Ivanova, S., Pitchon, V., Petit, C., Herschbach, H., Van Dorsselaer, A. and Leize, E., 2006. Preparation of alumina supported gold catalysts: Gold complexes genesis, identification and speciation by mass spectrometry. Appl. Cat. A Gen., 298: 203-210. https://doi.org/10.1016/j.apcata.2005.10.018
Johnsen, A., Rindal, E., Ericson, P.G., Zuccon, D., Kerr, K.C., Stoeckle, M.Y. and Lifjeld, J.T., 2010. DNA barcoding of Scandinavian birds reveals divergent lineages in trans-Atlantic species. J. Ornithol., 151: 565-578. https://doi.org/10.1007/s10336-009-0490-3
Johnsen, A., Kearns, A.M., Omland, K.E. and Anmarkrud, J.A., 2017. Sequencing of the complete mitochondrial genome of the common raven Corvus corax (Aves: Corvidae) confirms mitogenome-wide deep lineages and a paraphyletic relationship with the Chihuahuan raven C. cryptoleucus. PLoS One, 12: e0187316. https://doi.org/10.1371/journal.pone.0187316
Jonsson, K.A., Fabre, P.H. and Irestedt, M., 2012. Brains, tools, innovation and biogeography in crows and ravens. BMC Evol. Biol., 12: 1-12. https://doi.org/10.1186/1471-2148-12-72
Kerr, K.C., Stoeckle, M.Y., Dove, C.J., Weigt, L.A., Francis, C.M. and Hebert, P.D., 2007. Comprehensive DNA barcode coverage of North American birds. Mol. Ecol. Notes, 7: 535-543. https://doi.org/10.1111/j.1471-8286.2007.01670.x
Kerr, K.C., Lijtmaer, D.A., Barreira, A.S., Hebert, P.D. and Tubaro, P.L., 2009. Probing evolutionary patterns in Neotropical birds through DNA barcodes. PLoS One, 4: e4379. https://doi.org/10.1371/journal.pone.0004379
Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16: 111-120. https://doi.org/10.1007/BF01731581
Kress, W.J. and Erickson, D.L., 2012. DNA barcodes: Methods and protocols. DNA Barcodes Humana Press, Totowa, NJ. pp. 3-8. https://doi.org/10.1007/978-1-61779-591-6_1
Kumar, S., Stecher, G. and Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33: 1870-1874. https://doi.org/10.1093/molbev/msw054
Li, X., Lu, J., Lu, J., Hu, X. and Huang, Z., 2016. The complete mitochondrial genome of the American crow, Corvus brachyrhynchos (Passeriformes, Corvidae). Mitochond. DNA A, 27: 4213-4214. https://doi.org/10.3109/19401736.2015.1022745
Madge, S. and Burn, H., 1994. Crows and jays: A guide to the crows, jays and magpies of the world. A and C Black.
Manegold, A., 2008. Morphological characters of the tongue skeleton reveal phylogenetic relationships within the Corvidae (Oscines, Passeriformes). EMU-Aust. Ornithol., 108: 321-330. https://doi.org/10.1071/MU08022
Marzluff, J.M., Walls, J., Cornell, H.N., Withey, J.C. and Craig, D.P., 2010. Lasting recognition of threatening people by wild American crows. Anim. Behav., 79: 699-707. https://doi.org/10.1016/j.anbehav.2009.12.022
Miller, M.J., 2017. HBW and birdlife international illustrated checklist of the birds of the world. Passerines, 2: 421-424. https://doi.org/10.1111/jofo.12232
Ratnasingham, S. and Hebert, P.D., 2013. A DNA-based registry for all animal species: The barcode index number (BIN) system. PLoS One, 8: e66213. https://doi.org/10.1371/journal.pone.0066213
Roberts, T.J., 1991. The birds of Pakistan. Passeriformes: Pittas to Buntings (Vol. 2). Oxford University Press.
Saitou, N. and Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.
Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. Molecular cloning: A laboratory manual (No. Ed. 2). Cold spring harbor laboratory press.
Sanger, F., Nicklen, S. and Coulson, A.R., 1977. DNA sequencing with chain-terminating inhibitors. Proc. natl. Acad. Sci., 74: 5463-5467. https://doi.org/10.1073/pnas.74.12.5463
Thompson, J.D., Gibson, T.J. and Higgins, D.G., 2003. Multiple sequence alignment using Clustal W and Clustal X. Curr. Prot. Bioinf., 1: 2-3.
Tracewski, Ł., Butchart, S.H., Di Marco, M., Ficetola, G.F., Rondinini, C., Symes, A., Wheatley, H., Beresford, A.E. and Buchanan, G.M., 2016. Toward quantification of the impact of 21st century deforestation on the extinction risk of terrestrial vertebrates. Conserv. Biol., 30: 1070-1079. https://doi.org/10.1111/cobi.12715
Wei, L., He, J., Jia, X., Qi, Q., Liang, Z., Zheng, H., and Sun, J., 2014. Analysis of codon usage bias of mitochondrial genome in Bombyx mori and its relation to evolution. BMC. Evol. Biol., 14: 1-12. https://doi.org/10.1186/s12862-014-0262-4
Yang, Z. and Rannala, B., 2014. Unguided species delimitation using DNA sequence data from multiple loci. Mol. Biol. Evol., 31: 3125-3135. https://doi.org/10.1093/molbev/msu279
Zou, Y., Lu, Y. and Wei, D., 2005. Hypocholesterolemic effects of a flavonoid-rich extract of Hypericum perforatum L. in rats fed a cholesterol-rich diet. J. Agric. Fd. Chem., 53: 2462-2466. https://doi.org/10.1021/jf048469r