Genetic Diversity Evaluation of Two Loach Fishes and their Artificial Hybrid Population Based on 19 Polymorphic Microsatellite Loci
Yanping Li, Fei Xu, Yongming Wang*, Yunyun Lv, Jinrong Shi, Biwen Xie, Wenyao Cai and Dian Liu
Key Laboratory of Sichuan Province for Fishes Conservation and Utilization in the Upper Reaches of the Yangtze River, College of Life Sciences, Neijiang Normal University, Neijiang 641100, China.
ABSTRACT
Sinibotia superciliaris and S. reevesae are two economically important loaches in the middle and upper reaches of Yangtze River. Recently, wild populations of them have dropped sharply due to anthropogenic and environmental threats. There is an increasing need to implement captive propagation programs to protect their populations. Here, we firstly carried out artificial breeding of S. superciliaris and S. reevesae, and hybrid combinations were designed as S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀. Secondly, 19 microsatellite loci were used to evaluate genetic diversity between hybrid offspring and their parents. The mean polymorphic information content (PIC) among groups ranged from 0.685 to 0.818, implying high polymorphism in all of the four groups (PIC > 0.5). The mean observed heterozygosity ranged from 0.779 to 0.887, and the hybrid combination of S. superciliaris ♀ × S. reevesae ♂ obtained the highest observed heterozygosity, while S. reevesae had the lowest. The high heterozygosity was helpful for protecting the genetic resources and preventing the genetic decline, which could reduce the risk of inbreeding due to loss of heterozygosity. Thus, we recommend the hybrid strategy of S. superciliaris ♀ × S. reevesae ♂ as the potential germplasm resources for further artificial reproduction. Population structure analysis and UPGMA tree indicated S. superciliaris and S. superciliaris ♀ × S. reevesae ♂ were clustered together that comprised of clade I, and S. reevesae and S. superciliaris ♂ × S. reevesae ♀ were clustered together that comprised of clade II, suggesting the close genetic relationship between the offspring and their female parents. This study provides reasonable comparison of genetic diversity and potential application of hybrid strategy of S. superciliaris and S. reevesae, and the population genetic information supplied here will provide valuable resources for breeding, germplasm resources preservation and conservation genetics of these two loaches.
Article Information
Received 15 September 2021
Revised 15 October 2021
Accepted 06 November 2021
Available online 10 June 2022
(early access)
Published 12 June 2023
Authors’ Contribution
YW and BX conceived and designed the experiments. JS, DL, and WC performed the experiments. Y Li, FX, and Y Lv analyzed the data. Y Li wrote the original draft. Y Lv and YW reviewed and revised the manuscript.
Key words
Microsatellite, Sinibotia superciliaris, Sinibotia reevesae, Hybrid, Genetic diversity, Heterozygosity
DOI: https://dx.doi.org/10.17582/journal.pjz/20210915100940
* Corresponding author: [email protected]
0030-9923/2023/0004-1665 $ 9.00/0
Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
The Sinibotia superciliaris and S. reevesae are two loaches endemic to China, which are belong to the family Botiidae (Teleostei: Cypriniformes). S. superciliaris is primarily distributed in the main river and tributaries of the upper and middle Yangtze River. Differently, S. reevesae is exclusively distributed in the main streams and tributaries along the upper reaches of the Yangtze River, especially in the Tuojiang River (Yang, 1992). These two loaches usually inhabit in rocky, sandy and intermediate substrates with clear water and slow to moderate currents (Yang, 1992), and have high economic and academic values due to their tender meat, delicious taste, and rich body surface mucus. Recently, their wild populations have declined sharply due to overfishing, water pollution, soil erosion, and loss of original spawning grounds and foraging grounds following completion of the Three Gorges Dam and several other dams along the upper Yangtze River. As a result, S. reevesae has been classified as vulnerable (VU) in the Red List by the Endangered Species Scientific Commission of China (Jiang et al., 2016). There is increasing need to develop captive propagation to conserve genetic diversity, and to recover the wild populations of the two loaches.
However, studies on these two species are limited and most studies have been restricted to common biology (Li et al., 2011; Pu et al., 2013; Yang and Ding, 2010), and karyotype analysis (Yue et al., 2013). Regarding genetic studies, a previous research related to molecular phylogeny revealed that Botiidae was divided into two monophyletic subfamilies of Leptobotiinae and the Botiinae (Šlechtová et al., 2006). The mitochondrial genomes of these two loaches were also released, which provided valuable genetic markers for investigations on population genetics and conservation biology (Ye et al., 2013; Zou et al., 2017). Recently, two studies based on high-throughput sequencing developed microsatellite molecular markers in wild populations of S. superciliaris and S. reevesae, which provided important resources for further population and evolutionary studies (Liu et al., 2017; Wang et al., 2018).
Fortunately, our laboratory has successfully broken through the artificial reproduction of S. superciliaris and S. reevesae after conducting many years of researches involved in the gonadal development, reproduction habits, and spawning conditions (Huang et al., 2011; Wang et al., 2014a; Yue et al., 2011). Furthermore, in the early stage of artificial domestication of S. superciliaris and S. reevesae, we found that the mature males of S. reevesae had large testicles and thus could ejaculate a large amount of semen, and the egg fertilization rate was higher compared to the mature males of S. superciliaris (Wang et al., 2014b). In addition, we found S. superciliaris could hybridize with S. reevesae and produce fertile offspring (Wang et al., 2014b). Previous researches reported that distant hybridization was an important evolutionary mechanism of breeding, which could combine the excellent traits of the parents, increase genetic diversity, obtain excellent new hybrid varieties, increase the fitness and adaptive potential of populations (Lou and Li, 2006; Szűcs et al., 2012). Distant hybridization has been widely used in the genetic breeding of fish such as Megalobrama amblycephala (Qin et al., 2018), Erythroculter ilishaeformis (Li et al., 2019), Epinephelus fuscoguttatus (Chen et al., 2018), and Siniperca scherzeri (Shan et al., 2013), and a certain level of hybrid vigor was detected. Thus, we speculated that the hybridization of S. superciliaris and S. reevesae may help compensate for the small testis and low sperm of the mature male of S. superciliaris, thereby expanding the industrialization and the preservation of germplasm resources of these two loaches. In the present study, we firstly carried out artificial breeding of S. superciliaris and S. reevesae, and the hybrid combination of S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀. However, during the process of artificial domestication, it is a common phenomenon that loss of genetic diversity in hatchery populations (Kohlmann et al., 2005; Skaala et al., 2004). This genetic diversity reduction may lead to negative impacts on the aquaculture industry like decreasing disease-resistance and reproductive capacity (Zhang and Gui, 2018). Therefore, one of the key scientific issues is how to maintain the genetic variation among populations, and it is necessary to exploit an appropriate breeding method based on genetic information to achieve the long-term success of domestication and to protect the genetic resources (Ma et al., 2020). Thus, we secondly evaluated the genetic diversity and population genetic structure between the hybrid offspring and their parents.
Due to high level of polymorphism, codominance, abundance in the genome, relatively small size and rapid analysis protocol, microsatellites, or simple sequence repeats (SSRs), were usually used to investigate population genetic structure, conservation genetics, parentage analyses, and genetic variation of breeding stocks in farmed fish (Chistiakov et al., 2006; Ellegren, 2004; Jones et al., 2010; Mittal and Dubey, 2009). In addition, SSRs offer high allelic diversity and the relative ease of transfer between closely related species compared with other molecular markers (Guichoux et al., 2011).
In the present study, a total of 19 SSR loci were fluorescent-labeled multiple capillary electrophoresis to establish for allelic genotyping in four groups (S. superciliaris, S. reevesae, S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀). The purpose of this study is threefold: (1) to evaluate the genetic diversity of S. superciliaris, S. reevesae, and their hybrid populations; (2) to analyze the genetic relationships and structure among these four groups and (3) to provide scientific and practical suggestions for the breeding program and ensure captive production.
MATERIALS AND METHODS
Sampling and DNA extraction
Firstly, live samples of S. reevesae and S. superciliaris were collected from the middle and upper reaches of Yangtze River. Subsequently, all the fishes were artificially domesticated at the key laboratory of Sichuan province for fish conservation and utilization in the upper reaches of the Yangtze River, Neijiang, China. The artificial reproduction of the two species was successful after the long-term domestication, and then we carried out artificial reproduction of S. reevesae, S. superciliaris, and hybrid combination of S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀. To estimate their genetic diversity of the offspring and their parents, a total of 96 samples were selected from the four populations comprising of pure F1 of S. superciliaris (group A), F1 of S. reevesae (group B), F1 of S. superciliaris ♀ × S. reevesae ♂ (group C), and F1 of S. superciliaris ♂ × S. reevesae ♀ (group D), the equal amount of 24 samples were randomly selected from the four groups respectively. The male and female parents of the four F1 populations were came from the artificial domestication of S. superciliaris and S. reevesae, which were cultured in two different independent ponds.
Tissue samples were taken from a small amount of caudal fin and immediately stored at 95% ethanol. After sampling the tissues, the fishes were returned to their corresponding aquaculture pond. The caudal fins stored in 95% ethanol were used for genomic DNA extraction with DNeasy Blood Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions.
PCR amplification and genotyping
A total of 19 polymorphic microsatellite loci that can be amplified in both S. superciliaris, S. reevesae in our previous research (Wang et al., 2018) were chosen for genotyping and genetic assessment for this study (Table I). The 5′ ends of the forward primer of all the microsatellite loci were labelled with a FAM fluorochrome, and then used for PCR amplification and genotyping in four groups mentioned above.
Table I. Microsatellite loci of and their primers for genetic diversity evaluation in S. superciliaris, S. reevesae, and their hybrid populations.
|
Loci |
Primer sequence (5’-3’) |
Primer 5′ label |
Repeat motif |
Size/bp |
Tm/ oC |
GenBank accession No. |
|
SS17 |
F: GGAGCAGACTTACAGACTTCACAC R: CACACAGTAATGCGGAGGAAGC |
FAM |
(AAAC)11 |
245 |
59 |
MF289948 |
|
SS19 |
F: CTCTCCATCATCTTCAGCACCAC R: GTATAGCAGCCCTAGAAGCACC |
FAM |
(GTTA)10 |
193 |
60 |
KY660315 |
|
SS20 |
F: CCTTCTCCTCTTTTAGGTGTGAC R: GAATCTTCAGAGCAGAGAGTGTG |
FAM |
(TCCA)10 |
168 |
58 |
KY660316 |
|
SS21 |
F: GGAATCTGGCTGTTGTTAAGCAC R: CGCTGTGGTGTTTCATTGGG |
FAM |
(AAGA)10 |
198 |
58 |
KY660317 |
|
SS24 |
F: CTTCTACACGAATGGGAAACGG R: GGCCTATGAAGTTATACAGTCCC |
FAM |
(CACT)10 |
316 |
60 |
KY660318 |
|
SS26 |
F: CCTCTCACAAGCCATGAACGTC R: GTATCAGTGCTGCCCTCTGGTG |
FAM |
(GATG)10 |
222 |
58 |
KY660320 |
|
SS27 |
F: CCAGTCTGTCAGGCTTATGCAG R: GCTTACAGACAGAATGCCAGCTC |
FAM |
(ATCT)10 |
290 |
58 |
KY660321 |
|
SS29 |
F: GTAAGTCCGTCAGTATCAGACAC R: CATGAAGAGATTGTATGACCGGC |
FAM |
(TGAA)10 |
217 |
60 |
MF289952 |
|
SS31 |
F: GAGAAGAGCTGTGCGGTTG R: GAGGAAGAGAGTTACGAGCAG |
FAM |
(TTCT)10 |
272 |
59 |
MF289954 |
|
SS33 |
F: CACTCATCAGATTTGCACTGGG R: GTCTGAAACAAGATACACTCACTCG |
FAM |
(TGAG)10 |
222 |
60 |
KY660322 |
|
SS34 |
F: CAACATCCAACATCAGCCCTG R: GCCATGTGTTGACTTTGTGTG |
FAM |
(GTTA)10 |
212 |
58 |
KY660323 |
|
SS37 |
F: GAACTAATTGCTGTGGAGCGG R: CCTTCTCTGCATAACCCACG |
FAM |
(ACAG)9 |
213 |
56 |
MF289955 |
|
SS38 |
F: CACCCAGAGACACAACTGTTCC R: GTTGTTGTTCCCAGGGTGTTCC |
FAM |
(TCTG)8 |
173 |
57 |
MF289956 |
|
SS39 |
F: CTAACCTGCATCTCATTGGCTCC R: GTCTTACGCTACCTACGGCTG |
FAM |
(TATC)9 |
236 |
57 |
MF289957 |
|
SS43 |
F: CAGAGAGGTGGTGGTAGAGAGG R: CCACAGATTGCAGTTATGTTCCC |
FAM |
(AATG)8 |
226 |
60 |
MF289959 |
|
SS50 |
F: GAAGAGATGGAGACAGGCGCTC R: CAGCATCATTGCGGAAGATCCAG |
FAM |
(GATA)8 |
274 |
59 |
MF289960 |
|
SS52 |
F: CGATCCTCTCCACCTCTACACAC R: GTCGCATCTGCTTCACAGCTTC |
FAM |
(GGAT)9 |
186 |
59 |
MF289961 |
|
SS56 |
F: CACACACGAAGATCCACACCTC R: CAAACGGTGCTCATGTCCTGC |
FAM |
(ACAA)8 |
202 |
59 |
MF289964 |
|
SS57 |
F: GAACTCTCTCCATCCCTTCCTG F: GAACTCTCTCCATCCCTTCCTG |
FAM |
(CTGT)9 |
266 |
56 |
MF289965 |
The final volume of polymerase chain reaction (PCR) was 25 μL, containing 12.5 μL 2×PCR Master Mix, 1.0 μL each primer (10 μM), 1.0 μL genomic DNA (100 ng/μL) and distilled water up to 25 μL. The thermocycler programs for PCR procedure were conducted as follows: an initial denaturation stage at 94°C for 5 min, a total of 35 cycles of denaturation at 94°C for 30 s, an annealing stage at Tm for 30 s (the Tm was optimized according to different pairs of primers), an extension stage at 72°C for 30 s, and a final extension stage at 72°C for 7 min. PCR products were initially determined when an obvious PCR product was successfully amplified, which ensured the effectiveness of the corresponding primers using a 8% non-denaturing polyacrylamide gel (PAGE), and the pBR322 DNA/MspI molecular weight marker (TIANGEN; Beijing, China) was used as a standard ladder for the assessment to estimate the approximate interval product size. Then the successfully amplified PCR products were quantitatively diluted, and resolved on an ABI 3730 xl DNA analyzer (Applied Biosystems, USA) by multiple capillary electrophoresis method to analyze the number and size of the alleles of each microsatellite locus.
Genetic diversity and population differentiation analysis
GeneMarker software was used to analyze the allelic peaks and size of each microsatellite locus (Holland and Parson, 2011). In each group, the genetic diversity parameters, including the number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), allelic richness (Rs), Hardy-Weinberg equilibrium test (HWE), and Nei’s genetic distance among these four groups were assessed using POPGENE 1.3.1 (Yeh et al., 1997). The polymorphic information content (PIC) was calculated using CERVUS 3.0.3 (Kalinowski et al., 2007). The possible presence of null alleles was estimated at a 95% confidence interval using Micro-Checker 2.2.3 (Van Oosterhout et al., 2004). Genetic variation in the two loaches and their hybrid populations were also calculated. Pairwise population fixation indices for FST values among four groups were performed using ARLEQUIN 3.5 (Excoffier and Lischer, 2010) with 1,000 random permutations. Moreover, analysis of molecular variance (AMOVA) was also computed in ARLEQUIN 3.5.
Genetic structure analysis
First, the UPGMA phylogenetic tree was constructed based on the Nei’s genetic distance in MEGA 7 (Pritchard et al., 2000). To further verify the reliability of the clustering relationship, the potential number of genetic clusters and the membership of each individual were further conducted using Bayesian clustering analyses in Structure 2.3.4 (Pritchard et al., 2000). Admixture models were chosen to assess possible clusters (K value). The lengths of the MCMC iterations were set to 200,000 repetitions with a burn in period of 20,000. The K value range was set to 1–4, and each K was replicated 15 times. The most likely K value was chosen according to peak value of the mean log likelihood [Ln P(X/K)] and the Delta K statistic for a given K using Structure Harvester 0.6.93 (Earl, 2012). The results from 15 replicates of the selected K values were then aligned and conducted by CLUMPP 1.1.2 (Jakobsson and Rosenberg, 2007). The results were finally visualized in DISTRUCT 1.1 (Rosenberg, 2004).
RESULTS
Genetic diversity parameters of the two loaches and their hybrids
All of the 19 microsatellite loci were amplified successfully and showed polymorphism in all groups of the present study. Genetic parameters of these 19 analyzed loci are shown in Table II. For group A of the population S. superciliaris, the number of alleles (Na) in per locus ranged from 6 to 22, the observed heterozygosity (Ho) and expected heterozygosity (He) ranged from 0.667 to 1.000 and 0.683 to 0.928, respectively, the allelic richness (Rs) ranged from 3.016 to 10.971, and the polymorphic information content (PIC) ranged from 0.645 to 0.903. For group B of the population S. reevesae, per locus of Na ranged from 2 to 19, Ho and He ranged from 0.042 to 1.000 and 0.042 to 0.922, respectively. Rs ranged from 1.043 to 10.286. PIC ranged from 0.040 to 0.895, and locus of SS21, and SS56 were lower than 0.5 (Table II). For the group C of the population S. superciliaris ♀ × S. reevesae ♂, per locus of Na fluctuated from 7 to 15, Ho and He fluctuated from 0.417 to 1.000 and 0.510 to 0.908, respectively, Rs fluctuated from 1.997 to 9.000. PIC fluctuated from 0.472 to 0.879, and the PIC value in all of these 19 was higher than 0.5 except for the locus of SS27. For the group D of the population S. superciliaris ♂ × S. reevesae ♀, per locus of Na fluctuated from 4 to 12, Ho and He fluctuated from 0.500 to 1.000 and 0.554 to 0.893, respectively, Rs fluctuated from 2.186 to 7.945. PIC fluctuated from 0.474 to 0.861, and the PIC value in all of these 19 was higher than 0.5 except for the locus of SS57 (Table II).
In general, the mean number of alleles per population varied from 8 (Group D of S. superciliaris ♂ × S. reevesae ♀) to 12 (Group A of S. superciliaris). Among the four groups, the lowest mean value of PIC (0.685) was observed in the Group B of S. reevesae, while the highest (0.818) was appeared in the group A of S. superciliaris. The lowest mean Ho (0.779) was observed in the Group B of S. reevesae, while the highest mean Ho (0.887) was observed in the Group C of S. superciliaris ♀ × S. reevesae ♂ (Table II).
Table II. Summary of genetic diversity based on 19 microsatellite loci in four groups including S. superciliaris, S. reevesae, and their hybrid populations.
|
Groups |
Na |
Ho |
He |
PIC |
Rs |
PHWE |
|
S. superciliaris |
||||||
|
SS17 |
7 |
0.917 |
0.796 |
0.752 |
4.535 |
0.966 |
|
SS19 |
17 |
0.875 |
0.927 |
0.901 |
10.688 |
0.299 |
|
SS20 |
14 |
0.958 |
0.914 |
0.886 |
9.521 |
0.460 |
|
SS21 |
17 |
1.000 |
0.915 |
0888 |
9.600 |
0.135 |
|
SS24 |
22 |
0.875 |
0.928 |
0.903 |
10.971 |
0.000* |
|
SS26 |
7 |
0.792 |
0.780 |
0.750 |
4.608 |
0.433 |
|
SS27 |
11 |
0.792 |
0.683 |
0.645 |
3.016 |
0.857 |
|
SS29 |
6 |
0.667 |
0.778 |
0.726 |
4.189 |
0.065 |
|
SS31 |
14 |
0.958 |
0.903 |
0.873 |
8.597 |
0.031 |
|
SS33 |
14 |
0.958 |
0.905 |
0.876 |
8.794 |
0.816 |
|
SS34 |
11 |
0.917 |
0.883 |
0.850 |
7.385 |
0.811 |
|
SS37 |
12 |
0.750 |
0.881 |
0.849 |
7.291 |
0.088 |
|
SS38 |
9 |
0.958 |
0.850 |
0.813 |
5.969 |
0.509 |
|
SS39 |
13 |
0.875 |
0.880 |
0.848 |
7.245 |
0.953 |
|
SS43 |
10 |
0.750 |
0.895 |
0.863 |
8.056 |
0.031 |
|
SS50 |
15 |
0.958 |
0.919 |
0.892 |
10.017 |
0.715 |
|
SS52 |
10 |
0.958 |
0.832 |
0.791 |
5.383 |
0.943 |
|
SS56 |
9 |
0.708 |
0.700 |
0.645 |
3.182 |
0.011 |
|
SS57 |
10 |
0.917 |
0.840 |
0.799 |
5.620 |
0.960 |
|
Mean |
12 |
0.873 |
0.854 |
0.818 |
7.097 |
- |
|
S. reevesae |
||||||
|
SS17 |
6 |
0.792 |
0.768 |
0.712 |
4.028 |
0.003 |
|
SS19 |
14 |
0.917 |
0.907 |
0.878 |
8.930 |
0.096 |
|
SS20 |
8 |
0.917 |
0.840 |
0.800 |
5.647 |
0.039 |
|
SS21 |
5 |
0.833 |
0.571 |
0.462 |
2.268 |
0.348 |
|
SS24 |
9 |
0.917 |
0.871 |
0.835 |
6.777 |
0.028 |
|
SS26 |
3 |
0.833 |
0.646 |
0.555 |
2.723 |
0.035 |
|
SS27 |
10 |
0.708 |
0.704 |
0.657 |
3.218 |
0.123 |
|
SS29 |
5 |
0.542 |
0.560 |
0.500 |
2.215 |
0.009 |
|
SS31 |
14 |
0.875 |
0.891 |
0.861 |
7.937 |
0.028 |
|
SS33 |
16 |
1.000 |
0.916 |
0.888 |
9.681 |
0.001 |
|
SS34 |
12 |
0.917 |
0.898 |
0.867 |
8.288 |
0.529 |
|
SS37 |
3 |
0.750 |
0.649 |
0.561 |
2.743 |
0.042 |
|
SS38 |
9 |
0.708 |
0.599 |
0.569 |
2.420 |
1.000 |
|
SS39 |
16 |
0.917 |
0.922 |
0.895 |
10.286 |
0.028 |
|
SS43 |
6 |
0.667 |
0.684 |
0.614 |
3.032 |
0.837 |
|
SS50 |
19 |
0.750 |
0.920 |
0.895 |
10.105 |
0.000* |
|
SS52 |
8 |
0.958 |
0.838 |
0.797 |
5.565 |
0.471 |
|
SS56 |
2 |
0.042 |
0.042 |
0.040 |
1.043 |
1.000 |
|
SS57 |
5 |
0.750 |
0.707 |
0.630 |
3.254 |
0.000* |
|
Mean |
9 |
0.779 |
0.733 |
0.685 |
5.266 |
- |
|
Groups |
Na |
Ho |
He |
PIC |
Rs |
PHWE |
|
S. superciliaris ♀ × S. reevesae ♂ |
||||||
|
SS17 |
7 |
0.833 |
0.742 |
0.691 |
3.657 |
0.008 |
|
SS19 |
13 |
1.000 |
0.887 |
0.856 |
7.629 |
0.000* |
|
SS20 |
10 |
0.870 |
0.895 |
0.862 |
8.015 |
0.009 |
|
SS21 |
14 |
0.913 |
0.838 |
0.800 |
5.539 |
0.994 |
|
SS24 |
12 |
0.917 |
0.831 |
0.793 |
5.358 |
0.163 |
|
SS26 |
8 |
0.958 |
0.826 |
0.784 |
5.236 |
0.015 |
|
SS27 |
7 |
0.417 |
0.510 |
0.472 |
1.997 |
0.693 |
|
SS29 |
8 |
0.875 |
0.820 |
0.775 |
5.075 |
0.656 |
|
SS31 |
11 |
0.958 |
0.895 |
0.863 |
8.056 |
0.238 |
|
SS33 |
10 |
1.000 |
0.845 |
0.807 |
5.789 |
0.010 |
|
SS34 |
10 |
1.000 |
0.875 |
0.841 |
6.982 |
0.081 |
|
SS37 |
11 |
0.958 |
0.770 |
0.737 |
4.056 |
0.991 |
|
SS38 |
8 |
0.958 |
0.805 |
0.757 |
4.721 |
0.515 |
|
SS39 |
14 |
0.792 |
0.886 |
0.854 |
7.529 |
0.000* |
|
SS43 |
10 |
0.958 |
0.861 |
0.825 |
6.365 |
0.672 |
|
SS50 |
15 |
0.708 |
0.908 |
0.879 |
9.000 |
0.001 |
|
SS52 |
8 |
0.957 |
0.854 |
0.815 |
6.081 |
0.050 |
|
SS56 |
7 |
0.870 |
0.645 |
0.599 |
2.713 |
0.913 |
|
SS57 |
9 |
0.917 |
0.852 |
0.814 |
6.031 |
0.420 |
|
Mean |
10 |
0.887 |
0.818 |
0.780 |
5.781 |
- |
|
S. superciliaris ♂ × S. reevesae ♀ |
||||||
|
SS17 |
6 |
0.875 |
0.813 |
0.766 |
4.902 |
0.025 |
|
SS19 |
12 |
0.875 |
0.875 |
0.841 |
6.982 |
0.177 |
|
SS20 |
10 |
1.000 |
0.879 |
0.847 |
7.200 |
0.002 |
|
SS21 |
8 |
1.000 |
0.828 |
0.786 |
5.284 |
0.198 |
|
SS24 |
9 |
0.667 |
0.761 |
0.718 |
3.918 |
0.000* |
|
SS26 |
5 |
0.875 |
0.808 |
0.757 |
4.780 |
0.062 |
|
SS27 |
8 |
0.875 |
0.796 |
0.748 |
4.535 |
0.229 |
|
SS29 |
5 |
0.958 |
0.679 |
0.627 |
2.985 |
0.036 |
|
SS31 |
11 |
1.000 |
0.893 |
0.861 |
7.945 |
0.035 |
|
SS33 |
10 |
0.917 |
0.875 |
0.841 |
6.982 |
0.007 |
|
SS34 |
10 |
0.958 |
0.854 |
0.817 |
6.095 |
0.060 |
|
SS37 |
8 |
0.792 |
0.760 |
0.716 |
3.905 |
0.000* |
|
SS38 |
6 |
0.875 |
0.774 |
0.721 |
4.129 |
0.099 |
|
SS39 |
11 |
0.917 |
0.834 |
0.780 |
5.460 |
0.000* |
|
SS43 |
6 |
0.875 |
0.718 |
0.663 |
3.368 |
0.578 |
|
SS50 |
10 |
0.792 |
0.881 |
0.848 |
7.291 |
0.000* |
|
SS52 |
5 |
1.000 |
0.724 |
0.661 |
3.439 |
0.067 |
|
SS56 |
4 |
0.750 |
0.563 |
0.505 |
2.228 |
0.232 |
|
SS57 |
4 |
0.500 |
0.554 |
0.474 |
2.186 |
0.456 |
|
Mean |
8 |
0.868 |
0.783 |
0.736 |
4.927 |
- |
Note: Na, indicated the number of alleles; Ho, indicated observed heterozygosity; He, indicated expected heterozygosity; PIC, indicated the polymorphism information content; Rs, indicated allelic richness; and PHWE, indicated significance of deviation from Hardy-Weinberg equi-librium at P-levels 0.001 (***).
Hardy-Weinberg balance analysis results showed that locus of SS24 in S. superciliaris and loci of SS50 and SS57 in S. reevesae exhibited departure from HWE after applying a Bonferroni correction (P<0.001). Loci of SS19 and SS39 in S. superciliaris ♀ × S. reevesae ♂, and loci of SS24, SS37, SS39, and SS50 in S. superciliaris ♂ × S. reevesae ♀ were also exhibited departure from HWE. For the estimation of null allele, SS50 in population of S. reevesae and S. superciliaris ♀ × S. reevesae ♂ showed evidence for a null allele. No locus showed evidence for a null allele in the population of S. superciliaris and S. superciliaris ♂ × S. reevesae ♀.
Population differentiation of the two loaches and their hybrids
Results of AMOVA analysis of S. superciliaris, S. reevesae and their hybrid populations showed that the variation among populations was 7.97%, variation among individuals within population was -6.68%, and variation within individuals was 98.71% (Table III). Most of the variance was due to variation within individuals.
Table III. Hierarchical analysis of molecular variance (AMOVA) for S. superciliaris, S. reevesae, and their hybrid populations based on 19 microsatellite loci.
|
Source of variation |
d.f. |
Sum of squares |
Variance components |
Percentage of variation (%) |
|
Among populations |
3 |
114.807 |
0.65185 Va |
7.97 |
|
Among individuals within population |
92 |
642.208 |
-0.54620 Vb |
-6.68 |
|
Within individuals |
96 |
775.000 |
8.07292 Vc |
98.71 |
|
Total |
191 |
1532.015 |
8.17857 |
100 |
Nei’s genetic distance (Ds) between groups varied from 0.3585 to 0.6575 (Table IV), suggesting the studied populations were in interspecific inheritance (0.1 < Ds < 2.0) (Thorpe, 1982). The genetic differentiation index (Fst) varied from 0.0545 to 0.1069 (Table IV), indicating all groups were moderately differentiated (0.05 < Fst < 0.15) (Wright, 1978).
Table IV. Matrix of pair-wise Fst values (above diagonal) and Nei’s genetic distance (below diagonal) between groups of two loaches and their hybrid populations.
|
Pop ID |
Group A |
Group B |
Group C |
Group D |
|
Group A |
**** |
0.1069 |
0.0545 |
0.0709 |
|
Group B |
0.6575 |
**** |
0.0845 |
0.0764 |
|
Group C |
0.4461 |
0.4338 |
**** |
0.0763 |
|
Group D |
0.4947 |
0.3585 |
0.4765 |
**** |
Population genetic structure of the two loaches and their hybrids
The results of UPGMA clustering tree based on Nei’s genetic distance showed that group A (Sinibotia superciliaris) and group C (S. superciliaris ♀ × S. reevesae ♂) were firstly clustered together that comprised of clade I, group B (S. reevesae) and group D (S. superciliaris ♂ × S. reevesae ♀) were then gathered together that comprised of clade II (Fig. 1).
The difference among these four groups were also corroborated by Bayesian clustering, which reflected the presence of two clusters (K= 2; Fig. 2a) with a clear divide between group A, C, and group B, D. The genetic structure of Bayesian clustering analyses was consist with the UPGMA clustering tree. The mean Ln P(K) and ΔK change with the increase of the number of subgroups K. When K=2, mean Ln P(K) had the maximum inflection point and the maximum ΔK. Therefore, it was considered that K= 2 was the most probable model, and it was speculated that the 4 populations could be divided into 2 subgroups (Fig. 2b). However, isolation between the two clusters including group A, C, and group B, D was not complete, and some individuals from both clades showed mixed origin, especially for the hybrid populations.
DISCUSSION
Genetic diversity of the two loaches and their hybrids
In this study, a total of 19 microsatellite loci were successfully amplified and exhibited polymorphism in the four artificial breeding populations of S. reevesae, S. superciliaris, and their hybrid populations, implying that the microsatellite markers we developed in the previous research were effective (Wang et al., 2018). Among the 19 loci, only locus SS24 was deviated from HWE in Group A of S. superciliaris. Locus SS50 and SS57 in Group B of S. reevesae, and locus SS19 and SS39 in Group C of S. superciliaris ♀ × S. reevesae ♂ were also deviated from HWE. Differently, Group D of S. superciliaris ♂ × S. reevesae ♀ have four loci (SS24, SS37, SS39, and SS50) that deviated from HWE. Among these loci, SS24, SS39 and SS50 deviated from HWE at least in two groups, and thus they should be used with caution in subsequent population genetic analyses. The potential presence of null alleles were observed at one locus (SS50) in two groups, including S. reevesae and S. superciliaris ♀ × S. reevesae ♂, and which may be caused by a mutation at the primer binding sites leading to amplification failure (Lehmann et al., 1996). Thus, the deviation from HWE at SS50 can probably be explained by the presence of null alleles that mentioned in previous research (Li et al., 2014). The reasons why other loci deviated from HWE need to be further explored.
The number of alleles (Na), observed heterozygosity (Ho), and polymorphism information content (PIC) are three important parameters used to study population genetic diversity of organisms. Here, based on the analysis of 19 microsatellite loci, the mean values of PIC values were more than 0.5 in all groups. In detail, the mean PIC was 0.818, 0.685, 0.780, and 0.736 in S. superciliaris, S. reevesae, S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀, respectively. Previous research indicated the locus was high polymorphic when PIC > 0.50 (Botstein et al., 1980), the mean PIC in the four groups here was ranged from 0.685 to 0.818, suggesting high genetic diversity of the four groups in this study. The PIC in the wild populations of these two loaches also showed a high level of polymorphism, and the mean PIC in S. superciliaris and S reevesae was 0.54 and 0.5, respectively (Wang et al., 2018). Compared with the wild populations, the culture F1 populations of these two loaches and their hybrid progeny of F1 here had also maintained high genetic diversity, indicating the domestication process of these two loaches were considered to be in the early stage, and the same pattern also detected in the red-tail catfish (Zhou et al., 2021). The diversity of the both hybrid combinations were higher than the group B of S. reevesa, which may be the embodiment of the hybridization vigor among species. Furthermore, observed heterozygosity can represent the degree of individual genetic variation within a population, and the higher heterozygosity value signifies greater variation and higher genetic diversity. In the present research, the hybrid combination of S. superciliaris ♀ × S. reevesae ♂ obtained the highest value of Ho (0.887) compared to other three groups, which indicated its highest genetic diversity. In general, heterozygosity and genetic diversity of the hybrid combination of S. superciliaris ♀ × S. reevesae ♂ are higher than those of that in the combination of S. superciliaris ♂ × S. reevesae ♀, and the former has fewer loci deviating from HWE. Distant hybridization can effectively increase the genetic structure variation of the population and improve the inheritance of the population diversity. Thus, in the subsequent artificial breeding, it is recommended that the hybrids of S. superciliaris ♀ × S. reevesae ♂ can be utilized as the potential germplasm resources.
Genetic differentiation and genetic structure of populations
All of the four populations had moderate differentiation levels, and variation within individuals were the primary origin of variation. Genetic distance and genetic identity index were indicators that reflected the genetic relationship of the population. Comparing the Nei’s genetic distance between S. reevesae and the hybrid combinations of S. superciliaris ♀ × S. reevesae ♂ and S. superciliaris ♂ × S. reevesae ♀, it was indicated that the Nei’s genetic distance between S. reevesae and the hybrid combination of S. superciliaris ♂ × S. reevesae ♀ was the closest (0.3585), in comparison with the hybrid combination of S. superciliaris ♀ × S. reevesae ♂ (0.4338). Moreover, S. superciliaris also showed the similar pattern, with a closer genetic distance (0.4461) to S. superciliaris ♀ × S. reevesae ♂, in comparison with the combination of S. superciliaris ♂ × S. reevesae ♀ (0.4947). UPGMA clustering tree with Nei’s genetic distance revealed two clusters of the four populations, which was consistent with the results from the Bayesian clustering analyses in structure. Meanwhile, gene flow was found among multiple individuals of the hybrid populations and their parents. In summary, although the hybrid offspring inherited the genetic characteristics of both parents, they were more closely related to the female parents and a closer genetic relationship was found between the offspring populations and their female parents, and a similar pattern was obtained in the interspecific hybridization research of Quasipaa (Zhang et al., 2019).
Distant hybrization can integrate the genome of parents into the hybrid offspring to produce rich genetic variation. Thus, distant hybrization plays an important role in increasing species fitness and adaptive potential of populations. In this study, hybrid combinations of S. superciliaris ♀ × S. reevesae ♂ and S. superciliaris ♂ × S. reevesae ♀ obtained healthy crossbred offsprings. In our previous study, we observed the F1 embryonic development of S. superciliaris ♀ × S. reevesae ♂ showed obvious heterosis and could grow to be mature and reproduce normally to produce F2 hybrids (Wang et al., 2014b). Here, after comparing the analysis of the genetic diversity indicators such as the number of alleles, polymorphic information content, and especially the observed heterozygosity of the two loaches and their hybrid populations, we observed the genetic diversity of hybrid offspring population was rich, especially for S. superciliaris ♀ × S. reevesae ♂ that presented the highest Ho than the other three populations, implying the highest genetic diversity in the population of S. superciliaris ♀ × S. reevesae ♂.
However, along with breeding environment and feeding ground destructions, and overfishing of S. superciliaris and S. reevesae, the wild resources of the two species would be severely declined. Thus, there is an increasing need to develop captive breeding to protect genetic diversity, support the strengthening of populations, and aid the two loaches recovery. In the artificial reproduction process, the shortage including the sparse of semen volume in S. superciliaris and low number of eggs amount in S. reevesae will block large amount of offspring reproduction. Artificial hybrids success of the two S. superciliaris and S. reevesae will overcome the shortage. Based on our results, we recommended the hybrid strategy of S. superciliaris ♀ × S. reevesae ♂ would be a suitable route, which displayed the highest genetic diversity compared with other strategies. In addition, the hybrid individuals of S. superciliaris ♀ × S. reevesae ♂ could be considered as a potentially alternative economic fish of S. superciliaris and S. reevesae, thus it would benefit the natural resource conversation of these two species.
CONCLUSIONS
In conclusion, four groups presented high polymorphic due to the average PIC values in all of them were greater than 0.5. Furthermore, we found that the hybrid combination of S. superciliaris ♀ × S. reevesae ♂ presented the highest Ho than the other three groups. The high heterozygosity was useful to conserve the genetic resources and prevent the genetic decline, which could reduce the risk of inbreeding due to loss of heterozygosity. The hybrid strategy of S. superciliaris ♀ × S. reevesae ♂ had great potentials for artificially propagated germplasm resources. Thus, we recommended the hybrid strategy of S. superciliaris ♀ × S. reevesae ♂ would be more suitable for further artificial reproduction compared with other strategies. This study provides reasonable comparison of genetic diversity and potential application of hybrid strategy of S. superciliaris and S. reevesae, and the captive propagation programs can aid in the recovery of S. superciliaris and S. reevesae by providing individuals that can be used to supplement wild populations, and to produce a hybrid strain for captive production to take the strain off the harvesting of wild populations. These data described in this study provided a foundation and guidelines for wild population protection and breeding population construction in future breed improvement of these two loaches.
ACKNOWLEDGMENTS
We thank Drs Zhenyong Wen and Yunhai Yi for their valuable and constructive suggestions in revising the manuscript. This research was funded by the Sichuan Provincial Department of Science and Technology Application Basic Project (no. 2019YJ0398); the Major Project in Neijiang Normal University (no. 2021ZD09); and College Students Innovation and Entrepreneurship of Sichuan Province (no. X2019082).
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Botstein, D., White, R.L., Skolnick, M., and Davis, R.W., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet., 32: 314.
Chen, X., Shao, T., Long, X., Esposito, A., 2018. Evaluation of the effects of different stocking densities on the sediment microbial community of juvenile hybrid grouper (♀Epinephelus fuscoguttatus × ♂ Epinephelus lanceolatus) in recirculating aquaculture systems. PLoS One, 13: e0208544. https://doi.org/10.1371/journal.pone.0208544
Chistiakov, D.A., Hellemans, B., and Volckaert, F.A., 2006. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture, 255: 1-29. https://doi.org/10.1016/j.aquaculture.2005.11.031
Earl, D.A., 2012. Structure harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour., 4: 359-361. https://doi.org/10.1007/s12686-011-9548-7
Ellegren, H., 2004. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet., 5: 435-445. https://doi.org/10.1038/nrg1348
Excoffier, L., and Lischer, H., 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour., 10: 564-567. https://doi.org/10.1111/j.1755-0998.2010.02847.x
Guichoux, E., Lagache, L., Wagner, S., Chaumeil, P., Léger, P., Lepais, O., Lepoittevin, C., Malausa, T., Revardel, E., and Salin, F., 2011. Current trends in microsatellite genotyping. Mol. Ecol. Resour., 11: 591-611. https://doi.org/10.1111/j.1755-0998.2011.03014.x
Holland, M.M., and Parson, W., 2011. GeneMarker® HID: A reliable software tool for the analysis of forensic STR data. J. Forensic Sci., 56: 29-35. https://doi.org/10.1111/j.1556-4029.2010.01565.x
Huang, Y., Yue, X., Wang, F., Gan, L., Xie, B., Wang, Y., Qi, Z., and Ge, Z., 2011. Studies on the individual fecundity of Botia reevesae in the Tuojiang River, a Tributary River of the Yangtze River. Sichuan J. Zool., 30: 916-920. (in Chinese).
Jakobsson, M., and Rosenberg, N.A., 2007. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics, 23: 1801-1806. https://doi.org/10.1093/bioinformatics/btm233
Jiang, Z., Jiang, J., Wang, Y., Zhang, E., Zhang, Y., Li, L., Xie, F., Cai, B., Cao, L., and Zheng, G., 2016. Red list of China’s vertebrates. Biodivers. Sci., 24: 500. (in Chinese).
Jones, A.G., Small, C.M., Paczolt, K.A., and Ratterman, N.L., 2010. A practical guide to methods of parentage analysis. Mol. Ecol. Resour., 10: 6-30. https://doi.org/10.1111/j.1755-0998.2009.02778.x
Kalinowski, S.T., Taper, M.L., and Marshall, T.C., 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol., 16: 1099-1106. https://doi.org/10.1111/j.1365-294X.2007.03089.x
Kohlmann, K., Kersten, P., Flajšhans, M., 2005. Microsatellite-based genetic variability and differentiation of domesticated, wild and feral common carp (Cyprinus carpio L.) populations. Aquaculture, 247: 253-266. https://doi.org/10.1016/j.aquaculture.2005.02.024
Lehmann, T., Hawley, W.A., and Collins, F.H., 1996. An evaluation of evolutionary constraints on microsatellite loci using null alleles. Genetics, 144: 1155-1163. https://doi.org/10.1093/genetics/144.3.1155
Li, Q., Yao, M., Zhou, B., Chen, X., Long, Y., Zhou, C., and Li, M., 2011. Technique of artificial reproduction of Botia superciliaris Günther. Freshw. Fish., 41: 92-95. https://doi.org/10.1007/s11056-010-9213-0
Li, S., Xie, L., Xiao, J., Yuan, L., and Liu, S., 2019. Diploid hybrid fish derived from the cross between female Bleeker’s yellow tail and male topmouth culter, two cyprinid fishes belonging to different subfamilies. BMC Genet., 20: 1-13. https://doi.org/10.1186/s12863-019-0781-5
Li, Y., Wang, J., Zhao, K., Xie, B., and Peng, Z., 2014. Isolation and characterization of 16 polymorphic microsatellite loci for Euchiloglanis kishinouyei. J. Fish Biol., 85: 972-977. https://doi.org/10.1111/jfb.12472
Liu, S., Wang, Y., Xie, B., and Peng, Z., 2017. Twelve novel microsatellite markers for the Chinese golden loach Sinibotia superciliaris (Günther 1892). J. appl. Ichthyol., 33: 821-823. https://doi.org/10.1111/jai.13395
Lou, Y., and Li, X., 2006. Distant hybridization of fish and its application in aquaculture in China. J. Fish. Sci. China, 13: 151-158.
Ma, Q., Wu, B., Jiang, J., and Song, Z., 2020. Genetic characterization of selected domestic populations of channel catfish (Ictalurus punctatus) using microsatellites. Pakistan J. Zool., 52: 1683-1689.
Mittal, N., and Dubey, A., 2009. Microsatellite markers-A new practice of DNA based markers in molecular genetics. Phcog. Rev., 3: 235-246.
Pritchard, J.K., Stephens, M., and Donnelly, P., 2000. Inference of population structure using multilocus genotype data. Genetics, 155: 945-959. https://doi.org/10.1093/genetics/155.2.945
Pu, J., Jia, L., Su, S., Wang, H., Sun, F., and Yao, W., 2013. Age and growth of Botia superciliaris in Hejiang section of the Yangtze River. Freshw. Fish., 43: 38-43.
Qin, Q., Liu, C., Wang, Y., Li, R., and Liu, S., 2018. Rapid genomic and genetic changes in the first generation of autotetraploid lineages derived from distant hybridization of Carassius auratus Red Var. (♀)× Megalobrama amblycephala (♂). Mar. Biotechnol., 21: 139-149. https://doi.org/10.1007/s10126-018-9859-8
Rosenberg, N.A., 2004. Distruct: A program for the graphical display of population structure. Mol. Ecol. Notes, 4: 137-138. https://doi.org/10.1046/j.1471-8286.2003.00566.x
Shan, H., Liang, X.F., Sun, J., Li, L., Yu, Y., Huang, W., Qu, C., Cao, L., Bai, X., and Tao, Y., 2013. Insights into food preference in hybrid F1 of Siniperca chuatsi (♀)× Siniperca scherzeri (♂) mandarin fish through transcriptome analysis. BMC Genom., 14: 1-11. https://doi.org/10.1186/1471-2164-14-601
Skaala, Ø., Høyheim, B., Glover, K., and Dahle, G., 2004. Microsatellite analysis in domesticated and wild Atlantic salmon (Salmo salar L.): Allelic diversity and identification of individuals. Aquaculture, 240: 131-143. https://doi.org/10.1016/j.aquaculture.2004.07.009
Šlechtová, V., Bohlen, J., Freyhof, J., and Ráb, P., 2006. Molecular phylogeny of the Southeast Asian freshwater fish family Botiidae (Teleostei: Cobitoidea) and the origin of polyploidy in their evolution. Mol. Phylogenet. Evol., 39: 529-541. https://doi.org/10.1016/j.ympev.2005.09.018
Szűcs, M., Eigenbrode, S.D., Schwarzländer, M., and Schaffner, U., 2012. Hybrid vigor in the biological control agent, Longitarsus jacobaeae. Evol. Appl., 5: 489-497. https://doi.org/10.1111/j.1752-4571.2012.00268.x
Thorpe, J.P., 1982. The molecular clock hypothesis: Biochemical evolution, genetic differentiation and systematics. Annu. Rev. Ecol. Evol. Syst., 13: 139-168. https://doi.org/10.1146/annurev.es.13.110182.001035
Van Oosterhout, C., Hutchinson, W.F., Wills, D.P., and Shipley, P., 2004. Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes, 4: 535-538. https://doi.org/10.1111/j.1471-8286.2004.00684.x
Wang, Y., Liu, S., Peng, Z., and Xie, B., 2018. Characterization of 27 novel microsatellite loci in Sinibotia superciliaris (Günther 1892) and cross-species transferability in Sinibotia reevesae (Chang 1944). J. appl. Ichthyol., 34: 216-220. https://doi.org/10.1111/jai.13539
Wang, Y., Xie, B., Wang, F., Yue, X., Wang, Y., Qi, Z., Wu, Y., and Shen, S., 2014a. Reproductive characteristics of Sinibotia reevesae in the Tuojiang River. Chin. J. Zool., 49: 699-706. (In Chinese).
Wang, Y., Xie, B., Yue, X., Wang, F., Qi, Z., Wang, Y., and Wu, Y., 2014b. Embryonic development of hybrid of Sinibotia superciliaris (♀) and Sinibotia reevesae (♂). Sichuan J. Zool., 33: 90-93. (In Chinese).
Wright, S., 1978. Variability within and among natural populations. University of Chicago Press, Chicago, IL.
Yang, J., 1992. Revision of the subgenus Botia (Sinibotia) with description of a new species (Cypriniformes: Cobitidae). Ichthyol. Explor. Freshw., 2: 341-349.
Yang, M., and Ding, X., 2010. Study on the reproductive biology of Botia supercilliaris. J. Hydroecol., 2: 38-41.
Ye, H., Huang, Y., Wang, J., Peng, Z., and Zhang, Y., 2013. Determination and comparison of two complete mitochondrial genomes of golden Chinese loach, Sinibotia superciliaris (Teleostei, Cypriniformes). Mitochondr. DNA, 24: 34-36. https://doi.org/10.3109/19401736.2012.716053
Yeh, F.C., Yang, R., Boyle, T.B., Ye, Z., and Mao, J., 1997. Popgene, the user-friendly shareware for population genetic analysis. Corpus (Molecular biology and Biotechnology Centre, University of Alberta, Canada), 10: 295-301.
Yue, X., Wang, F., Xie, B., Qi, Z., Wang, Y., He, B., and Chen, X., 2011. Embryonic development of Botia reevesae in Tuojiang River. Sichuan J. Zool., 30: 390-395. (In Chinese).
Yue, X., Zou, Y., Liu, J., Wang, Y., Wang, F., Xie, B., and Qi, Z., 2013. Chromosome karyotype of Sinibotia superciliaris. Sichuan J. Zool., 3: 017. (In Chinese).
Zhang, D., Fei, X., Kong, S., Zhang, Q., and Zheng, R., 2019. Interspecific hybridization of Quasipaa and genetic characteristics of hybrid tadpole. PeerJ., 7: e27814. https://doi.org/10.7287/peerj.preprints.27814v1
Zhang, Q., and Gui, J., 2018. Diversity, evolutionary contribution and ecological roles of aquatic viruses. Sci. China Life Sci., 61: 1486-1502. https://doi.org/10.1007/s11427-018-9414-7
Zhou, Y., Wu, J., Wang, Z., Li, G., Zhou, L., and Gui, J., 2021. Microsatellite polymorphism and genetic differentiation of different populations screened from genome survey sequencing in red-tail catfish (Hemibagrus wyckioides). Aquacult. Rep., 19: 100614. https://doi.org/10.1016/j.aqrep.2021.100614
Zou, Y., Xie, B., Qin, C., Wang, Y., Yuan, D., Li, R., and Wen, Z., 2017. The complete mitochondrial genome of a threatened loach (Sinibotia reevesae) and its phylogeny. Genes Genom., 39: 767-778. https://doi.org/10.1007/s13258-017-0541-8