Establishment of LAMP Assay for Detection of Bacillus cereus

Xu Yun-Ming1*, Sun Zhi-Yuan1, Yang Jian-Bo1, Bian Rong-Rong2, Ren Hong-Lin3, Zhong Si-Yuan1, Cai Yu-Hong1, Peng Jing1 and Bao Hua-Xia1

1Institute of Animal Husbandry and Veterinary Medicine, Jiangsu Vocational College of Agriculture and Forestry, Jurong 212400, China

2Bureau of Agricultural and Rural Affairs of Jurong, Jurong 212400, China;

3Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, Jilin University. Changchun 130062, China

ABSTRACT

Bacillus cereus is a common foodborne and opportunistic pathogen. It is widely distributed in soil, water and animal intestines. Its special spore structure easily causes foodborne infection to humans or animals. In order to monitor and prevent the spread of B. cereus, a rapid and sensitive loop-mediated isothermal amplification assay has been developed to detect it in uniformly items. According to the entFM gene of B. cereus, four primers were designed, and reaction components and conditions optimized. Sensitivity was compared between optimized LAMP assay and the conventional PCR. The optimal reaction conditions of LAMP assay (25uL each reaction) comprised 1.0 mol/L betaine, 6 m mol/L Mg2+, 1.4 mmol/L dNTPs, 1.6 μmol/L inner primers (1:1), 0.2 μmol/L outer primers (1:1), 2.5 μL 10×thermpol reaction buffer, 1 μL Bst DNA Polymerase (8U/μL), 1 μL template DNA, at 65 incubating 60 min. Two strains of B. cereus out of 18 strains were positive result by LAMP assay. The detection limit of B. cereus genomic DNA(gDNA) by LAMP was 0.755 pg/μL which was 100 times more sensitive than conventional PCR assay. The CFU limit of LAMP assay was 14×103 CFU/mL. The artificial polluted samples (chicken meat) can be detected by LAMP, when at least 45 min must be needed to enrich bacteria. Visual dye hydroxynaphthol (HNB) successfully used in LAMP assay was established for detection of B. cereus in meat.


Article Information

Received 23 January 2022

Revised 25 March 2022

Accepted 17 April 2022

Available online 09 August 2022

(early access)

Published 01 September 2023

Authors’ Contribution

XY-m designed the research. SZ-y and YJ-b adjusted and revised the experimental process. BR-r collected experimental data. CY-h analysed the results. ZS-y, PJ and BH-x took resposilitity of reserach related to LAMP assay. RH-l donated the experimental strains and related reagents, and provided useful suggestions and ideas for the research.

Key words

Loop-mediated isothermal amplification (LAMP), Bacillus cereus, entFM gene, Hydroxynaphthol

DOI: https://dx.doi.org/10.17582/journal.pjz/20220123050105

* Corresponding author: [email protected]

0030-9923/2023/0005-2359 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Bacillus cereus is widely distributed in nature and various foods. It was first isolated from air in a cow shed more than one hundred years ago and reported for the first time in Norway 1950. Since then, similar food poisoning has been reported in many countries (Stenfors et al., 2008).

Food poisoning by B. cereus has obvious seasonality, especially from June to October. Long storage time or incomplete food heating results in the massive reproduction of the bacteria and the production of toxins in food (Sun et al., 2016). Rice or soy dishes were commonly implicated in B. cereus outbreaks (50%). B. cereus which infects human or animal causes sickness through preformed toxin production in improperly handled foods or in vivo toxin production within the gastrointestinal tract after eating of a contaminated food. The symptoms that human and animal are infected of B. cereus are abdominal pain, vomiting, diarrhea and so on (Deng et al., 2020).

Therefore, the development of a ready to use and rapid method for detection of B. cereus is of great importance to improve food safety and protect human health. The detection assays of B. cereus involve routine detection method such as isolation and identification or rapid detection assay including immunology-based and molecular biology. Physiological and biochemical identification test of B. cereus is a common a common and accurate diagnostic assay B. cereus. Molecular biology for example PCR assay and immunological technology for instant ELSIA are rapid detection assay that can get the results in several hours. Li et al. (2021) have established a PCR assay to realize the rapid detection by amplifying the hblA gene of pathogenic B. cereus. ELISA have been invented as an assay for detection of B. cereus by Tallent et al. (2015). Isolation and culture method maybe the most accurate, but it is needed that professional researchers operate the experiment with high cost and long time in a potential threat environment. Rapid detection assays have advantages of high speed, high sensitivity, reliability and accuracy, but the equipment are high cost and too professional.

In 2000, a novel nucleic acid amplification assay named loop-mediated isothermal amplification (LAMP) have been invented in Japan (Notomi et al., 2000). Four primers are used in LAMP assay for amplifying target gene under 60-65℃ constant temperature for 30 ~ 60min. Incili et al. (2019) have improved that specificity and sensitivity values of the LAMP assay are equal or higher and less time-consuming than ISO and VIDAS UP methods that are international standards. A LAMP assay established by Horiuchi et al. (2019) for detection of Helicobacter pylori specimens was 10-1 CFU/tube (37 min reaction time), which was 10-fold more sensitive than polymerase chain reaction. Many other studies have shown that LAMP is more sensitive and efficient than conventional PCR assay (Babu et al., 2020; Liu et al., 2019; Sheet et al., 2016; Mu et al., 2016; Xu et al., 2014; Porcellato et al., 2016). The purpose of this study is to establish a LAMP assay for detection of B. cereus.

Materials and Methods

Main reagents

dNTPs, betaine and Dnase type I digestive enzymes were purchased from Shanghai Sangon Biotech Co., Ltd; Mg2+(MgSO4), thermal buffer and Bst DNA polymerase were gotten from New England (Beijing) Co., Ltd; High purity DNA template preparation kit was bought from Bao biology Co., Ltd; LB liquid culture medium was purchased from Haibo biological Co., Ltd; 50×TAE buffer, DL 2000 DNA maker and nucleic acid electrophoresis dye were purchased from Tiangen Biochemical Co., Ltd; hydroxynaphthol blue (HNB) indicator was purchased from Haiji biological Co., Ltd. Eighteen strains of common foodborne pathogenic microorganisms used in this study were donated by the microbiology laboratory, Institute of zoonosis, Jilin University. Single colony of Bacteria cultured on tryptone soybean agar plate was inoculated into LB liquid medium at 37℃ for 12-16 h. The harvested bacteria were used for extraction of genomic DNA (gDNA) and stored at -20℃. The DNA extracted were used as templates in the later optimum reaction conditions and analyzing the sensitivity and specificity of LAMP.

LAMP primers design

Through pre experiment, entFM virulent gene of B. cereus was chosen to design the LAMP assay primers. Primers were designed using the special design software primer Explorer v4 software program (http:// primerexplorer.jp/elamp4.0.0/index.html). The LAMP primers were synthesized by Shanghai Biotechnology Co., Ltd. The primer sequences are shown in Table I.

Optimization of reaction conditions

25 μL LAMP reaction system was as follow: 1 μL Bst DNA Polymerase(8U), 2.5 μL 10× thermpol reaction buffer, outer primers (B3 and F3 0.2 μmol/L each), 1 μL genome template (gDNA) kept constant volume or concentration through the whole research. Concentration of betaine, Mg2+, dNTPs, inner primers (BIP and FIP), reaction time and temperature were optimized. The following changes were attempted to optimize the results. The condition of betaine ranged from 0 to 1.4 mol/L i.e. 0, 0.2, 0.4, 0.6, 0.8,1.0, 1.2, 1.4 mol/L. The condition range of Mg2 + was 1.0 ~ 8.0 mmol/L, i.e. 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0 mmol/L. dNTPs was optimized from 1.0 to 2.4, i.e. 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4 mmol/L. The test range of inner primers (each) were operated from 0.2 to 1.6 μmol/L, i.e. 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6 μmol/L. The reaction temperature ranged from 55 to 80 ℃ to find the optimum reaction temperature, i.e. 55, 60, 65, 70, 75, 80℃. The selection of reaction time ranged from 30 to 80 min, i.e. 30, 40, 50, 60, 70, 80 min. Finally, LAMP system was supplemented to 25 μL with sterilized ddH20.The LAMP experiments were repeated 3 times at least.

 

Table I. LAMP primers sequence.

Primer name

Primer sequence

Primer position α

F3

5’- GATACATCTTCAATCGCTGG -3’

3530994-3531013

B3

5’- GGAAGTATACTAAATCACCTGG -3’

3531204-3531183

FIP

5’- TGAATCCACTGCAATCAAAACCA

TTTT

TAAATGGTTCACCATACAGAACA -3’

3531090-3531068

Primer linked base

3531028-3531050

BIP

5’- TGGTCATAAAGGCGCTCGTC

TTTT

CTAGTTTTTGTTTTAGAGCTCCAG-3’

3531113-3531132

Primer linked base

3531172-3531149

 

α, according to the primers position marked by B. cereus entFM gene (GenBank accession No. CP 015589.1).

 

Specificity of LAMP assay

Genomic DNA of eighteen strains (Bacillus cereus (CGMCC 1.195, CMCC(B) 63303), Yersinia enterocolitica (CGMCC 52225), Vibrio prholyticus (CGMCC 1.1615), Candida albicans (ATCC 1.2258), Salmonella choleraesuls (CGMCC 1.1859), Corynebacterium glutamicum (CMCC(B)46117), Staphylococcus aureus (CMCC 1.2328), micrococcus lysodeikticus (CGMCC 1.634), Bacillus subtilis (CGMCC1.1630), Escherichia coli (CMCC 1.2385), Micrococcus luteus (CGMCC 1.193), Edwardsiella tarda (ATCC 15947), Salmonella paratyphosa (CMCC 50093), Salmonella typhi (CMCC 50071), Salmonella Schott (CMCC 50094), Salmonella gallinarum (CMCC 50118), Salmonella paratyphosa (CMCC 50093)) were used as templates to determine the specificity of LAMP reaction. Sterilized ddH20 instead of gDNA was taken into the LAMP assay as the negative control. After the reaction, the results were detected by 2% agarose gel electrophoresis to verify the accuracy and specificity of LAMP assay for detecting B. cereus.

Sensitivity of LAMP assay

Sensitivity of LAMP assay

Genomic DNA of B. cereus extracted in step 2.1 was determined the initial concentration of genome with BioTek take 3 microplate spectrophotometer under Gene 5 software. The initial gDNA was diluted with 10-fold gradient from 10-1 to 10-8 times with sterilized ddH20 and then performed in LAMP assay. The LAMP experiment was repeated 3 times at least, and reaction products were subjected to electrophoresis on 2.0% agarose gel.

Sensitivity of PCR assay

Referring to literature (Porcellato et al., 2016), A conventional PCR assay was performed to compare its sensitivity with the above LAMP assay. The primer sequences: Upstream: 5′-gctaaaaggtacttagcttagg-3′; downstream: 5′-tatatacattatgcgtcatcac-3′. The PCR reaction system (25 μL) included 2 × PCR Master Mix 12.5 μL, 0.2 μmol/L upstream primer, 0.2 μmol/L downstream primer, 1 μL gDNA, and finally supplemented to 25 μL with sterilized ddH20. The reaction condition was as follows: 94 for 5 min; 94 30 s, 57 30 s, 72 30s, 35 cycles; 72 7 min. At the end of the reaction, 2% gel electrophoresis was performed. The size of the amplified target fragment was 297 bp. The experiment was repeated 3 times at least.

The CFU limit of LAMP assay

The pure culture same as B. cereus initial gDNA was diluted with 10-fold gradient from 10-1 to 10-8. Through calculation, the colony detection limit of LAMP assay was obtained. The experimental procedure was repeated at least three times.

Artificial polluted samples detection by LAMP assay

Chilled chicken was bought in local supermarket and sterilized at 121 for 15min. 5 g chicken muscle were added into sterilized normal saline and homogenized, and the volume is finally kept at 100 mL. The limit of B. cereus CFU for LAMP assay was added into the chicken homogenate and extracted with the high purity gDNA template preparation kit. The optimized LAMP assay was used to detect the extracted gDNA. This step was repeated at least three times.

Visual dye hydroxynaphthol blue (HNB) used in LAMP assay

According to the color development principle of hydroxynaphthol blue (HNB) indicator, LAMP assay was established in 25uL including 2.5 μL10 × theromal buffer, 1 μL Bst DNA Polymerase(8U), 0.2 μmol/L external primers (each), 1μL gDNA, 5 μL HNB solution, and the above optimized conditions. Finally, sterilized ddH2O was supplied to 25 μL in LAMP assay. At the end of the reaction, 2% gel electrophoresis was performed. This part of the experiment was repeated at least three times.

Results

Optimization of reaction conditions

It can be known from the specific ladder strips that the LAMP reaction is ideal. The designed primers for the entFM gene can specifically and accurately identify the B. cereus. The optimum amount of betaine was 1.0 mol/L. Mg2+ was optimized as 6 mmol/L. And the optimal concentration of dNTPs was 1.4 mmol/L. The concentration of inner primer was chosen as1.6 μmol/L, so the rate between external and inner primers is 1:8. The optimized temperature and time was respectively 65°C and 60 min.

Specific results of LAMP assay

Only 2 strains of B. cereus were positive results (Fig. 1), so it can be inferred that the LAMP assay established in this study for the detection of B. cereus has high specificity.

Sensitivity of LAMP assay

The initial concentration of gDNA extracted from B. cereus was 75.5ng/μL. The results showed that the detection limit of LAMP assay was 7.5×10-4 ng/μL (0.755pg/mL, Fig. 2A). The detection limit of conventional PCR assay was 7.5×10-2 ng/μL (75.5pg/ μL Fig. 2B), it can be seen that LAMP assay were 102 times higher sensitivity than conventional PCR.

 

 

The CFU limit of LAMP assay

According to the colony count of 10-8 times diluted B. cereus culture medium plate (Fig. 3), the CFU was 14 CFU/mL. So the limit of LAMP assay was 14×103 CFU/ mL.

LAMP assay detection of manually spiked contaminated samples

When LAMP assay was operated for detection of manually spiked samples, a short time enrichment process is needed. The results are shown in Figure 4, obvious amplification bands were at 45 min and 60 min. Therefore, the enrichment time is at least 45 min, so that the LAMP assay can detect B. cereus in meat.

 

 

 

Visual dye HNB used in LAMP assay

As it showed in Figure 5A, the positive result was observed as watched with naked eye and the negative one is navy blue. In Figure 5B, the 2% nucleic acid gel electrophoresis showed that HNB positive result had a specific band on the imager.

Discussion

The spore produced by B. cereus is an important factor leading to foodborne diseases. The spore has strong resistance to high temperature, drying, ultraviolet, ionizing radiation, toxic chemicals and other disinfection methods. It has been reported that spores of B. cereus are successfully revived from amber with a history of 25-40 million years and salt water with a history of 250 million years (Sagripanti et al., 2007; Henriques and Moran, 2007). The spores of some kind of B. cereus are more heat-resistant than those of thermophilic Bacillus subtilis and Bacillus licheniformis, so B. cereus can withstand more procedures in cooking food. Therefore, the characteristic of B. cereus that is difficult to sterilize is the main reason why it is easy to cause food pollution and disease (Dun et al., 2009).

As an important foodborne pathogenic microorganism, B. cereus mainly infects people with immune deficiency, such as the elderly, children, newborns and so on. It may cause bacteremia, endocarditis, meningitis and human eye diseases (Jessberger et al., 2020; Huang et al., 2020).

Yan et al. (2015) from National food safety risk assessment center in China researched that B. cereus was detected in 57 of 135 infant formula milk powder, and 24 strains of B. cereus were extracted. Among the 24 strains, the proportion of B. cereus with nhe gene was 92.98% (53/ 57), followed by entFM gene (71.93%). The proportion of the above two (nhe and entFM) virulent genes is 70.18%. According to the Blast (n) function in NCBI website, it is found that nhe gene has high homology with Bacillus anthracis, Salmonella and other kind of bacteria. At the same time, we found that the specificity of LAMP primers designed from nhe gene was poor. The entFM virulent gene of B. cereus has high specific without homology with other bacteria.

Conclusions

A LAMP assay is established for detection of Bacillus cereus in manually spiked contaminated samples. The optimized LAMP assay is as follow: 1.0 mol/L betaine, 6 mmol/L Mg2+, 1.4 mmol/L dNTPs, 1.6 μmol/L inner primers (BIP and FIP, each), 0.2 μmol/L outer primers (B3 and F3, each), 2.5 μL 10×thermpol reaction buffer, 1 μL Bst DNA Polymerase (8U/μL), 65 incubating 60 min, filled up with ddH2O to 25uL. 2 strains of Bacillus cereus in 18 strains common foodborne pathogenic were positive result by LAMP assay. The detection limit of Bacillus cereus gDNA was 0.755 pg/μL which was 100 times more sensitive than conventional PCR assay. The CFU limit of LAMP assay is 14×103 CFU/mL. The artificial pollution samples can be detected by LAMP with 45 min enrichment time. Hydroxynaphthol blue (HNB) is successfully applied in this experiment, and satisfactory results are obtained.

Acknowledgments

This study was supported by the College Cultivation Science and Technology Plan of Jiangsu Vocational College of Agriculture and Forestry, China (2019kj029, 2021kj34); China Postdoctoral Science Foundation, China (2019M662408); the natural science research project of Jiangsu Province, China (18KJB230001); the Science and Technology Development Project of Jilin Province, China (20200402059NC). We thank Professor Ren Hong-lin from the microbiology laboratory, Institute of zoonosis, Jilin University for the donation and useful suggestions and ideas.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Babu, U.S., Harrison, L.M., Mammel, M.K., Bigley. E.C., Hiett, K.L., and Balan, K.V., 2020. A loop-mediated isothermal amplification (LAMP) assay for the consensus detection of human pathogenic Campylobacter species. J. Microbiol. Meth., 176: 106009. https://doi.org/10.1016/j.mimet.2020.106009

Deng, Y.L., Liu, Y.Q., Jiang, Z.B., Wang, J.X., Zhang, Q., Qian, Y.Q., Yuan, Y., Zhou, X.Y., Fan, L.F., and Li, Y.F., 2020. A multiplex loop-mediated isothermal amplification assay for rapid detection of Bacillus cereus and Staphylococcus aureus. Biosci. Trends, 13: 510- 515. https://doi.org/10.5582/bst.2019.01267

Dun, Y.H., Zhao, G.F., and Zheng, Q.W., 2009. Research status of emetic toxin of Bacillus cereus. Fd. Sci., 30: 259-263.

Henriques, A.O., and Moran, C.P.Jr., 2007. Structure, assembly, and function of the spore surface layers. Annu. Rev. Microbiol., 61: 555-588. https://doi.org/10.1146/annurev.micro.61.080706.093224

Horiuchi, S., Nakano, R., Nakano, A., Hishiya, N., Uno, K., Suzuki, Y., Tanouchi, A., Kakuta, N., Masui, T., Jojima, N., and Yano, H., 2019. Development of a loop-mediated isothermal amplification assay for rapid Helicobacter pylori detection. J. Microbiol. Meth., 163: 105653. https://doi.org/10.1016/j.mimet.2019.105653

Huang, Y.Y., Flint, S.H., and Palmer, J.S., 2020. Bacillus cereus spores and toxins. The potential role of biofilms. Fd. Microbiol., 90: 103493. https://doi.org/10.1016/j.fm.2020.103493

Incili, G.K., Koluman, A., Aktüre, A., and Ataşalan, A., 2019. Validation and verification of LAMP, ISO, and VIDAS UP methods for detection of Escherichia coli O157:H7 in different food matrices. J. Microbiol. Methods, 165: 105697. https://doi.org/10.1016/j.mimet.2019.105697

Jessberger, N., Dietrich, R., Granum, P.E., and Märtlbauer, E., 2020. The Bacillus cereus food infection as multi-factorial process. Toxins (Basel), 12: 701. https://doi.org/10.3390/toxins12110701

Li, Q., Xie, G., Wang, Y., Aguilar, Z.P., and Xu, H.Y., 2021. Vancomycin-modified poly-l-lysine magnetic separation combined with multiplex polymerase chain reaction assay for efficient detection of Bacillus cereus in milk. J. Dairy Sci., 104: 1465-1473. https://doi.org/10.3168/jds.2020-18962

Liu, W., Yuan, C., Zhang, L., and Feng, Y., 2019. Development of isothermal amplification methods for rapid and sensitive detection of heat-labile enterotoxin producing Escherichia coli. J. Microbiol. Meth., 161: 47-55. https://doi.org/10.1016/j.mimet.2019.04.010

Mu, X.Q., Liu, B.B., Hui, E., Huang, W., Yao, L.C., Duo, L.B., Sun, W.Y., Li, G.Q., Wang, F.X., and Liu, S.L., 2016. A rapid loop-mediated isothermal amplification (LAMP) method for detection of the macrolide–streptogramin type B resistance gene msrA in Staphylococcus aureus. J. Glob. Antimicrob. Resist., 7: 53-58. https://doi.org/10.1016/j.jgar.2016.07.006

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., and Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucl. Acids Res., 28: E63. https://doi.org/10.1093/nar/28.12.e63

Porcellato, D., Narvhus, J., and Skeie, S.B., 2016. Detection and quantification of Bacillus cereus group in milk by droplet digital PCR. J. Microbiol. Meth., 127: 1-6. https://doi.org/10.1016/j.mimet.2016.05.012

Sagripanti, J.L., Carrera, M., Insalaco, J., Ziemski, M., Rogers, J., and Zandomeni, R., 2007. Virulent spores of Bacillus anthracis and other Bacillus species deposited on solid surfaces have similar sensitivity to chemical decontaminants. J. appl. Microbiol., 102: 11-21. https://doi.org/10.1111/j.1365-2672.2006.03235.x

Sheet, O.H., Grabowski, N.T., Klein, G., and Abdulmawjood, A., 2016. Development and validation of a loop mediated isothermal amplification (LAMP) assay for the detection of Staphylococcus aureus in bovine mastitis milk samples. Mol. Cell Probes., 30: 320-325. https://doi.org/10.1016/j.mcp.2016.08.001

Stenfors, A.L.P., Fagerlund, A., and Granum, P.E., 2008. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev., 32: 579-606. https://doi.org/10.1111/j.1574-6976.2008.00112.x

Sun, L., Ji, X.H., Zhang, Z.W., and Yang, H., 2016. Contamination status and experimental study of Bacillus cereus in box lunch on EMU trains administrated by Xi’an Railway Bureau from 2014-2015. Occup. Hlth., 32: 2649-2653.

Tallent, S.M., Hait, J.M., and Bennett, R.W., 2015. Analysis of Bacillus cereus toxicity using PCR, ELISA and a lateral flow device. J. appl. Microbiol., 118: 1068-1075. https://doi.org/10.1111/jam.12766

Xu, Y.M., Liu, X.L., Ma, J., Huang, W., Yao, L.C., Duo, L.B., Sun, W.Y., Li, G.Q., Wang, F.X., and Liu, S.L., 2014. Simple, specific, sensitive and rapid loop-mediated method for detecting Yersinia enterocolitica. Southeast Asian J. Trop. Med. Publ. Hlth., 45: 670-679.

Yan, S.F., Yan, X., Gan, X., Li, Z.G., Yu, D.M., Zhao, X., and Li, F.Q., 2015. Survey on contamination of Bacillus cereus and its virulence gene profiles isolated from retail infant formula in China. Chinese J. Fd. Hyg., 27: 286-291.