YAP/TAZ Pathway Promoted the Trastuzumab Resistance in HER2-Positive Breast Cancer

Wei Wang1, Meifeng Zhou2, Yuebo Liang1, Fan Zhang1, Zhong Wu3, Shaowei Mo4* and Yi Qing Wang1*

1Department of General Surgery, Hainan General Hospital, Hainan Medical University, Haikou, Hainan, China

2Department of Medical Oncology, Hainan General Hospital (Hainan Affiliated Hospital of Hainan Medical University), Haikou 570311, Hainan, China

3Department of General Surgery, Hainan Maternal and Child Health Medical Center, Haikou, Hainan, China.

4Department of Sicience and Education, Hainan Maternal and Child Health Medical Center, Haikou, Hainan, China.

Wei Wang and Meifeng Zhou contributed equally to this article.

ABSTRACT

The developed resistance of trastuzumab remained a problem for clinical therapy of HER2-positive breast cancer. However, effects of YAP/TAZ pathway on resistance of trastuzumab have not been explored. Tumor tissues were collected from 40 breast cancer patients for clinical studies. For in vitro studies, human breast cancer cell lines SK-BR-3-TS was obtained, and trastuzumab resistant model SK-BR-3-TR was constructed. Cell viability was determined using MTT assay. Cell apoptosis was analyzed by flow cytometry. Protein and mRNA expression was measured using western blotting and RT-qPCR, respectively. The mRNA and protein level of YAP was significantly increased in the tumor tissues of HER2-positive breast cancer patients. Consistently, the expression of YAP and TAZ were both dramatically upregulated in SK-BR-3-TR cells. The cell viability was increased, while cell apoptosis was inhibited in SK-BR-3-TS cells compared with SK-BR-3-TS. The depletion of YAP by si-YAP reversed the YAP/TAZ expression, cell viability and cell apoptosis in SK-BR-3-TR cells. YAP/TAZ pathway might induce the trastuzumab resistance in HER2-positive breast cancer and targeting YAP would be an alternative way for the clinical therapeutic methods of HER2 positive breast cancer.


Article Information

Received 30 June 2022

Revised 18 July 2022

Accepted 01 August 2022

Available online 14 April 2023

(early access)

Published 04 September 2023

Authors’ Contribution

WW and MZ conceived and designed experiments, performed experiments and data analysis, and wrote the manuscript. YL, FZ, ZW, SM and YQW provided technical support, data collection and analysis. All authors provided final approval for submitted and published version.

Key words

HER2-positive breast cancer, Trastuzumab resistance, YAP/TAZ

DOI: https://dx.doi.org/10.17582/journal.pjz/20220630020601

* Corresponding author: [email protected], [email protected]

0030-9923/2023/0005-2391 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Breast cancer has been regarded as one of the cancers that caused significant morbidity and mortality in female (Akram et al., 2017). It was estimated that the 5-year survival rate was 80% in developed countries, whereas that was only 40% for developing countries (Coleman et al., 2008). Human epidermal growth factor receptor 2 (HER2) belonged to HER family, whose expression was demonstrated to be increased in around 20% breast cancer and associated with aggressive cancers and disease recurrence (Kunte et al., 2020). Trastuzumab has been identified as a monoclonal antibody, which could target against the extracellular domain of the HER2 receptor, and chemotherapy combined with trastuzumab was the standard therapeutic methods for the early-stage therapy of breast cancer in the past few decades (Zhang, 2021). However, it was reported that only a small part of metastatic patients was responded to trastuzumab, and around 60% of them developed resistance (Han et al., 2020). Therefore, investigations on the mechanisms regarding resistance occurrence and approaches to reducing resistance are of vital importance.

YAP was identified as a 65 kDa protein that contained transcriptional activation domain and TEAD binding domain, and the sequence identity between TAZ and YAP was 50% (Reuven et al., 2019). The domains of YAP/TAZ played various biological roles in the cellular processes of tumorigenesis. The transcriptional co-activators YAP/TAZ could be regulated by multiple upstream signals, of which Hippo pathway accounted for a main part (Zhao et al., 2010). Previous studies also revealed that YAP/TAZ pathway participated in the proliferation and adhesion of breast cancer (Zhao et al., 2021). Recent studies indicated that YAP was able to induce cisplatin resistance through cellular autophagy and could mediate paclitaxel resistance in ovarian cancer cells (He et al., 2019; Xiao et al., 2016). However, the relations of YAP and trastuzumab resistance has not been comprehensively explored in breast cancer.

In the present study, we hypothesized that the YAP/TAZ pathway could induce the trastuzumab resistance in HER2-positive breast cancer. The clinical tissues were collected, and the expression of YAP were detected. Moreover, the drug-resistant cell model was established for in vitro verifications. With the deepening understanding of the biological behavior of breast cancer and the transformation and updating of the treatment concept, this study is expected to provide new ideas for the mechanism of acquired drug resistance in breast cancer.

Materials and Methods

Clinical studies

The frozen tumor tissues and the adjacent tissues were collected from 40 breast cancer patients. The experiments obtained the informed consent of all the patients. The study was performed as per the guidelines of the committee and the declaration of Helsinki. All the clinical experiments were approved by the Ethics Committee of the Hainan General Hospital, Hainan Medical University.

Cell culture

The human breast cancer cell lines SK-BR-3-TS was obtained from American Type Culture Collection (ATCC, USA). The cells were cultured in cultured in Roswell Park Memorial Institute (RPMI, Gibco, USA) media containing 10% fetal bovine serum and 1% penicillin/streptomycin. For construction of trastuzumab resistant models, cells at logarithmic growth phase were collected, after which 0.5 μg/ml (10 times of 50% inhibition concentration) trastuzumab (Roche, Shanghai, China) was added into complete medium. Subsequently, the concentration of trastuzumab was added (0.5, 1, 2, 4, 6 to 8 μg/ml), and the SK-BR-3-TR cells were collected when cells stably grew in medium containing 8 μg/ml trastuzumab. For further experiments, cells were maintained in medium containing 4 μg/ml trastuzumab. All the cells were incubated in a 5% CO2 humidified incubator at 37°C.

Cell transfection

For constructing the knockdown model of YAP, si-YAP was synthesized by GenePharma Co., Ltd. (Shanghai, China). Cell transfection was performed when the confluence of cells reached 90% using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) as per the protocol of manufacturer.

Cell viability

MTT assay was employed for measurement of cell viability. Briefly, cells were seeded into 96-well plates at a density of 5×103 cells/well and then treated under various conditions for 48 h. After three PBS washes, the cells were treated with MTT solution (0.1 mg/ml, Solarbio, Beijing, China) as per the protocol of manufacturer and incubated for 4 h at 37°C. The absorbance was detected at 570 nm by a microplate reader (Bio-Tek, Norcross, GA, USA).

Cell apoptosis

The cell apoptosis was determined by flow cytometer analysis. Briefly, cells were seeded into 6-well plates at a density of 2.5×105 cells/well and then treated under various conditions for 48 h. After three PBS washes, the cells were treated with Annexin V-FITC/PI apoptosis detection kit (BD Bioscience, USA) as per the manufacturer’s instructions. Briefly, cells were suspended with 100 μL 1×Binding Buffer and 5 μL Annexin V solutions and incubated for 5 min at room temperature, after which cells were centrifugated at 1000 rpm for 5 min and resuspended with 10 μL propidium iodide and 190 μL buffer. The double-stained cells were analyzed by a flow cytometer (Thermo Scientific, Waltham, MA, USA).

RT-qPCR

Total RNA was extracted from cells by TRIzol reagent (Life Technologies, Carlsbad, CA, USA). Then the cDNA was synthesized using Prime Script reverse transcription reagent kit (TaKaRa, Japan). RT-qPCR were performed with quantitative fluorescent PCR kit (Cwbiotech, Beijing, China) and performed on ABI Prism system (Applied Biosystems, USA). The relative expressions of mRNA were measured using 2−ΔΔCt method via normalization to GAPDH. The primers were list as follows:

YAP-F: 5’- CCTTCTTCAAGCCGCCGGAG -3’

5’- CAGTGTCCCAGGAGAAACAGC -3’

TAZ-F: 5’- TATCCCAGCCAAATCTCGTG -3’

5’- TTCTGCTGGCTCAGGGTACT -3’

GAPDH-F: 5’- TCAAGAAGGTGGTGAAGCAGG - 3’

5’- TCAAAGGTGGAGGAGTGGGT -3’

Western blotting

Total protein was extracted from cells using using RIPA buffer (Sigma-Aldrich, USA) that supplemented with protease (1:100) and phosphatase (1:100) inhibitors. The concentration was determined using the BCA Assay Kit (Beyotime, Shanghai, China). The samples were separated by SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Massachusetts, USA). The nonfat milk was obtained for blocking at room temperature for 1 h. Then the membrane was incubated with primary antibodies that included anti-YAP (Abcam, ab52771, 1:1000), anti-TAZ (Abcam, ab110239, 1:1000) and anti-GAPDH (Abcam, ab8245, 1:1000). Then the samples were incubated with horseradish peroxidase-conjugated secondary antibody (Abcam, ab6721 1:1000) for 2 h at room temperature.

Statistical analysis

All data were expressed as means ± standard derivation (SD). GraphPad Prism 8 was used for statistical analysis. Student’s t tests were used for comparisons between two groups. One-way ANOVA analysis was performed for comparisons among multiple groups. P-values < 0.05 were considered to indicate statistically significant results.

 

Results

The analysis on clinical tissues revealed that the mRNA (Fig. 1A) and protein (Fig. 1B) level of YAP was dramatically upregulated in the tumor tissues compared with adjacent tissues in HER2-positive breast cancer patients. Consistently, the in vitro experiments showed that the mRNA (Fig. 2A) and protein (Fig. 2B) level of YAP and TAZ were dramatically upregulated in SK-BR-3-TR cells compared with SK-BR-3-TS. Moreover, MTT assay indicated that the cell viability was increased (Fig. 3A), while flow cytometry results (Fig. 3B) proved that cell apoptosis was inhibited in SK-BR-3-TR cells compared with SK-BR-3-TS. For elucidating the role of YAP, the depletion of YAP was achieved by transfection of si-YAP. The protein level of YAP and TAZ was downregulated after transfection of si-YAP (Fig. 4A), indicating the successful construction of YAP knockdown model. The cell apoptosis rate was enhanced after transfection of si-YAP (Fig. 4B), and the cell viability was decreased in si-YAP group (Fig. 4C). The above results suggested that inhibition of YAP might alleviate the tumor processes of trastuzumab resistant HER2-positive breast cancer cells.

 

Discussion

HER2 was reported to be overexpressed in around 20% of breast cancers, which contributed to increased clinical behavior (Guarneri et al., 2010; Zimmer et al., 2022). The poor prognosis has always been an important problem for patients with breast cancer till the availability of HER2-directed monoclonal antibodies (Hudis, 2007). The diagnosis and treatment of HER2 positive breast cancer was considerably changed in the past few decades, and the

 

 

standard for the HER2 positive breast cancer patients at the metastatic stage was dual antibody therapy that included pertuzumab and trastuzumab (Indini et al., 2021; Kunte et al., 2020). Although the HER2 positive targeted drugs achieved successful in extending the overall survival of patients, the developed drug resistance remained a major clinical problem. The multiple reagents that targeted HER2 truncation or PI3K pathway activation has been used clinically in combination with trastuzumab to decrease the effects of trastuzumab-resistance (Hunter et al., 2020). Moreover, it was reported that trastuzumab-resistance could be reversed by combination therapy with small-molecule inhibitors of multidrug-resistance transporters (Gottesman and Pastan, 2015). However, because of the high expression of efflux transporters in tumor tissues, the inhibitors were rarely applicated in clinical therapy. The present study investigated the molecular mechanisms for trastuzumab-resistance in HER2 positive breast cancer, aiming at providing new clinical therapeutic targets.

Transcriptional co-activators YAP and TAZ could interact with transcription factors and further regulated the cis-regulatory elements, which was essential for cancer progression and tumor metastasis (Cai et al., 2021; Zanconato et al., 2016). It was reported that the upregulated YAP/TAZ was positively correlated with the poor histological status and metastasis proclivity in tumor tissues of breast cancer patients (Zanconato et al., 2015). Chen et al. (2014) also demonstrated that transgenic expression of HER2 significantly activated YAP/TAZ signaling pathway in mouse mammary gland (Chen et al. 2014). Consistently, the present study indicated that the expression of YAP was dramatically increased in tumor tissues compared with adjacent tissues in HER2-positive breast cancer patients. Gao et al. reported that YAP/TAZ signaling positively regulated the expression of SLC7A11, which belonged to key transporters that maintained homeostasis of intracellular glutathione, and increased cell resistance to sorafenib (Gao et al., 2021). In lung cancer cells, the expression of YAP was upregulated, and the increased YAP level was positively correlated with the enhanced cisplatin resistance, while depletion of YAP effectively sensitized the cells to cisplatin treatment (Song et al., 2018). Moreover, a previous study found silencing of YAP inhibited tumor growth and increased responsiveness of parental cells to ALK tyrosine kinase inhibitors that used for clinical treatment of lung cancer (Yun et al., 2019). It was reported that nuclear YAP/TAZ was able to bind to the TEAD family of transcription factors, which further activated the down streaming pro-proliferative and survival enhancing gene programs (Cunningham and Hansen, 2022). In this study, we newly reported that YAP/TAZ might affect the resistance of HER2 positive breast cancer cells to trastuzumab. The depletion of YAP significantly increased apoptosis rate and decreased cell viability of SK-BR-3-TR cells.

In conclusion, the present study elucidated that YAP/TAZ pathway might induce the trastuzumab resistance in HER2-positive breast cancer and targeting YAP would be an alternative way for the clinical therapeutic methods of HER2 positive breast cancer. However, further in vivo investigations and clinical studies are needed to comprehensively understand and verify the role of YAP/TAZ signaling in trastuzumab resistance in HER2-positive breast cancer. The down streaming pathways of YAP/TAZ signaling in trastuzumab resistance also needs further exploration.

Acknowledgements

We would like to acknowledge the everyone for their helpful contributions on this paper.

DECLARATIONS

Ethics approval and consent to participate

The ethic approval was obtained from the Ethic Committee of Hainan General Hospital, Hainan Medical University and written informed consent was obtained from all patients.

Consent to publish

All of the authors have Consented to publish this research.

Availability of data and materials

The data are free access to available upon request.

Competing interests

All authors declare no conflict of interest.

Funding

Hainan Provincial Natural Science Foundation of China (No. 820MS139).

References

Akram, M., Iqbal, M., Daniyal, M., and Khan, A.U., 2017. Awareness and current knowledge of breast cancer. Biol. Res., 50: 33. https://doi.org/10.1186/s40659-017-0140-9

Cai, X., Wang, K.C., and Meng, Z., 2021. Mechanoregulation of YAP and TAZ in cellular homeostasis and disease progression. Front. Cell Dev. Biol., 9: 673599. https://doi.org/10.3389/fcell.2021.673599

Chen, Q., Zhang, N., Gray, R.S., Li, H., Ewald, A.J., Zahnow, C.A., and Pan, D., 2014. A temporal requirement for Hippo signaling in mammary gland differentiation, growth, and tumorigenesis. Genes Dev., 28: 432-437. https://doi.org/10.1101/gad.233676.113

Coleman, M.P., Quaresma, M., Berrino, F., Lutz, J.M., De Angelis, R., Capocaccia, R., Baili, P., Rachet, B., Gatta, G., Hakulinen, T., Micheli, A., Sant, M., Weir, H.K., Elwood, J.M., Tsukuma, H., Koifman, S., GA, E.S., Francisci, S., Santaquilani, M., Verdecchia, A., Storm, H.H., and Young, J.L., 2008. Cancer survival in five continents: A worldwide population-based study (CONCORD). Lancet Oncol., 9: 730-756. https://doi.org/10.1016/S1470-2045(08)70179-7

Cunningham, R., and Hansen, C.G., 2022. The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin. Sci. (London), 136: 197-222. https://doi.org/10.1042/CS20201474

Gao, R., Kalathur, R.K.R., Coto-Llerena, M., Ercan, C., Buechel, D., Shuang, S., Piscuoglio, S., Dill, M.T., Camargo, F.D., Christofori, G., and Tang, F., 2021. YAP/TAZ and ATF4 drive resistance to Sorafenib in hepatocellular carcinoma by preventing ferroptosis. EMBO Mol. Med., 13: e14351. https://doi.org/10.15252/emmm.202114351

Gottesman, M.M., and Pastan, I.H., 2015. The role of multidrug resistance efflux pumps in cancer: Revisiting a JNCI publication exploring expression of the MDR1 (P-glycoprotein) gene. J. natl. Cancer Inst., 107. https://doi.org/10.1093/jnci/djv222

Guarneri, V., Barbieri, E., Dieci, M.V., Piacentini, F., and Conte, P., 2010. Anti-HER2 neoadjuvant and adjuvant therapies in HER2 positive breast cancer. Cancer Treat. Rev., 36 (Suppl 3): S62-66. https://doi.org/10.1016/S0305-7372(10)70022-0

Han, M., Gu, Y., Lu, P., Li, J., Cao, H., Li, X., Qian, X., Yu, C., Yang, Y., Yang, X., Han, N., Dou, D., Hu, J., and Dong, H., 2020. Exosome-mediated lncRNA AFAP1-AS1 promotes trastuzumab resistance through binding with AUF1 and activating ERBB2 translation. Mol. Cancer, 19: 26. https://doi.org/10.1186/s12943-020-1145-5

He, J., Shi, X.Y., Li, Z.M., Pan, X.H., Li, Z.L., Chen, Y., Yan, S.J., and Xiao, L., 2019. Proton pump inhibitors can reverse the YAP mediated paclitaxel resistance in epithelial ovarian cancer. BMC Mol. cell. Biol., 20: 49. https://doi.org/10.1186/s12860-019-0227-y

Hudis, C.A., 2007. Trastuzumab mechanism of action and use in clinical practice. N. Engl. J. Med., 357: 39-51. https://doi.org/10.1056/NEJMra043186

Hunter, F.W., Barker, H.R., Lipert, B., Rothé, F., Gebhart, G., Piccart-Gebhart, M.J., Sotiriou, C., and Jamieson, S.M.F., 2020. Mechanisms of resistance to trastuzumab emtansine (T-DM1) in HER2-positive breast cancer. Br. J. Cancer, 122: 603-612. https://doi.org/10.1038/s41416-019-0635-y

Indini, A., Rijavec, E., and Grossi, F., 2021. Trastuzumab deruxtecan: Changing the destiny of HER2 expressing solid tumors. Int. J. mol. Sci., 22. https://doi.org/10.3390/ijms22094774

Kunte, S., Abraham, J., and Montero, A.J., 2020. Novel HER2-targeted therapies for HER2-positive metastatic breast cancer. Cancer, 126: 4278-4288. https://doi.org/10.1002/cncr.33102

Reuven, N., Shanzer, M., and Shaul, Y., 2019. Hippo pathway regulation by tyrosine kinases. Methods mol. Biol., 1893: 215-236. https://doi.org/10.1007/978-1-4939-8910-2_17

Song, J., Xie, L.X., Zhang, X.Y., Hu, P., Long, M.F., Xiong, F., Huang, J., and Ye, X.Q., 2018. Role of YAP in lung cancer resistance to cisplatin. Oncol. Lett., 16: 3949-3954. https://doi.org/10.3892/ol.2018.9141

Xiao, L., Shi, X.Y., Zhang, Y., Zhu, Y., Zhu, L., Tian, W., Zhu, B.K., and Wei, Z.L., 2016. YAP induces cisplatin resistance through activation of autophagy in human ovarian carcinoma cells. Oncol. Targets Ther., 9: 1105-1114. https://doi.org/10.2147/OTT.S102837

Yun, M.R., Choi, H.M., Lee, Y.W., Joo, H.S., Park, C.W., Choi, J.W., Kim, D.H., Kang, H.N., Pyo, K.H., Shin, E.J., Shim, H.S., Soo, R.A., Yang, J.C., Lee, S.S., Chang, H., Kim, M.H., Hong, M.H., Kim, H.R., and Cho, B.C., 2019. Targeting YAP to overcome acquired resistance to ALK inhibitors in ALK-rearranged lung cancer. EMBO Mol. Med., 11: e10581. https://doi.org/10.15252/emmm.201910581

Zanconato, F., Cordenonsi, M., and Piccolo, S., 2016. YAP/TAZ at the roots of cancer. Cancer Cell, 29: 783-803. https://doi.org/10.1016/j.ccell.2016.05.005

Zanconato, F., Forcato, M., Battilana, G., Azzolin, L., Quaranta, E., Bodega, B., Rosato, A., Bicciato, S., Cordenonsi, M., and Piccolo, S., 2015. Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers drives oncogenic growth. Nat. Cell Biol., 17: 1218-1227. https://doi.org/10.1038/ncb3216

Zhang, L., 2021. Ecological agriculture development under the guidance of digital economy. Creat. Econ., 5: 85-92. https://doi.org/10.1101/gad.1843810

Zhao, B., Li, L., Tumaneng, K., Wang, C.Y., and Guan, K.L., 2010. A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP). Genes Dev., 24: 72-85.

Zhao, W., Wang, M., Cai, M., Zhang, C., Qiu, Y., Wang, X., Zhang, T., Zhou, H., Wang, J., Zhao, W., and Shao, R., 2021. Transcriptional co-activators YAP/TAZ: Potential therapeutic targets for metastatic breast cancer. Biomed. Pharmacother., 133: 110956. https://doi.org/10.1016/j.biopha.2020.110956

Zimmer, A.S., Van Swearingen, A.E.D., and Anders, C.K., 2022. HER2-positive breast cancer brain metastasis: A new and exciting landscape. Cancer Rep. (Hoboken), 5: e1274. https://doi.org/10.1002/cnr2.1274