DNA Markers Based Genetic Polymorphism in Natural Populations of Channa marulius
Mamona Jabeen1, Sumra Naz1, Hina Amjad1, Khalid Abbas1*, Sajid Abdullah1, Muhammad Anjum Zia2, Taqwa Safdar1 and Muhammad Sarfraz Ahmed1
1Department of Zoology, Wildlife and Fisheries, University of Agriculture, Faisalabad-38040, Pakistan
2Department of Biochemistry, University of Agriculture, Faisalabad-38040, Pakistan
ABSTRACT
Characterization of freshwater fish species using molecular markers is important for their management regarding the evaluation of the potential genetic effects induced by anthropogenic interventions. The genetic variability among five natural populations of Channa marulius was studied by using five microsatellite loci in a total of 150 individuals. The C. marulius population exhibited a moderate level of heterozygosity. The mean value of observed heterozygosity ranged between 0.700 – 0.833 while the expected heterozygosity varied between 0.863 – 0.868. Significant deviation from HWE (P<0.05) was observed in all the populations due to the deficits of heterozygotes suggesting either due to inbreeding or recent mixing of stocks. AMOVA revealed that the majority of the variation (77.21%) lied within the individuals than among the individuals within populations (15.48%). The UPGMA dendrogram based on Nei’s genetic distance revealed that the C. marulius population was divided into two major clusters. This study would be helpful to underpin the causes of decline in genetic diversity of C. marulius and provide significant guidelines over the effective management and conservation strategies for sustainable fisheries of Channa species in Pakistan.
Article Information
Received 12 August 2021
Revised 05 May 2022
Accepted 18 May 2022
Available online 08 September 2022
(early access)
Published 29 September 2023
Authors’ Contribution
KA designed the idea and research layout. MJ conducted different experiments/laboratory work and wrote manuscript. SN, HA, TS and MSA assisted in experiments handling, results interpretation and technically monitor the experiments. SA and MAZ were members of supervisory committee and facilitated the author in conducting the research work.
Key words
Genetic polymorphism, DNA markers, natural populations, Catfish species, Genetic distance
DOI: https://dx.doi.org/10.17582/journal.pjz/20210812100840
* Corresponding author: [email protected]
030-9923/2023/0006-2587 $ 9.00/0
Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Genetic diversity provides the basis for the survival of fish species as it develops the potential to protect themselves against the risk of extinction in ever changing environmental conditions (Ashley et al., 2003; Banerjee et al., 2008). Loss of genetic variability leads to the loss of fitness in relation to vigor, fixation of genes and disease resistance causing ultimate extinction of native populations. During last several decades, human interventions like pollution, hydrological alterations, overfishing, exotic species introduction and environmental threats such as climatic changes and floods are the major elements that interrupt the survival of fish species in natural systems (Vandewoestijne et al., 2008).
The genetic variability of commercial fish species is devastated due to inbreeding, poor broodstock management and lack of genetic characterization. For maintenance of genetic integrity, the conservation of allelic variation is necessary for maintaining the evolutionary potential in natural populations to adapt the environmental changes as well as for captive stocks to make sure the improvement of beneficial traits (Perrier et al., 2011). To refrain from genetic decline resulting from over exploitation, environmental fluctuations and natural mortality, monitoring of genetic structure of the riverine fisheries stock on regular basis is critical (Islam et al., 2005).
The fish Channa marulius (Indian snakehead or sol) is a potential aquaculture fish species native to Indo-Pakistan sub-continent, better adapted to low dissolved oxygen and has a commercial value (Bhatti, 2012). The C. marulius population in riverine systems of Punjab has been threatened by a number of factors but genetic variability of this species is facing a continuous decline primarily as a result of anthropogenic interventions along with impoundment of rivers, habitat destruction, deterioration of water quality and overharvesting (Frankham, 2003). These interruptions have resulted in loss of breeding, spawning and nursing grounds for fish in natural water bodies. Moreover, construction of dams interrupts the migration patterns of this species and thus interferes with their life cycles (Agosthinho et al., 2008).
Molecular markers have become valuable tools in conservation biology, population genetics and evolutionary studies (Liu and Cordes, 2004). These markers are used to measure the effective population size (Cheng et al., 2010), historical bottlenecks and sex specific gene flow (Kucuktas et al., 2009). However, appropriate marker selection is beneficial to determine the genetic variation that is essential for any population genetic study (Sunnucks, 2000). Among the available molecular markers, microsatellite DNA is a reliable marker because of its unique characteristics including a high rate of mutation, wide distribution in coding as well as non-coding regions of DNA, and a quick detection protocol. These markers could be used in fisheries for individual identification, broodstock management, marker assisted breeding programs and to construct the genetic linkage map (Chistiakov et al., 2006).
With the decreasing flow of River Ravi and ecological alterations due to prolonged dry periods coupled with overharvesting has led to decline in fisheries resources. In Pakistan, very little work was done on stocks management and population differentiation based on molecular approaches and there is a dire need to comprehend the changes in genetic diversity of fish populations of River Ravi. Keeping in view the current situations, this study is planned to monitor the status of fish C. marulius in natural reservoirs as influenced by some environmental fluctuations and other unknown factors.
Materials and methods
Sampling of fish and DNA extraction
A total of 150 samples of C. marulius were collected from different sites of River Ravi, Punjab including Head Balloki (HB), Head Punjnad (HP), Head Sidhnai (HS), Sidhnai-Mailsi Link Canal (SM Link-C) and Shahdra Bridge (SB) (Fig. 1). Thirty samples were taken from each sampling site including fingerlings (TL varied from 1.4-2.8cm) and mature (TL varied from 84-110cm). Dorsal muscle tissues were collected at the sampling sites and kept in marked polythene bags for DNA isolation. Samples were labeled with site code and immediately preserved in crushed icebox at temperature -20oC. By following the Sambrook and Russell (2001) standard phenol-chloroform DNA isolation technique with slight modifications, the DNA extraction from dorsal muscles tissues was carried out. Approximately 25mg of muscle tissues were cut and chopped after the scales and spikes were removed. DNA was isolated from small quantity (2mg) of frozen samples. The quality and quantity of isolated DNA was assessed by agarose gel electrophoresis and Nanodrop (Thermo Scientific), respectively.
Table I. Characteristics of microsatellite primers for C. marulius.
|
Sr. No. |
Locus |
Repeat motif |
Sequence of Primers |
T (ᵒC) |
Gene bank accession No. |
|
1 |
CA05 |
(GT)18 |
F: ACTAATCTCTGGTCGTCTCC R: ATGAATGATAGCCTCTGGTG |
56 |
GU253344 |
|
2 |
CA07 |
(GT)28 |
F: ATACGGTAGTTTGACGGTGG R: GTCTGACCTTCCAAAACTG |
55 |
GU253347 |
|
3 |
CA08 |
(TG)28 |
F: CTGATGTCCAATCGTGAAGG R: CTCCCACCAACTGAGAAACT |
55 |
GU253348 |
|
4 |
CA09 |
(CA)11 |
F: CTACACCTGGGTTTTCACAC R: CTTCACCTTCTACTTCTGGAG |
58 |
GU253349 |
|
5 |
CA10 |
(CA)20 |
F: ACTGTGTCTTGCTCTTGTCTG R: CAGGCAAGTAAGCACAATTC |
58 |
GU253350 |
Amplification of microsatellite loci
The DNA of isolated microsatellite loci was amplified by polymerase chain reaction (PCR) using species specific primers of Channa marulius isolated by McConnell et al. (2001). The characteristics of microsatellite primers are given in Table I. The PCR reaction was performed in 20µL reaction mixture containing template DNA of 50ng, 0.4µL each primer with primer sequence and PCR master mix (Thermo Scientific) 12µL in a thermocycler. The initial denaturation was carried by 5 min at 94 ̊C, annealing of 30 cycles for 1 min at 94oC and final elongation at 72oC for 4 min.
Gel electrophoresis
Following the amplification, 1µL of loading dye was mixed with 5µL of PCR product and loaded on the polyacrylamide gel along with the DNA ladder. After electrophoretic resolution the gel was stained with silver nitrite solution. With the help of pUC18DNA sequencing ladder (Thermo Scientific, USA) the size of all the alleles was determined. The bands were calculated manually two bands at extreme for diploid individuals.
Data analysis
The genotypic data of each locus obtained from counting of the bands, was accurately examined by means of different genetics software and systematic programs to determine the genetic assortment of every population. Various genetic parameters like allele frequency, number of alleles (Na), allelic richness (Ar) and inbreeding coefficient (FIS) were computed with program FSTAT Ver. 2.9.3.2 (Goudet, 2002).
The POPGENE software Ver.1.31 was used to measure the heterozygosity (H) and deviation from Hardy-Weinberg Equilibrium (HWE) at each locus (Yeh et al., 1999). ARLEQUIN software Ver. 3.1 was used to calculate the Analysis of Molecular Variance (AMOVA) (Excoffier et al., 2005). The pairwise genetic differentiation of all the populations was determined and UPGMA dendrogram (Miller, 1997) based on Nei’s (1972) unbiased genetic distance constructed by using TFPGA software (Weir and Cockerham, 1984).
Results
A total of five microsatellite loci were amplified to measure the level of genetic polymorphism among wild populations of Channa marulius. All the examined microsatellite loci showed the distinct levels of polymorphism in this study. The allele frequency average values ranged from 0.020 to 0.227 while the allele size was observed ranging from 170 to 330 base pairs (bp) in the present study.
Table II. Genetic diversity at examined microsatellite loci in natural populations of C. marulius.
|
Populations/ Parameter |
Locus |
Average |
||||
|
CA-05 |
CA-07 |
CA-08 |
CA-09 |
CA-10 |
||
|
Head Sidhnai (HS) |
||||||
|
Na |
13 |
13 |
13 |
13 |
13 |
13 |
|
Ar |
12.998 |
12.999 |
13 |
12.966 |
12.999 |
12.992 |
|
Ho |
0.933 |
0.700 |
0.767 |
0.900 |
0.867 |
0.833 |
|
He |
0.852 |
0.862 |
0.821 |
0.905 |
0.890 |
0.866 |
|
FIS |
0.138 |
0.155 |
0.093 |
0.078 |
-0.074 |
0.078 |
|
PHWE |
0.024NS |
0.001* |
0.127NS |
0.058NS |
0.001* |
----- |
|
Head Panjnad (HP) |
||||||
|
Na |
11 |
11 |
10 |
10 |
11 |
10.6 |
|
Ar |
11 |
10.999 |
10 |
10 |
10.999 |
10.600 |
|
Ho |
0.800 |
0.700 |
0.767 |
0.767 |
0.767 |
0.760 |
|
He |
0.856 |
0.873 |
0.812 |
0.915 |
0.888 |
0.869 |
|
FIS |
0.110 |
0.068 |
0.204 |
0.083 |
0.073 |
0.108 |
|
PHWE |
0.307 NS |
0.0005* |
0.001* |
0.099NS |
0.085NS |
----- |
|
Sidhnai-Mailsi link canal (SM link canal) |
||||||
|
Na |
8 |
8 |
8 |
8 |
8 |
8 |
|
Ar |
9 |
9 |
8.999 |
8.966 |
9 |
8.993 |
|
Ho |
0.733 |
0.800 |
0.733 |
0.767 |
0.733 |
0.753 |
|
He |
0.851 |
0.860 |
0.808 |
0.908 |
0.898 |
0.865 |
|
FIS |
0.060 |
0.091 |
0.215 |
0.204 |
0.186 |
0.151 |
|
PHWE |
0.002 * |
0.155 NS |
0.101NS |
0.001 * |
0.047NS |
----- |
|
Shahdra bridge (SB) |
||||||
|
Na |
8 |
8 |
8 |
7 |
8 |
7.8 |
|
Ar |
8 |
8 |
7.967 |
8 |
7.999 |
7.993 |
|
Ho |
0.733 |
0.767 |
0.767 |
0.667 |
0.700 |
0.727 |
|
He |
0.835 |
0.868 |
0.809 |
0.910 |
0.896 |
0.864 |
|
FIS |
0.171 |
0.237 |
0.266 |
0.155 |
0.041 |
0.174 |
|
PHWE |
0.004 * |
0.088NS |
0.002* |
0.589NS |
0.003 * |
----- |
|
Head Balloki (HB) |
||||||
|
Na |
6 |
6 |
6 |
6 |
6 |
6 |
|
Ar |
6 |
6 |
6 |
6 |
6 |
6 |
|
Ho |
0.767 |
0.700 |
0.667 |
0.700 |
0.667 |
0.700 |
|
He |
0.830 |
0.873 |
0.821 |
0.904 |
0.889 |
0.863 |
|
FIS |
0.174 |
0.281 |
0.214 |
0.169 |
0.033 |
0.175 |
|
PHWE |
0.560 NS |
0.238NS |
0.001* |
0.114NS |
0.005* |
----- |
Na, number of alleles; Ar, allelic richness; Ho, observed heterozygosity; He, expected heterozygosity; Fis, inbreeding coefficient; PHWE, Hardy-Weinberg equilibrium
Genetic diversity
The mean values of number of alleles (Na) and allelic richness (Ar) ranged from 6–13 and 6–12.992, respectively. The maximum value of Na and Ar was calculated in fish population collected from HS while, the lowest in the HB population. The value of observed heterozygosity (Ho) was noted lower than the value of expected heterozygosity (He) in the present study. The range of average values for Ho was observed from 0.700–0.833 while, the value of He was measured as 0.863–0.869. High level of heterozygosity, both Ho and He was seen in the fish populations of HS and HP, respectively while, the lowest in BHW population. On average, all the examined loci showed limited level of Ho in comparison to He. The mean FIS (inbreeding coefficient) value varied from 0.078 to 0.175. Highest FIS value was observed in BHW fish population while, the lowest in HS population. Out of 25 tests, 11 were found to be deviated from HWE significantly at p˂0.05 in this study (Table II).
Genetic structure
The population genetic differentiation increased as the geographical distance increased. The estimates of pair-wise FST indicated the low genetic differentiation among all the studied populations of C. marulius. Minimum level of differentiation (0.0054) was observed for the HS and SM-Link Canal while, the highest (0.0128) was observed for the HP-SB population pairs (Table III). Among pairs of populations, the unbiased genetic distance indicated considerable variation (P<0.05) in magnitude. The maximum genetic distance was observed 0.0947 for the HP-SB while, the minimum 0.0391 was noted for the HS and SM-Link Canal, population pairs. The highest genetic identity 0.9617 was observed for the HS and SM-Link Canal while, the lowest was noted 0.9097 for the HP-SB, population pairs (Table IV).
Table III. Pair wise population differentiation among the wild populations of C. marulius.
|
Population |
HS |
HP |
SM-link canal |
SB |
HB |
|
HS |
- |
||||
|
HP |
0.0075* |
- |
|||
|
SM-link canal |
0.0054* |
0.0074* |
- |
||
|
SB |
0.0118* |
0.0128* |
0.0096* |
- |
|
|
HB |
0.0085* |
0.0127* |
0.0086* |
0.0058* |
- |
*Significant at P<0.05. For details of population see Table II.
Analysis of Molecular Variance (AMOVA) for five microsatellite loci revealed that majority (77.21%) of the variation was present within individuals and 15.48% among individuals within populations (Table V). An unweighted pair group method with arithmetic mean (UPGMA) analysis was followed to examine the genetic relatedness among entire natural fish populations. Two major clusters were observed by the construction of phylogenetic tree (Fig. 2). The cluster one included only HP population whereas, the second cluster is divided into two sub-clusters containing SB, HB, HS and SM-Link Canal fish populations.
Table IV. Pair-wise genetic distance (below diagonal) and genetic identity (above diagonal) among the natural populations of C. marulius.
|
Population |
HS |
HP |
SM-link canal |
SB |
HB |
|
HS |
- |
0.9378 |
0.9617 |
0.9194 |
0.9346 |
|
HP |
0.0642 |
- |
0.9483 |
0.9097 |
0.9112 |
|
SM-link canal |
0.0391* |
0.0531 |
- |
0.9252 |
0.9322 |
|
SB |
0.0840 |
0.0947 |
0.0777 |
- |
0.9547 |
|
HB |
0.0677 |
0.0930 |
0.0703 |
0.0464* |
- |
*Significant at P<0.05. For details of population see Table II.
Table V. Analysis of molecular variance (AMOVA) for natural populations of C. marulius.
|
Source of variance |
Df |
MSS |
Variance |
% Variation |
|
Among populations |
4 |
19.5 |
0.26 |
7.31 |
|
Among individuals within populations |
173 |
2.16 |
0.17 |
15.48 |
|
Within individuals |
179 |
1.87 |
1.98 |
77.21 |
Discussion
The genetic diversity of natural fish populations is being devastated due to the anthropogenic interventions. Maintaining the genetic diversity is critical because the presence of genetic variation determines the capacity for genetic improvement and fitness of a population (Schaal et al., 1991). It is imperative to know about the level of genetic diversity in natural populations not only for their conservation but also for the sustainability of other aquaculture species.
All the genetic parameters studied in the present research indicated that the level of genetic diversity in all the wild populations of C. marulius was low-to-moderate. The number of alleles (Na) at different loci varied from 6 to 13. The highest mean values of Na and Ar was detected in fish population captured from HS which demonstrated that elevated level of genetic diversity is present among HS populations as compared to other populations. Allelic richness (Ar) is the basic parameter to measure the level of genetic diversity in all populations. The calculation of Ar is a complex process dependent upon the effective population size (Steven, 2004). In this study, the values of number of alleles and allelic richness were noted limited that are mainly affected by the effective size of populations. Related results about low level of genetic diversity were reported by Yang et al. (2012) in riverine population of Chinese Catfish Leiocassis longirostris and Abdul et al. (2009) in wild stocks of Yellow Catfish, Horabagrus brachysoma. The average values of observed heterozygosity (Ho) and expected heterozygosity (He) ranged from 0.700 to 0.833 and 0.863 to 0.868, respectively. The He values were observed higher as compared to Ho values that could be attributed to the effect of overfishing and deterioration in breeding grounds of natural fish populations. Consistent results were explained by Musammilu et al. (2014) who observed moderate level of heterozygosity in wild Gonoproktopterus curmuca populations. The low level of genetic diversity among riverine Channa striata populations may be due to the bottleneck effect as revealed by Jamaluddin et al. (2011). FIS (inbreeding coefficient) measures the frequencies of observed heterozygosity compared to expected heterozygosity and effective population size is reduced due to the high rate of inbreeding in natural populations. On average, the maximum FIS values were found positive in BHW population that indicated the excess level of homozygosity in that population. Because of inbreeding, genetic diversity is lost in populations of fish species (Ramstad et al., 2004). Thai et al. (2007) described the similar results about loss of genetic diversity because of inbreeding in natural populations of Cyprinus carpio by using SSR markers.
Out of 25 tests (P˂0.05), 11 were found to be deviated from HWE after applying the multiple test corrections in natural populations of C. marulius. This deviation from HWE was caused by several factors like non random sampling, inbreeding and random mating. Significant departure from HWE was also observed in another study by Zhou et al. (2004) on microsatellite diversity in Chinese Common Carp. Several factors, e.g., null alleles, inbreeding, bottleneck effect and random genetic drift are the main reason of deviation from HWE stated by Castric et al. (2002).
Understanding the genetic structure of a species is crucial for developing the conservation and management strategies for natural as well as threatened fish species. In this study, positive correlation between FST and geographical distance was noted. Some dissimilarity was also observed due to the poor data of isolation by distance in which populations SB and HB deviated from straight line. Delimited dispersal of populations due to geographical distance was reported by Rahim et al. (20l2) in Channa striata populations. Lack of genetic differentiation among adjacent populations is expected but when distant populations show less genetic differences, then demographic and historical explanations is the main reason to justify such less genetic differentiation that might include the ancient connectivity among populations (Steven, 2004). The population genetic distance increased as the geographical distance increased and sharing of genes decreased among populations with the minimum gene flow (Li et al., 2011). The pair-wise values of population differentiation determine the unbiased genetic distance and identity between the pairs of populations. The maximum level of genetic distance was found among the HP and SB while the minimum genetic distance was observed among the population pair of HS-SM-Link Canal suggesting that both populations probably share the same genetic origin. The results of genetic identity were found antagonistic to that of genetic distance in the present study. Parallel results were reported about population genetic structure of C. carpio by Yousefian (2011).
AMOVA as a suitable means for determination of population structure and between population variations showed that majority of variation was related to within population (93%) than the between populations (7%). The small variation between populations is also confirmed by FST values. Similar findings related to AMOVA were also observed by Hussain et al. (2019) in riverine C. marulius. In this study, two major clusters were found among the wild populations by constructing the UPGMA dendrogram to examine the genomic resemblance among the populations. In first cluster only HP population was included while, the second cluster was divided into two sub-clusters containing SB, HS, HB and SM-Link Canal. Both the populations on the same clade revealed the recent expansion among C. marulius populations and suggested thatthe existence of non-crossable barriers and the species’ non-migratory habit induce the genetic difference across distant riverine populations.
Conclusions
The present study inferences revealed that habitat destruction due to industrial activities, agriculture runoff and construction of dams on River Ravi is the main reason of limited connectivity among C. marulius populations to reduce the effective population size and increase inbreeding depression. These anthropogenic activities must be carefully managed and effective management strategies should be implemented to avoid further habitat fragmentations in order to conserve and maintain the populations of C. marulius. Moreover, hatchery operations and open water restocking need to be checked to avoid the genetic contamination of natural populations. The findings of this study would be helpful in formulating the efficient management plans in fisheries department at government and semi-government level.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Abdul-Muneer, P.M., Gopalakrishnan, A., Musammilu, K.K., Mohindra, V., Basheer, V.S. and Lakra, W.S., 2009. Genetic variation and population structure of endemic yellow catfish, Horabagrus brachysoma (Bagridae) among three populations of Western Ghat region using RAPD and microsatellite markers. Mol. Biol. Rep., 36: 1779-1791. https://doi.org/10.1007/s11033-008-9381-6
Agosthinho, A.A., Pelicice, F.M. and Gomes, L.C., 2008. Dams and the fish fauna of the Neotropical region: impacts and management related to diversity and fisheries. Braz. J. Biol., 68: 1119-1132. https://doi.org/10.1590/S1519-69842008000500019
Ashley, M.V., Willson, M.F., Pergams, O.R.W., DJO’Dowd, Gende, S.M. and Brown, J.S., 2003. Evolutionarily enlightened management. Biol. Conserv., 111: 115-123. https://doi.org/10.1016/S0006-3207(02)00279-3
Banerjee, T., Raj, K.D. and Misra, V., 2008. Conservation of natural fish population. Proceedings of Taal 2007: The world 12th Lake Conference, India. pp. 562-567.
Bhatti, M.Z., 2012. Some studies on the reproductive biology of sol (Channa marulius) in the Punjab, Pakistan. Ph.D. dissertation (unpublished) Dept. Zool., PMAS University of Arid Agriculture Rawalpindi, Pakistan.
Castric, V., Bernatchez, L., Belkhir, K. and Bonhomme, F., 2002. Heterozygote deficiencies in small lacustrine populations of brook charr Salvelinus fontinalis Mitchill (Pisces, Salmonidae): A test of alternative hypotheses. Heredity, 89: 27-35. https://doi.org/10.1038/sj.hdy.6800089
Cheng, L., Liu, L., Yu, X., Wang, D. and Tong, J., 2010. A linkage map of common carp (Cyprinus carpio) based on AFLP and microsatellite markers. Anim. Genet., 41: 191-198. https://doi.org/10.1111/j.1365-2052.2009.01985.x
Chistiakov, D.A., Hellemans, B. and Volckaert, F.A.M., 2006. Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture, 255: 1-29. https://doi.org/10.1016/j.aquaculture.2005.11.031
Excoffier, L., Laval, G. and Schneider, S., 2005. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform., 1: 47-50. https://doi.org/10.1177/117693430500100003
Frankham, R., 2003. Genetics and conservation biology. Comp. Rendus Biol., 326: 22-29. https://doi.org/10.1016/S1631-0691(03)00023-4
Goudet, J., 2002. FSTAT a program to estimate and test gene diversities and fixation indices. Version 2.9.3.2. Institute of Ecology, University of Lausanne, Switzerland.
Hussain, U., Abbas, K., Ahmed, T. and Qadeer, I., 2019. Microsatellite DNA polymorphism of Channa marulius inhabiting River Jhelum. Genet. Aquat. Org., 3: 37-45. https://doi.org/10.4194/2459-1831-v3_2_01
Islam, M.S., Ahmed, A.S.I., Azam, M.S. and Alam, M.S., 2005. Genetic analysis of three river populations of Catla catla using randomly amplified polymorphic DNA markers. Asian-Australas. J. Anim. Sci., 18: 453-457. https://doi.org/10.5713/ajas.2005.453
Jamaluddin, J.A.F., Pau, T.M. and Azizah, M.N., 2011. Genetic structure of snakehead murrel, Channa striata based on cytochrome c oxidase subunit 1 gene: Influence of historical and geomorphological factors. Genet. mol. Biol., 34: 152-160. https://doi.org/10.1590/S1415-47572011000100026
Kucuktas, H., Wang, S., Li, P., He, C., Xu, P., Sha, Z., Liu, H., Jiang, Y., Baoprasertkul, P., Somridhivej, B., Wang, Y., Abernathy, J., Guo, X., Liu, L., Muir, W. and Liu, Z., 2009. Construction of genetic linkage maps and comparative genome analysis of catfish using gene associated markers. Genetics, 181: 1649-1660. https://doi.org/10.1534/genetics.108.098855
Li, S.F., Jia-Wei, X., Qi-Ling, Y., Cheng-Hui, W., Chapman, D.C. and Lu, G., 2011. Significant genetic differentiation between native and introduced silver carp (Hypophthalmichthys molitrix) inferred from mtDNA analysis. Environ. Biol. Fish., 92: 503-511. https://doi.org/10.1007/s10641-011-9870-7
Liu, Z.J. and Cordes, J.F., 2004. DNA marker technologies and their applications in aquaculture genetics. Aquaculture, 238: 1-37. https://doi.org/10.1016/j.aquaculture.2004.05.027
McConnell, S.K.J., Leamon, J., Skibinski, D.O.F. and Mair, G.C., 2001. Microsatellite markers from the Indian major carp species, Catla catla. Mol. Ecol. Notes, 1: 115-116. https://doi.org/10.1046/j.1471-8278.2000.00025.x
Miller, M.P., 1997. Tools for population genetic analyses (TFPGA) V l.3: A windows program for the analysis of allozyme and molecular genetic data.
Musammilu, K.K., Abdul-Muneer, P.M., Gopalakrishnan, A., Basheer, V.S., Gupta, H., Mohindra, V., Lal, K. and Ponniah, A.G., 2014. Identification and characterization of microsatellite markers for the population genetic structure in endemic red-tailed barb, Gonoproktopterus curmuca. Mol. Biol. Rep., 41: 3051-3062. https://doi.org/10.1007/s11033-014-3164-z
Nei, M., 1972. Genetic distance and molecular phylogeny. In: Population genetics and fishery management (eds. N. Ryman and F.M. Utter). University of Washington, Washington.
Perrier, C., Guyomard, R., Bagliniere, J.L. and Evanno, G., 2011. Determinants of hierarchical genetic structure in Atlantic salmon populations: environmental factors vs. anthropogenic influences. Mol. Ecol., 20: 4231-4245. https://doi.org/10.1111/j.1365-294X.2011.05266.x
Rahim, M.H.A., Ismail, P., Alias, R., Muhammad, N. and Jais, A.M., 2012. PCR-RFLP analysis of mitochondrial DNA cytochrome b gene among Haruan in Malaysia. Gene, 494: 1-10. https://doi.org/10.1016/j.gene.2011.12.015
Ramstad, K.M., Woody, C.A., Sage, G.K. and Allendrof, F.W., 2004. Founding event influence genetic population structure of sockey salmon in Lake Clark, Alaska. Mol. Ecol., 13: 277-290. https://doi.org/10.1046/j.1365-294X.2003.2062.x
Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual. 3rd Ed. Cold Spring Harbor Laboratory Press, New York, USA.
Schaal, B.A., Leverich, W.J. and Rogstad, S.H., 1991. Comparison of methods for assessing genetic variations in plant conservation biology. In: Genetics and conservation of rare plants (eds. D.A. Falk and K.E. Holsinger). Oxford University Press, New York, pp. 123-134.
Steven, T.K., 2004. Counting alleles with rarefaction: Private alleles and hierarchical sampling designs. Conserv. Genet., 5: 539-543. https://doi.org/10.1023/B:COGE.0000041021.91777.1a
Sunnucks, P., 2000. Efficient genetic markers for population biology. Trends Ecol. Evol., 15: 199-203. https://doi.org/10.1016/S0169-5347(00)01825-5
Thai, B.T., Burridge, C.P. and Austin, C.M., 2007. Genetic diversity of common carp in Vietnam using four microsatellite loci. Aquaculture, 269: 174-186. https://doi.org/10.1016/j.aquaculture.2007.05.017
Vandewoestijne, S., Schtickzelle, N. and Baguette, M., 2008. Positive correlation between genetic diversity and fitness in a large, well-connected metapopulation. BMC Biol., 6: 46. https://doi.org/10.1186/1741-7007-6-46
Weir, B.S. and Cockerham, C.C., 1984. Estimating F statistics for the analysis of population structure. Evolution, 38: 1358-1370. https://doi.org/10.1111/j.1558-5646.1984.tb05657.x
Yang, G., Xiao, M., Yu, Y. and Xu, S., 2012. Genetic variation at mtDNA and microsatellite loci in Chinese longsnout catfish (Leiocassis longirostris). Mol. Biol. Rep., 39: 4605-4617. https://doi.org/10.1007/s11033-011-1252-x
Yeh, F.C., Yang, R.C. and Boyle, T., 1999. POPGENE V. 1.31: Microsoft windows-based free software for population genetic analysis. University of Alberta, Edmonton.
Yousefian, M., 2011. Genetic variations of Common Carp (Cyprinus carpio L.) in South-Eastern part of Caspian Sea using five microsatellite loci. World J. Zool., 6: 56-60.
Zhou, J., Wu, Q., Wang, Z. and Ye, Y., 2004. Genetic variation analysis within and among six varieties of common carp (Cyprinus carpio) in China using microsatellite markers. Genetika, 40: 1389-1393. https://doi.org/10.1023/B:RUGE.0000044758.51875.25