Research Article

Trichomonas Gallinae Prevalence and Genetic Characteristics from Racing Pigeons in Thi-Qar Province, Iraq

Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid

Microbiology branch, College of Veterinary Medicine, University of Thi-Qar, Iraq.

Abstract | Trichomonas gallinae, a protozoan widely found in pigeons and other wild birds, causes the parasitic disease known as “avian trichomoniasis”. The complications of this illness include lesions in the upper gastrointestinal tract. The present study’s goal would be to study the prevalence and genetic characteristics of T. gallinae in racing pigeons in Thi-Qar province, Iraq, utilizing the ITS1-5.8s rRNA-ITS2 gene. 100 samples were collected from racing pigeons between September and December 2022. The swabs were taken from the throat, pharynx, crop, and esophagus with a cotton swab. Utilizing direct smear and polymerase chain reaction (PCR) techniques, 30 (30%) of the 100 collected samples were found to be positive. A DNA sequence of 372 bp length that partly encompassed the coding region of the ITS1-5.8s rRNA-ITS2 gene within ten samples (assigned 1-10) was amplified in this study. The PCR amplicons that were found in the amplified genetic region were directly sequenced. The detected variations were then used to build a phylogenetic tree, which was used to evaluate the precise phylogenetic distances in addition to other relative parastic sequences. According to the present findings, there is almost 99% homology between the sequences of T. gallinae and the samples that were under investigation. In this investigation, the genetic variants C64T, G236A, C243T, and A363C were found.

 

Keywords |Thi-Qar province , genetic variation, , T.gallinae, rtPCR, racing pigeons.


Received | May 29, 2023; Accepted | June 20, 2023; Published | September 15, 2023

*Correspondence | Ahmed Jaafar Mousa, Microbiology branch, College of Veterinary Medicine, University of Thi-Qar, Iraq; Email: [email protected]

Citation | Mousa AJ, Hamid NR (2023). Trichomonas gallinae prevalence and genetic characteristics from racing pigeons in Thi-Qar Province, Iraq. Adv. Anim. Vet. Sci. 11(10): 1690-1696.

DOI | http://dx.doi.org/10.17582/journal.aavs/2023/11.10.1690.1696

ISSN (Online) | 2307-8316

 

BY%20CC.png 

Copyright: 2023 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Trichomonas gallinae is a protozoan that causes an important disease in pigeons known as avian trichomoniasis. It is anaerobic, flagellates and classified in the class Zoomastigophorea and the phylum Trichomonadida (Muzeal & Khudeir, 2022). T. gallinae primarily affects the digestive and respiratory systems of birds.

This disease is usually referred to as “canker” when it affects pigeons. Some strains are virulent, while others are asymptomatic or have mild symptoms. Yellow-green secretions with an unpleasant odor from the mouth, diarrhea, emaciation, severe weight loss, The onset of decaying lesions, the appearance of cheddar-like sores, and oral irritations that prevent swallowing and cause catastrophic respiratory failure are all symptoms of this condition.

T. gallinae is spread between birds through parents feeding their young and ingesting contaminated food and water. It is also spread among raptors and carnivorous birds by consuming infected birds. The parasite can be diagnosed by the following methods: observing the characteristic lesions of the disease; observing the protozoa and its flagella microscopically; culturing the parasite; and using molecular methods.

In the subject of molecular epidemiology of microorganisms, polymeras chain reaction and related methods are often recognized as sensitive and reliable methodologies for genetic investigations (Thomas, 2017).

Around the world, different T. gallinae genotypes have been identified, including genotypes A and B in China (S. Y. Feng et al., 2018) , in Spain (Quillfeldt et al., 2018), in Iran (Arabkhazaeli et al., 2020) ,whereas genotype A has been discovered in Iraq (Fadhil & Faraj, 2019).

Although trichomoniasis in Iraq has been the subject of numerous investigations, there have been few attempts to genetically characterize this parasite. The significance of trichomoniasis and the absence of thorough research on phylogenetic distribution and diversity in the past drove the need for such a study to be carried out in Thi-Qar province, Iraq. The current investigation sought to determine the frequency and genetic makeup of T.gallinae in racing pigeons in the Iraqi province of Thi-Qar.

MATERIALS AND METHODS

Samples collection                                                              

Between September 2022 and December 2022, 100 domestic pigeon mouth, pharynx, crop, and esophagus samples were taken in Thi-Qar Province of Iraq.

Microscopic Examination

Using sterile, cotton-tipped applicators that had been previously moistened, samples were randomly obtained from the mouths, pharynx, crop, and esophagus of pigeons (wet mount method). If, under a light microscope, motile and flagellated protozoa were seen, the Trichomonas were recognized (Collántes-Fernández et al., 2018).

DNA extraction

Using the gSYNCTM DNA Extraction Kit, Geneaid UK, in accordance with the manufacturer’s protocol, genomic DNA was extracted from each and every isolate of Trichomonas gallinae. Until PCR analysis, samples were kept frozen at a temperature of -20 oC.

PCR detection of genes

The primers given in Table 1 were used to amplify the ITS1-5.8s rRNA-ITS2 gene. The 20 μL total reaction tube volume is composed of 5 μL of master mix, 1.5 μL of forward and reverse primers specifically designed for each gene, and 5 μL of DNA template. To finish off the volume, water free of nucleases was added. By combining 5 μL of DNA with loading dye (safety dye), loading the mixture into the designated wells, and subjecting the mixture to an electric field (70 volts for 45–60 min), the separated DNA samples were electrophoresed. The thermocycling program of the gene began with initial denaturation for ten minute at 95 oC, one cycle, proceeded by 35 cycles, including 30 second at 95 oC, 30 second at 60 oC,and 1 minute at 72 oC, then last extension at 72 oC for ten minute and 1 cycle.

Table 1: Primer sequences for amplifying genes

Source

Size of the item

Primer Sequences (5´- 3´)

Gene

(Felleisen, 1997)

372bp

 

F*:TGCTTCAGTTCAGCGGGTCTTCC

R: * CGG TAG GTG AACCTG CCG TTG

ITS1-5.8s

rRNA-ITS2

 

Real time PCR

The primer sequences of the ITS1–5.8s rRNA–ITS2 gene are listed in Table 2. The RT-PCR reaction mixture (20 μL) is composed of sample DNA (3 μL), each forward and reverse primer (1 μL), syber green master mix (12.5 μL), and sterile deionized water. The qPCR procedure was performed in triplicate. The qPCR program began with initial denaturation for 3 minute at 94 oC, one cycle, following 40 cycles, including 30 second at 94 oC, 1 minute at 60 oC and extention for 30 second at 72 oC.

Table 2: Primer sequences used for realtime PCR.

Source

Size of the item

Primer Sequences

(5´- 3´)

Gene

Mohammed et al. 2023

372bp

F:CCTGCCGTTGGATCAGTTCT

 

R:AGGAGCCAAGACATCCGTTG

ITS1-5.8s rRNA-ITS2

 

DNA Sequencing of PCR amplicons

The strong positive samples (10) were amplified with conventional PCR and then send for made sequence and sending to koria. According to the instructions provided by the sequencing provider (Macrogen Inc., Geumchen, Seoul, South Korea), the resolved PCR amplicons were commercially sequenced starting at the forward termini. The annotation and variances were only discernible in clean chromatographs produced from ABI sequence data, proving that they are not the result of PCR or sequencing artifacts. By contrasting the observed nucleic acid sequences of the parasite samples with the retrieved reference sequences from the parasitic database, it was possible to identify the virtual posi positions and other details of the retrieved PCR fragments.

 

Analysis of sequencing data

As long as the corresponding sequences in the reference database matched, PCR product sequencing results were edited, aligned, and evaluated using BioEdit Sequence Alignment Editor Software Version 7.1 (DNASTAR, Madison, WI, USA). Both in PCR amplicons and in the proper places within the reference genome, the detected nucleic acids were given numbers. Each variant discovered in the T. gallinae gene was annotated by SnapGene Viewer version 4.0.4 (https://www.snapgene.com).

Creation of phylogenetic tree

Spesific phylogenetic tree was constructed in this study. Using the NCBI-BLASTn service, the identified variations were compared to their neighboring homologous reference sequences (S.-Y. Feng et al., 2018). The newly identified variant was then incorporated into an inclusive tree made by applying the neighbor-joining method and visualized with the use of the iTOL suit to produce a traditional clades formation tool. (Letunic & Bork, 2019). As a result, each phylogenetic species group’s sequences were annotated in the phylogenetic tree.

 

RESULTS

Occurrence of T. gallinae in pigeons

In this investication, 30 of the 100 samples examined yielded positive results for microscopy and PCR, indicating that this protozoan is common in 30% of domestic pigeons. All 30 samples that tested positive for T. gallinae upon microscopic examination were confirmed to be positive by the PCR assay. Furthermore, the ten isolates’ ITS1-5.8s rRNA-ITS2 sequences were successfully amplified by PCR using the designated primers, as shown by the band size of about 372 bp (Figure 1).

ITS1, 5.8S, and ITS2 sequence phylogenetic analyses

Ten samples were included inside this locus, with an amplicon length of roughly 372 bp. Before being sent for sequencing, the amplified amplicons were all examined to make sure they all showed sharp, specific, and clean bands.  
By using an NCBI blast, the sequencing reactions revealed the amplified products’ confirmed identities. Regarding the 372 bp PCR amplicons of the currently targeted ITS1-5.8 rRNA-ITS2 sequences, the NCBI BLASTn engine showed a high degree of sequence similarity between the sequenced samples and T. gallinae sequences. The NCBI BLASTn engine showed that there was approximately 99% homology with the expected target, which partially encompassed the coding section of the ITS1-5.8s rRNA-ITS2 gene sequences, by comparing the observed DNA sequences of the samples under investigation with the returned DNA sequences. Comparing the 372 bp samples’ alignment findings to the matching T. gallinae referencing sequences, it was possible to identify four nucleic acid variations (Fig. 2). These sequences were created by comparing the samples we looked at with the most similar sequences that were stored in the NCBI database.

The exact sites of the identified alterations were documented in (Table 3) to provide a summary of all the findings from the sequenced 372bp segments.

 

Table 3: The pattern of the differences that have been noticed in the 372bp of the ITS1-5.8s rRNA-ITS2 amplicons when compared to the NCBI reference sequences.

Sample

Variant

Position in the PCR fragment

1,2,3,4,5,6,7,8,9,10 C64T 64
1,2,3,4,5,6,7,8,9,10 G236A 236
1,2,3,4,5,6,7,8,9,10 C243T 243
1,2,3,4,5,6 A363C

363

 

A phylogenetic tree was built using the analyzed ITS1-5.8s rRNA-ITS2 nucleic acid sequences in the examined parasite samples. The total number of aligned nucleic acid sequences in the currently built tree is 27. Trichomonas gallinae, the only species contained in this tree, is also the sole nucleic acid sequence that has been included. The ITS1-5.8s rRNA-ITS2 sequences of T. gallinae were

found to be highly diverse in this organism, clustering into numerous neighboring phylogenetic branches based on the genetic sequences that were examined (Fig. 3).

Submission in NCBI

The local isolates submitted in gene bank under accessions number: LC768806, LC768807, LC768808, LC768809, LC7688010, LC7688011, LC7688012, LC7688013, LC7688014, LC7688015.

 

Discussion

Using sequence analysis of the ITS1-5.8S rRNA-ITS2 gene in 10 samples, this study was carried out on racing pigeons in Thi-Qar Governorate, Iraq, to discover the genetic variations of Trichomonas gallinae for the first time. Because it affects a variety of birds and shows high variation across T. gallinae isolates, avian trichomonosis, which is caused by T. gallinae, is significant. (Ayati et al., 2023). The ability to identify intraspecific genetic variations among Trichomonads utilizing sequence analysis of the ITS1- 5.8S rRNA-ITS2 was established in several studies. (Alrefaei, 2020).

The diversity observed within the majority of studied samples might be related to the four variations detected in the majority of investigated samples. The genetic diversity of T. gallinae was studied using sequence analysis of ITS1-5.8S-ITS2 in three types of falcons in Saudi Arabia (Alrefaei, 2020).

All study samples (1–10) were exposed to three variations (C64T, G236A, and C243T) in the position (64, 236, and 243). While samples (7, 8, 9, and 10), which did not exhibit variation in position 363 (A363C), were detected in the other studied samples (1, 2, 3, 4, and 6).

According to the present findings, there is 99% similarity between the sequences of T. gallinae and the isolates that were under investigation.

Some research found different proportions of similarity between the studied samples and those registered in the Gen Bank, such as OM688823 from Egypt, which matched 64% with MK771128.1 from KSA, and isolate OM679422.1 from Egypt, which was 85% identical to MT300160.1 from KSA (Mohamed et al., 2023).

Other research found 100% similarity with a number of sequences, including sequences MK932773, isolated from a European turtle dove by (Santos et al., 2019).

It was found that there is a link between the appearance of necrotic ingluvitis lesions and genetic diversity when using ITS  region sequencing of T. gallinae in Europe, the UK, and the USA (Girard et al., 2014).

There were two genotypes of ITS1–5.8S-rRNA –ITS2 widely distributed among bird populations, a new variant, and also two sequences with mixed patterns. Genotype ITS-OBT-Tg-1 was associated with the existence of visible lesions in birds (Sansano-Maestre et al., 2016).

T. gallinae isolates from several bird species were sequenced and found to contain 29 distinct ITS 1 genotypes. Positive samples of T. gallinae sequence C obtained from pigeons and hens displayed obvious clinical signs or visual lesions (Albeshr & Alrefaei, 2020).

The 18S rRNA gene for 10 sequence analysis findings showed the number and locations of variations and revealed that 5 samples were 100% identical and 5 samples had variation in the gene’s sequence. Following sequence analysis, 10 samples showed genotype A (Fadhil & Faraj, 2019).

The results of this study are consistent with studies that recorded genetic variations in T. gallinae protozoa. Including the study conducted in Iraq by (Fadhil & Faraj, 2019) and the study in Egypt by (Mohamed et al., 2023), while disagreeing with some of the findings by (Santos et al., 2019).

The most closely related sequences to the examined samples (1–10), according to the phylogenetic tree, belonged to T. gallinae.

Two phylogenetic locations were seen from the studied samples depending on whether they were endemic to the main T. gallinae branches. Nearly all of the samples’ observed differences led to their varying neighboring phylogenetic locations in the tree. These neighboring positions were linked to the regularity of changes within the examined samples, which resulted in varying distributions of these samples in these referred phylogenetic positions. The isolate 1 sample, however, was also discovered to be in a different branch and close to the GenBank accession numbers KT869154.1, KT869153.1, KT869156.1, MN446018.1, MK770861.1, KT869151.1, and KT869150.1. Other study samples, however, were found in different branches.

The investigated samples (isolate 3, isolate 4, and isolate 10) were positioned nearness with GenBank accession numbers: EU881912.1, KX459475.1, U86614.1, and MH733816.1. While, other local samples (isolate2, isolate5, isolate6, isolate7, isolate8, and isolate9) were located closeness with KX459474.1, KX459476.1, OM688825.1, MK172847.1, MK172846.1, and KT869152.1.

At least two T. gallinae genotypes (A and B) were discovered in birds in the United States, according to phylogenetic analysis of the ITS1-5.8s rRNA-ITS2 region from this study (Girard et al., 2014), as well as to the occurrence of gross lesions in infected animals (Martínez-Herrero et al., 2014).

Conclusion

Canker disease (Trichomonas gallinae) infection is still endemic in pigeons in Thi-Qar province, Iraq. The prevalence rate of the disease in this governorate is close to the prevalence rates recorded in local and international studies. There is genetic diversity in the T. gallinae parasite in the mentioned governorate.

Recommendations

Conducting more molecular studies on the parasite in Iraq and other countries, investigating theeffect of the parasite on the blood picture, and investigating the possibility of transmission of this species to humans.

Acknowledgments

I would like to thank Asst.Prof. Dr. Nothaila Rasheed Hamid for his flexibility, professional ideas, and advice throughout my study, as well as the staff of the Microbiology Department, College of Vet. Med., Thi-Qar University.

Conflicts of interest

The investigation did not involve any conflicts of interest.

Novelty Statement

The study was conducted to investigate the spread of the T. gallinae parasite in racing pigeons and identify the genetic variation by analysis of the sequencing of selected samples because there are no records of avian trichomoniasis in the Thi-Qar province of Iraq, despite its widespread prevalence and the veterinary and economic importance of the disease.

Authors Contribution

Ahmed J. Mousa contributed to the conception and design of the research, the gathering, analysis, and interpretation of data, as well as the writing and revision of the manuscript. Nothaila R. Hamid contributed to data collection, analysis, and interpretation, as well as paper revision.

References

Al-Zubaidei H. H. H. (2023). Trichomonasis detection in pigeons (Columba livia domestica) in Diyala province. Diyala J. Vet. Sci. Print ISSN: 2410-8863. 2(1), 85–97.

Albeshr M.F., Alrefaei A. F. (2020). Isolation and characterization of novel Trichomonas gallinae ribotypes infecting Domestic and Wild birds in Riyadh, Saudi Arabia. Avian Dis., 64(2): 130–134. https://doi.org/10.1637/0005-2086-64.2.130

Alejandro Mateo S., Azami-Conesa I., Martín-Maldonado B., Pastor-Tiburón N., Martín-Hernández R., González-González F., Gómez-Muñoz M.T. (2022). Adaptation of the classical end-point ITS-PCR for the diagnosis of avian trichomonosis to a real-time PCR reveals Bonelli’s eagle as a new host for Trichomonas gypaetinii. Parasitol. Res., 1–8. https://doi.org/10.1007/s00436-022-07693-3

Alrefaei A. F. (2020). Molecular detection and genetic characterization of Trichomonas gallinae in falcons in Saudi Arabia. Plos One, 15(10): e0241411. https://doi.org/10.1371/journal.pone.0241411

Arabkhazaeli F., Madani S.A., Ghorbani A. (2020). Parasitological and molecular survey of scattered parasitism by trichomonads in some avian species in Iran. Avian Pathol., 49(1): 47–55. https://doi.org/10.1080/03079457.2019.1662369

Arfin S., Sayeed M. A., Sultana S., Dash A.K., Hossen M.L. (2019). Prevalence of Trichomonas gallinae infection in pigeon of jessore district, Bangladesh. J. Adv. Vet. Anim. Res., 6(4): 549. https://doi.org/10.5455/javar.2019.f381

Ayati R., Nasr-Abadi N.t., Momeni Z., Shojaei S.s.r. (2023). Prevalence Of Trichomonas Gallinae With Molecular Characterisation And Phylogenetic Analysis In Domestic Pigeons Using Its1-5.8 S Rrna-Its2 Gene In Alborz Province, IraN. Bulgarian J. Vet. Med., 26(1): 65–72. https://doi.org/10.15547/bjvm.2021-0100

Brunthaler R., Teufelbauer N., Seaman B., Nedorost N., Bittermann K., Matt J., Weissenbacher-Lang C., Weissenböck H. (2022). Trichomonosis in Austrian Songbirds—Geographic Distribution, Pathological Lesions and Genetic Characterization over Nine Years. Animals., 12(10): 1306. https://doi.org/10.3390/ani12101306

Bulbul K. H., Shahardar R., Allaie I. M., Wani Z. A., Tramboo S. R., Ashraf A., Maqbool I., Ganaie Z.A., Sheikh I.U., Shubeena S. (2018). Avian trichomonosis with special reference to pigeon. Int. J. Vet. Sci. Anim. Husb., 3: 11–13.

Changes in the diversity and composition of gut microbiota in pigeon squabs infected with Trichomonas gallinae. (2020). Scient. Rep., 10(1): 19978. https://doi.org/10.1038/s41598-020-76821-9

Chavatte J.-M., Giraud P., Esperet D., Place G., Cavalier F., Landau I. (2019). An outbreak of trichomonosis in European greenfinches Chloris chloris and European goldfinches Carduelis carduelis wintering in Northern France. Parasite,. 26. https://doi.org/10.1051/parasite/2019022

Chou S., Hadano S., Kojima A., Yorisaki M., Yasuda, M., Ike, K., Tokiwa T. (2022). Genetic characterization of Trichomonas gallinae (Rivolta, 1878) in companion birds in Japan and the genotypical relationship in the Asia region. J. Microbiol. Immunol. Infect., 55(3): 527–534. https://doi.org/10.1016/j.jmii.2021.05.010

Collántes-Fernández, E., Fort, M. C., Ortega-Mora, L. M., & Schares, G. (2018). Trichomonas. Parasit. Protozoa Farm Anim. Pets., 313–388. https://doi.org/10.1007/978-3-319-70132-5_14

Fadhil L.T., Faraj A.A. (2019). Survey of Trichomonas gallinae isolates in pigeons by microscopy and PCR. Online J. Vet. Res., 23(4): 321–329.

Felleisen R. S. J. (1997). Comparative sequence analysis of 5· 8S rRNA genes and internal transcribed spacer (ITS) regions of trichomonadid protozoa. Parasitology., 115(2): 111–119. https://doi.org/10.1017/S0031182097001212

Feng S.-Y., Chang H., Li F.-H., Wang C.-M., Luo J., He H.-X. (2018). Prevalence and molecular characterization of Trichomonas gallinae from domestic pigeons in Beijing, China. Infect. Genet. Evol., 65: 369–372. https://doi.org/10.1016/j.meegid.2018.08.021

Feng S. Y., Chang H., Li F. H., Wang C. M., Luo J., He H. X. (2018). Prevalence and molecular characterization of Trichomonas gallinae from domestic pigeons in Beijing, China. Infect. Genet. Evol., 65: 369–372. https://doi.org/10.1016/j.meegid.2018.08.021

Girard Y. A., Rogers K. H., Woods L. W., Chouicha N., Miller W.A., Johnson C.K. (2014). Dual-pathogen etiology of avian trichomonosis in a declining band-tailed pigeon population. Infect. Genet. Evol. 24 146–156. https://doi.org/10.1016/j.meegid.2014.03.002

Gornatti-Churria C.D., Loukopoulos P., Stoute S.T., Shivaprasad, H.L., Uzal F. A. (2023). A retrospective study of pigeon herpesviral infection in domestic pigeons in California (1991–2014) and literature review. J. Vet. Diagn. Investigati, 10406387231161052. https://doi.org/10.1177/10406387231161053

Kalita M. K. (2020). Diseases of Pigeon Pea (Cajanus cajan L. Millsp.) and Their Management. In Diseases of Field Crops: Diagn. Manag. (pp. 121–131). Apple Academic Press. https://doi.org/10.1201/9780429321962-7

Letunic I., Bork P. (2019). Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucl. Acids Res., 47(W1): W256–W259. https://doi.org/10.1093/nar/gkz239

Martínez-Herrero M. C., Sansano-Maestre J., López Márquez I., Obón E., Ponce C., González J., Garijo-Toledo M. M., Gómez-Muñoz M.T. (2014). Genetic characterization of oropharyngeal trichomonad isolates from wild birds indicates that genotype is associated with host species, diet and presence of pathognomonic lesions. Avian Pathol., 43(6): 535–546. https://doi.org/10.1080/03079457.2014.967660

Mehmood S., Nashiruddullah N., Ahmed J.A., Borkataki S. (2019). Parasitic affections of domesticated pigeons (Columba livia) in Jammu, India. Ann. Parasitol., 65(1).

Mohamed H.M., Saad A.S.A., Khalifa M. M., Abdel-Maogood S. Z., Awadalla S. M. F., Mousa W. M. (2023). Detection and molecular characterization of Trichomonas gallinae recovered from domestic pigeons in Egypt. Parasitol. Res., 122(1): 257–263. https://doi.org/10.1007/s00436-022-07724-z

Muzeal F. A., Khudeir M. A. A. (2022). Pathological lesions of Trichomonas gallinae in Domastic pigeons (Columba livia) of Al-muthanna province, Iraq. Al-Qadisiyah J. Vet. Med. Sci., 21(2).

Quillfeldt P., Schumm Y. R., Marek C., Mader V., Fischer D. Marx M. (2018). Prevalence and genotyping of Trichomonas infections in wild birds in central Germany. PloS One., 13(8), e0200798. https://doi.org/10.1371/journal.pone.0200798

Saikia M., Bhattacharjee K., Sarmah P. C., Deka D. K. (2022). Comparative Evaluation of Direct Smear and Culture Methods for Detection of Trichomonas gallinae Infection in Pigeon and Chicken of Assam. Int. J. Cur. Sci. Res. Rev., 5(11): 4331–4335. https://doi.org/10.47191/ijcsrr/V5-i11-31

Sansano-Maestre J., del Carmen Martínez-Herrero M., Garijo-Toledo M.M., Gómez-Muñoz M.T. (2016). RAPD analysis and sequencing of ITS1/5.8 S rRNA/ITS2 and Fe-hydrogenase as tools for genetic classification of potentially pathogenic isolates of Trichomonas gallinae. Res. Vet. Sci., 107: 182–189. https://doi.org/10.1016/j.rvsc.2016.05.016

Santos N., Jambas J., Monteiro A., Amaral J., Martins N., Garcia J., Fernández A. M., Tyler K. M., Almeida T., Abrantes J. (2019). Trichomonas infection in a community of free-ranging domestic and wild Columbiformes and bonelli’s eagle (Aquila fasciata). Front. Vet. Sci., 6: 148. https://doi.org/10.3389/fvets.2019.00148

Sigrist B., Ng T. W. C., Albini S., Wolfrum N. (2022). A new duplex real-time PCR for simultaneous detection and differentiation of Tetratrichomonas gallinarum and Trichomonas gallinae. J. Vet. Diagnos. Investigat., 34(4): 631–637. https://doi.org/10.1177/10406387221098069

Tamura K., Stecher G., Kumar S. (2021). MEGA11: molecular evolutionary genetics analysis version 11. Molecul. Biol. Evol., 38(7): 3022–3027. https://doi.org/10.1093/molbev/msab120

Thomas R. C. (2017). Molecular epidemiology of Trichomonas gallinae in European Turtle Doves (Streptopelia turtur). University of Leeds.

Young R. E., Dunn J. C., Vaughan I. P., Mallord J. W., Orsman C. J., Ka M., Diallo M. B., Sarr M., Lormée H., Eraud C. (2023). Investigating the association between diet and infection with Trichomonas gallinae in the European turtle dove (Streptopelia turtur). Environmental DNA. https://doi.org/10.1002/edn3.402

Zigo F., Ondrašovičová S., Zigová M., Kuďelková L. (2019). Impact Of Flight Load On The Health Of Racing Pigeons. “ Anim. Physiol., Nutrit. Welfare., 188.